ID: 948436650

View in Genome Browser
Species Human (GRCh38)
Location 2:237958207-237958229
Sequence ATCACTGATGCTCCAAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948436640_948436650 25 Left 948436640 2:237958159-237958181 CCCGGGGGGGCAGCCTGAGATGG No data
Right 948436650 2:237958207-237958229 ATCACTGATGCTCCAAATTTGGG No data
948436644_948436650 12 Left 948436644 2:237958172-237958194 CCTGAGATGGAAACAGCGTGGAT No data
Right 948436650 2:237958207-237958229 ATCACTGATGCTCCAAATTTGGG No data
948436642_948436650 24 Left 948436642 2:237958160-237958182 CCGGGGGGGCAGCCTGAGATGGA No data
Right 948436650 2:237958207-237958229 ATCACTGATGCTCCAAATTTGGG No data
948436639_948436650 26 Left 948436639 2:237958158-237958180 CCCCGGGGGGGCAGCCTGAGATG No data
Right 948436650 2:237958207-237958229 ATCACTGATGCTCCAAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948436650 Original CRISPR ATCACTGATGCTCCAAATTT GGG Intergenic