ID: 948436644

View in Genome Browser
Species Human (GRCh38)
Location 2:237958172-237958194
Sequence ATCCACGCTGTTTCCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948436644_948436649 11 Left 948436644 2:237958172-237958194 CCTGAGATGGAAACAGCGTGGAT No data
Right 948436649 2:237958206-237958228 CATCACTGATGCTCCAAATTTGG No data
948436644_948436650 12 Left 948436644 2:237958172-237958194 CCTGAGATGGAAACAGCGTGGAT No data
Right 948436650 2:237958207-237958229 ATCACTGATGCTCCAAATTTGGG No data
948436644_948436651 16 Left 948436644 2:237958172-237958194 CCTGAGATGGAAACAGCGTGGAT No data
Right 948436651 2:237958211-237958233 CTGATGCTCCAAATTTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948436644 Original CRISPR ATCCACGCTGTTTCCATCTC AGG (reversed) Intergenic