ID: 948437824

View in Genome Browser
Species Human (GRCh38)
Location 2:237966161-237966183
Sequence TCTTCCTAAAGGAGGCTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948437824_948437831 17 Left 948437824 2:237966161-237966183 CCCGCCAGCCTCCTTTAGGAAGA 0: 1
1: 0
2: 2
3: 18
4: 166
Right 948437831 2:237966201-237966223 CACTGTTAGAAACCTCTCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 151
948437824_948437832 18 Left 948437824 2:237966161-237966183 CCCGCCAGCCTCCTTTAGGAAGA 0: 1
1: 0
2: 2
3: 18
4: 166
Right 948437832 2:237966202-237966224 ACTGTTAGAAACCTCTCAGTGGG 0: 1
1: 0
2: 1
3: 58
4: 1026
948437824_948437833 19 Left 948437824 2:237966161-237966183 CCCGCCAGCCTCCTTTAGGAAGA 0: 1
1: 0
2: 2
3: 18
4: 166
Right 948437833 2:237966203-237966225 CTGTTAGAAACCTCTCAGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948437824 Original CRISPR TCTTCCTAAAGGAGGCTGGC GGG (reversed) Intergenic
900549880 1:3249183-3249205 TCCTCCTAAAGGAGGCTGGAGGG + Intronic
902260027 1:15218009-15218031 CATTCCTAAAGGAGGGTGGGAGG + Intronic
902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
904949468 1:34224734-34224756 TCCTCCCAAAGGAGGGAGGCTGG - Intergenic
904972698 1:34431637-34431659 TCTTCCTGATGGAGGTTGCCTGG + Intergenic
906095592 1:43221889-43221911 TCTTCCCAGAGCAGGCAGGCAGG + Intronic
908943659 1:69467573-69467595 TCTTATTACAGGAGGTTGGCTGG - Intergenic
911650336 1:100380920-100380942 GCTTCCTAAAGGGTGGTGGCTGG - Intronic
911777795 1:101836995-101837017 TAGTCCTAAAGAAGGGTGGCAGG - Exonic
914017612 1:143834741-143834763 TCTTTATAAAAGAGGCTGGAGGG - Intergenic
914656222 1:149743273-149743295 TCTTTATAAAAGAGGCTGGAGGG - Intergenic
914704973 1:150162887-150162909 TCTTCCTAATGGAGGGAGCCGGG - Intronic
915106549 1:153538280-153538302 TCGTCCTAATGGAGCCAGGCTGG - Intronic
916391356 1:164334162-164334184 TCTTCCTAAATGAGAGGGGCAGG + Intergenic
919285863 1:195558786-195558808 TATAGCTAAAGGAGGCTGGGAGG + Intergenic
920211507 1:204332017-204332039 TCTTCCTGGAGCAGGCTGCCAGG - Intronic
920430920 1:205918455-205918477 TCTTTCTAAAGGGGGCTTTCGGG - Intronic
922068822 1:222170661-222170683 CCTTCCTAATGCAGGCTAGCTGG - Intergenic
922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG + Intergenic
924863511 1:247952442-247952464 CCTTTCTAAAGGAGGCTCGAGGG + Intronic
1063147396 10:3308646-3308668 TCTTCCTAAAGTAGGTAGGTGGG + Intergenic
1064263990 10:13809676-13809698 TCTTCCTCAAGAAAGCTGGGAGG - Intronic
1067933191 10:50584201-50584223 TCCTCCTAAAGAAGATTGGCTGG + Intronic
1069777369 10:70934861-70934883 TCTTCCTCCAGCAGGCAGGCTGG + Intergenic
