ID: 948433334

View in Genome Browser
Species Human (GRCh38)
Location 2:237934650-237934672
Sequence TACAGGCGATGAGCACTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948433334_948433336 -7 Left 948433334 2:237934650-237934672 CCACGCAGTGCTCATCGCCTGTA No data
Right 948433336 2:237934666-237934688 GCCTGTAATCCTAGCACTTTGGG 0: 15701
1: 240057
2: 272945
3: 174764
4: 138480
948433334_948433341 9 Left 948433334 2:237934650-237934672 CCACGCAGTGCTCATCGCCTGTA No data
Right 948433341 2:237934682-237934704 CTTTGGGAGGCCTAGGCAGATGG 0: 40
1: 3331
2: 61902
3: 144128
4: 174530
948433334_948433335 -8 Left 948433334 2:237934650-237934672 CCACGCAGTGCTCATCGCCTGTA No data
Right 948433335 2:237934665-237934687 CGCCTGTAATCCTAGCACTTTGG 0: 7600
1: 143979
2: 282423
3: 215359
4: 145953
948433334_948433338 -4 Left 948433334 2:237934650-237934672 CCACGCAGTGCTCATCGCCTGTA No data
Right 948433338 2:237934669-237934691 TGTAATCCTAGCACTTTGGGAGG 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
948433334_948433340 2 Left 948433334 2:237934650-237934672 CCACGCAGTGCTCATCGCCTGTA No data
Right 948433340 2:237934675-237934697 CCTAGCACTTTGGGAGGCCTAGG 0: 264
1: 17463
2: 223557
3: 264563
4: 169549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948433334 Original CRISPR TACAGGCGATGAGCACTGCG TGG (reversed) Intergenic
No off target data available for this crispr