ID: 948436642

View in Genome Browser
Species Human (GRCh38)
Location 2:237958160-237958182
Sequence TCCATCTCAGGCTGCCCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948436642_948436649 23 Left 948436642 2:237958160-237958182 CCGGGGGGGCAGCCTGAGATGGA No data
Right 948436649 2:237958206-237958228 CATCACTGATGCTCCAAATTTGG No data
948436642_948436650 24 Left 948436642 2:237958160-237958182 CCGGGGGGGCAGCCTGAGATGGA No data
Right 948436650 2:237958207-237958229 ATCACTGATGCTCCAAATTTGGG No data
948436642_948436651 28 Left 948436642 2:237958160-237958182 CCGGGGGGGCAGCCTGAGATGGA No data
Right 948436651 2:237958211-237958233 CTGATGCTCCAAATTTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948436642 Original CRISPR TCCATCTCAGGCTGCCCCCC CGG (reversed) Intergenic