ID: 948429310

View in Genome Browser
Species Human (GRCh38)
Location 2:237909104-237909126
Sequence TGGCTTACGGATGCCCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948429303_948429310 10 Left 948429303 2:237909071-237909093 CCCCCATGGGGCAAGGGCTCATT 0: 1
1: 0
2: 1
3: 13
4: 115
Right 948429310 2:237909104-237909126 TGGCTTACGGATGCCCACTGTGG 0: 1
1: 0
2: 1
3: 5
4: 101
948429297_948429310 29 Left 948429297 2:237909052-237909074 CCTAGAGGCACTCAGGCTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 279
Right 948429310 2:237909104-237909126 TGGCTTACGGATGCCCACTGTGG 0: 1
1: 0
2: 1
3: 5
4: 101
948429306_948429310 7 Left 948429306 2:237909074-237909096 CCATGGGGCAAGGGCTCATTCAA 0: 1
1: 0
2: 0
3: 11
4: 143
Right 948429310 2:237909104-237909126 TGGCTTACGGATGCCCACTGTGG 0: 1
1: 0
2: 1
3: 5
4: 101
948429304_948429310 9 Left 948429304 2:237909072-237909094 CCCCATGGGGCAAGGGCTCATTC 0: 1
1: 0
2: 2
3: 15
4: 142
Right 948429310 2:237909104-237909126 TGGCTTACGGATGCCCACTGTGG 0: 1
1: 0
2: 1
3: 5
4: 101
948429296_948429310 30 Left 948429296 2:237909051-237909073 CCCTAGAGGCACTCAGGCTGCCC 0: 1
1: 0
2: 0
3: 20
4: 150
Right 948429310 2:237909104-237909126 TGGCTTACGGATGCCCACTGTGG 0: 1
1: 0
2: 1
3: 5
4: 101
948429305_948429310 8 Left 948429305 2:237909073-237909095 CCCATGGGGCAAGGGCTCATTCA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 948429310 2:237909104-237909126 TGGCTTACGGATGCCCACTGTGG 0: 1
1: 0
2: 1
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948429310 Original CRISPR TGGCTTACGGATGCCCACTG TGG Intronic