ID: 948436644 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:237958172-237958194 |
| Sequence | ATCCACGCTGTTTCCATCTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 948436644_948436650 | 12 | Left | 948436644 | 2:237958172-237958194 | CCTGAGATGGAAACAGCGTGGAT | No data | ||
| Right | 948436650 | 2:237958207-237958229 | ATCACTGATGCTCCAAATTTGGG | No data | ||||
| 948436644_948436649 | 11 | Left | 948436644 | 2:237958172-237958194 | CCTGAGATGGAAACAGCGTGGAT | No data | ||
| Right | 948436649 | 2:237958206-237958228 | CATCACTGATGCTCCAAATTTGG | 0: 1 1: 0 2: 0 3: 7 4: 135 |
||||
| 948436644_948436651 | 16 | Left | 948436644 | 2:237958172-237958194 | CCTGAGATGGAAACAGCGTGGAT | No data | ||
| Right | 948436651 | 2:237958211-237958233 | CTGATGCTCCAAATTTGGGATGG | 0: 1 1: 0 2: 0 3: 12 4: 137 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 948436644 | Original CRISPR | ATCCACGCTGTTTCCATCTC AGG (reversed) | Intergenic | ||