1071222102 10:83479682-83479704 TCTTCCCATAGAAGGCTGGTAGG - Intergenic
1072735842 10:97879128-97879150 TCTTCAGAAAAGAGGCTGGAAGG + Intronic
1074656188 10:115590629-115590651 TCTTCCTGGAGGAGGCAGGTGGG - Intronic
1075661155 10:124197408-124197430 TTTTTATAAAGGACGCTGGCGGG + Intergenic
1076482330 10:130792715-130792737 GCCTCCTACAGGAGCCTGGCCGG - Intergenic
1081462535 11:43285069-43285091 TCTTGCTCAATGAAGCTGGCAGG - Intergenic
1082915035 11:58424276-58424298 GTTTCATAAAGGAGGATGGCAGG + Intergenic
1083993248 11:66259057-66259079 TCTACCTAAGGGAGACTGGATGG + Intronic
1086452735 11:86933123-86933145 CCTTTCAAAAGCAGGCTGGCGGG + Intronic
1086726311 11:90189076-90189098 TCTTCCTGTAAGAGGCAGGCAGG + Intronic
1090082963 11:123626627-123626649 TCCTCCTGGAGGAGGCAGGCAGG - Intronic
1090177969 11:124668388-124668410 TCTTCCTTAATGAGGCATGCAGG - Intronic
1094073000 12:26439720-26439742 TCATCCTAAAAGGGGCTGCCAGG + Intronic
1095766956 12:45907017-45907039 TCTTCCTGAAGGAGGATCCCTGG + Exonic
1098409733 12:70168593-70168615 TCATCCTCAAGGAGACTGGCTGG + Intergenic
1100756464 12:97756585-97756607 TCTTGCCAAAGAAGGCAGGCTGG - Intergenic
1101590467 12:106121009-106121031 GCTAACTAAAGGAGGCTGCCTGG - Intronic
1101778691 12:107816552-107816574 TCTGCCAGCAGGAGGCTGGCTGG - Intergenic
1103851868 12:123938611-123938633 TCCTCCTAACGCTGGCTGGCTGG + Intronic
1107966855 13:45604964-45604986 TCTTTCTACAGGCTGCTGGCTGG + Intronic
1110250171 13:73372420-73372442 TCTTCCTAAAGGAGAGTCTCTGG + Intergenic
1113466837 13:110518937-110518959 TCTCCCTGAAGGAGGCAGCCTGG + Intergenic
1115078986 14:29427725-29427747 ACTTCCTAATGGAGGTTGGCTGG - Intergenic
1115422277 14:33209805-33209827 TCTTCATAAAAGAGCATGGCAGG - Intronic
1117724915 14:58663614-58663636 TACTCCCAAAGGAGGCTGTCTGG + Intergenic
1118332336 14:64824233-64824255 TATTCCTAAAGGAAGCTTGGAGG + Intronic
1122303881 14:100749155-100749177 TCTGCCTCTAGGTGGCTGGCCGG - Intergenic
1123880582 15:24675395-24675417 AGGTCCTAGAGGAGGCTGGCAGG + Intergenic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1125431227 15:39595784-39595806 TGTTCCTGAAGGAGGATGTCAGG - Exonic
1125608697 15:40956813-40956835 GCTGCCCCAAGGAGGCTGGCAGG + Intergenic
1127041834 15:54985319-54985341 TGTTCCAGAAGGAGGCAGGCAGG - Intergenic
1127800280 15:62471816-62471838 TCTTCCCAAAGGCTGCAGGCAGG + Intronic
1130857755 15:87856336-87856358 TCTTACTAAGGGAAGCTGGATGG - Intergenic
1131095162 15:89649923-89649945 TCATCCTCAAGGAGGGAGGCTGG + Exonic
1134627010 16:15729431-15729453 TCTTCCCAAAGAGGCCTGGCTGG + Intronic
1134834627 16:17350616-17350638 TCTCCCATAAGGAGGCTGACGGG + Intronic
1136478859 16:30529089-30529111 TGGTCCTAGAGGAGGCTGGCTGG - Intronic
