ID: 948429309

View in Genome Browser
Species Human (GRCh38)
Location 2:237909091-237909113
Sequence ATTCAAGGCTCTCTGGCTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 171}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948429304_948429309 -4 Left 948429304 2:237909072-237909094 CCCCATGGGGCAAGGGCTCATTC 0: 1
1: 0
2: 2
3: 15
4: 142
Right 948429309 2:237909091-237909113 ATTCAAGGCTCTCTGGCTTACGG 0: 1
1: 0
2: 0
3: 22
4: 171
948429306_948429309 -6 Left 948429306 2:237909074-237909096 CCATGGGGCAAGGGCTCATTCAA 0: 1
1: 0
2: 0
3: 11
4: 143
Right 948429309 2:237909091-237909113 ATTCAAGGCTCTCTGGCTTACGG 0: 1
1: 0
2: 0
3: 22
4: 171
948429296_948429309 17 Left 948429296 2:237909051-237909073 CCCTAGAGGCACTCAGGCTGCCC 0: 1
1: 0
2: 0
3: 20
4: 150
Right 948429309 2:237909091-237909113 ATTCAAGGCTCTCTGGCTTACGG 0: 1
1: 0
2: 0
3: 22
4: 171
948429303_948429309 -3 Left 948429303 2:237909071-237909093 CCCCCATGGGGCAAGGGCTCATT 0: 1
1: 0
2: 1
3: 13
4: 115
Right 948429309 2:237909091-237909113 ATTCAAGGCTCTCTGGCTTACGG 0: 1
1: 0
2: 0
3: 22
4: 171
948429295_948429309 21 Left 948429295 2:237909047-237909069 CCTGCCCTAGAGGCACTCAGGCT 0: 1
1: 0
2: 1
3: 20
4: 231
Right 948429309 2:237909091-237909113 ATTCAAGGCTCTCTGGCTTACGG 0: 1
1: 0
2: 0
3: 22
4: 171
948429305_948429309 -5 Left 948429305 2:237909073-237909095 CCCATGGGGCAAGGGCTCATTCA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 948429309 2:237909091-237909113 ATTCAAGGCTCTCTGGCTTACGG 0: 1
1: 0
2: 0
3: 22
4: 171
948429297_948429309 16 Left 948429297 2:237909052-237909074 CCTAGAGGCACTCAGGCTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 279
Right 948429309 2:237909091-237909113 ATTCAAGGCTCTCTGGCTTACGG 0: 1
1: 0
2: 0
3: 22
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948429309 Original CRISPR ATTCAAGGCTCTCTGGCTTA CGG Intronic