ID: 948436649

View in Genome Browser
Species Human (GRCh38)
Location 2:237958206-237958228
Sequence CATCACTGATGCTCCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948436642_948436649 23 Left 948436642 2:237958160-237958182 CCGGGGGGGCAGCCTGAGATGGA No data
Right 948436649 2:237958206-237958228 CATCACTGATGCTCCAAATTTGG No data
948436639_948436649 25 Left 948436639 2:237958158-237958180 CCCCGGGGGGGCAGCCTGAGATG No data
Right 948436649 2:237958206-237958228 CATCACTGATGCTCCAAATTTGG No data
948436644_948436649 11 Left 948436644 2:237958172-237958194 CCTGAGATGGAAACAGCGTGGAT No data
Right 948436649 2:237958206-237958228 CATCACTGATGCTCCAAATTTGG No data
948436640_948436649 24 Left 948436640 2:237958159-237958181 CCCGGGGGGGCAGCCTGAGATGG No data
Right 948436649 2:237958206-237958228 CATCACTGATGCTCCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948436649 Original CRISPR CATCACTGATGCTCCAAATT TGG Intergenic