1137481984 16:48859451-48859473 GCTTCATCAAGGAGGCTGGGAGG - Intergenic
1137506487 16:49058215-49058237 TCTTCCTAGAGGTGGCTTGCAGG + Intergenic
1138085606 16:54131272-54131294 TCATCTTGAAGGAGGCTGGAGGG + Intergenic
1138335737 16:56251595-56251617 TCTTTATAAAGGAGGCTGTTAGG - Intronic
1139372964 16:66479933-66479955 TCTGCCTGAGGGGGGCTGGCAGG - Intronic
1141064480 16:80902769-80902791 TCTCCCTCCAGGAGGCTGGGTGG - Intergenic
1142923006 17:3207605-3207627 TCCTCCTCAAGGAAGCAGGCAGG - Intergenic
1143010846 17:3865484-3865506 GCTTCCTGTAGGAGGCTGGCGGG - Exonic
1143140898 17:4741177-4741199 GCTTCCGAAGGGAGGATGGCTGG - Intronic
1148913900 17:50958291-50958313 CCTTCCTGAAGGAGCCTAGCTGG - Intergenic
1151675650 17:75596074-75596096 ACTTCCTATAGGAGGAAGGCTGG + Intergenic
1153137530 18:1933846-1933868 GCTACCTACAGGTGGCTGGCAGG + Intergenic
1153599425 18:6764587-6764609 GCTGCCTCAGGGAGGCTGGCAGG - Intronic
1153641087 18:7157779-7157801 TCTAGCTAAAGGAGGCAGTCAGG + Intergenic
1156001561 18:32390659-32390681 TCTTCCCAATGGAAGCTGGATGG + Intronic
1156306545 18:35883290-35883312 TATTCTGAAAGGAAGCTGGCTGG - Intergenic
1156890130 18:42181174-42181196 TCTGCCTGAAGGTGGGTGGCTGG + Intergenic
1158825672 18:61216038-61216060 TTTTCCAAAAGGAGTCAGGCAGG + Intergenic
1162871193 19:13588025-13588047 TTTTCTTAAGGGAGGCAGGCTGG - Intronic
1164916055 19:32053143-32053165 TCTTCCCAAGGGAGGCTGTGGGG + Intergenic
1166161965 19:40960752-40960774 GCTTCCCAAAGGAGACAGGCAGG + Intergenic
1166300883 19:41911587-41911609 TCTCCCTCAAGGAGACTGCCTGG - Intronic
1168723386 19:58567500-58567522 TCTTTCCCAAGGATGCTGGCAGG + Intronic
925535117 2:4908612-4908634 GCTCCCTGGAGGAGGCTGGCAGG + Intergenic
926822704 2:16870802-16870824 TCTTCCTGAAGGAGGATGTTTGG + Intergenic
926958088 2:18323818-18323840 TCTTCCTAAAAGTGAATGGCAGG - Intronic
927277338 2:21273097-21273119 TTTTCCTAAAGGGGGCAGACAGG + Intergenic
927394928 2:22638820-22638842 TCTTCCCACATGAGGCTGGAAGG + Intergenic
930873003 2:56185661-56185683 TTTTCCTAGAAGAGGGTGGCAGG - Intronic
931459797 2:62440711-62440733 TCTTCATAGGGGAGGCTGGAGGG - Intergenic
931485925 2:62691471-62691493 TGGTTGTAAAGGAGGCTGGCAGG + Intronic
931554307 2:63483184-63483206 TCTTACTATAGGTGGCAGGCTGG + Intronic
934871743 2:97872660-97872682 TCTACCCAAAGGAAGCTGTCAGG + Intronic
936398521 2:112148724-112148746 TCATCCTCCAGGAGGCTAGCTGG + Intronic
938392115 2:130914824-130914846 TGTCCTCAAAGGAGGCTGGCAGG - Intronic
940909391 2:159196718-159196740 TCTTCCTCAGGGTGCCTGGCTGG - Exonic
941775317 2:169387084-169387106 ACTTCCCAAGGGAGGCTAGCTGG + Intergenic
948437824 2:237966161-237966183 TCTTCCTAAAGGAGGCTGGCGGG - Intergenic
