ID: 948436651

View in Genome Browser
Species Human (GRCh38)
Location 2:237958211-237958233
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948436642_948436651 28 Left 948436642 2:237958160-237958182 CCGGGGGGGCAGCCTGAGATGGA No data
Right 948436651 2:237958211-237958233 CTGATGCTCCAAATTTGGGATGG No data
948436640_948436651 29 Left 948436640 2:237958159-237958181 CCCGGGGGGGCAGCCTGAGATGG No data
Right 948436651 2:237958211-237958233 CTGATGCTCCAAATTTGGGATGG No data
948436639_948436651 30 Left 948436639 2:237958158-237958180 CCCCGGGGGGGCAGCCTGAGATG No data
Right 948436651 2:237958211-237958233 CTGATGCTCCAAATTTGGGATGG No data
948436644_948436651 16 Left 948436644 2:237958172-237958194 CCTGAGATGGAAACAGCGTGGAT No data
Right 948436651 2:237958211-237958233 CTGATGCTCCAAATTTGGGATGG No data
948436645_948436651 -8 Left 948436645 2:237958196-237958218 CCGTCCCGACCATCACTGATGCT No data
Right 948436651 2:237958211-237958233 CTGATGCTCCAAATTTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type