1170713903 20:18816105-18816127 TATTTCTAAGGGAGGGTGGCAGG - Intronic
1171106307 20:22436005-22436027 TCTTCCTCAGGGAGACTTGCTGG - Intergenic
1171194559 20:23187100-23187122 TCTTCCTGAGGGTGGCTGGCAGG + Intergenic
1171986670 20:31665690-31665712 TCTGTCCAAAGGAGGCTGGCAGG - Exonic
1173872558 20:46351065-46351087 TCTCACAAAAGGAGGCTGGCGGG - Intronic
1176234299 20:64047222-64047244 CTTTCCTGAGGGAGGCTGGCAGG - Intronic
1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG + Intergenic
1178840803 21:36136105-36136127 TCTTCCTTAAGGAGAGGGGCGGG + Intronic
1178846243 21:36176386-36176408 TCATACACAAGGAGGCTGGCAGG - Intronic
1178978975 21:37245064-37245086 TATTCCTAGACCAGGCTGGCTGG - Intronic
1179485548 21:41708097-41708119 TCTTCCTCATGGAGGCTTCCTGG + Intergenic
1179749739 21:43460999-43461021 GCTTCCTCCAGGAGGCTGGGTGG - Intergenic
1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG + Intronic
1181139770 22:20795974-20795996 TCTTTCTCAAGGATGCTGGTGGG - Intronic
1181443739 22:22952557-22952579 TCTGCCAGCAGGAGGCTGGCTGG - Intergenic
1182256147 22:29040043-29040065 TCTTCCTGGAGGAGGGTGACAGG + Intronic
950097466 3:10338305-10338327 AGTTCCTCAAGGAGGCAGGCAGG - Exonic
950263013 3:11555497-11555519 TCTCCCTCAAGCAGGCAGGCAGG - Exonic
950681105 3:14585674-14585696 TCCTCCTGAAGGAAGCTGGGGGG - Intergenic
952330869 3:32363476-32363498 TCCTTCCAAAGGAGGCTGGAAGG + Intronic
953174532 3:40537911-40537933 TCTTCCAAAAGAAGGCTGTTTGG - Intronic
955066470 3:55537407-55537429 TGGTCCAAAGGGAGGCTGGCTGG + Intronic
960085721 3:113589010-113589032 TCATCCTGAAGCAGGCTAGCTGG + Intronic
960701823 3:120447071-120447093 TCTTCCTAAAGCAGGCAGTTGGG + Intronic
968511112 4:996353-996375 TCTCCCTAAAGGAGGCAGGGAGG + Intronic
968928383 4:3562317-3562339 TATTCCCAATGGAGGCTGGTCGG + Intergenic
969060196 4:4428020-4428042 TATTACTTAAGGAGGCTGGCAGG + Intronic
984560111 4:181258144-181258166 TCTTCCTCCAGCAGGTTGGCTGG + Intergenic
985833687 5:2255001-2255023 TCTTCCTGAAATAGGCTGGCTGG + Intergenic
986729271 5:10623333-10623355 TGTTCCTTAAGGAAGATGGCAGG - Intronic
991097156 5:62751473-62751495 TCATCCTTAAGGTGGCTAGCTGG + Intergenic
992245883 5:74822059-74822081 TCAGCCTTAAGAAGGCTGGCAGG - Intronic
993728909 5:91399644-91399666 ACTTTCTAAAGCAGGCTGGAAGG - Intergenic
996307313 5:122062668-122062690 TCATCCTTAAGGAGTCTTGCAGG - Intronic
997369731 5:133350844-133350866 TCTTCCTTAAGGTGGCTTTCTGG + Intronic
997615025 5:135240314-135240336 GCTTCCTGGAGGAGGCTGGGTGG + Intronic
998387490 5:141766164-141766186 TCTGTCTCAAGGAGACTGGCTGG + Intergenic
1001035322 5:168292568-168292590 TCTTCCTAAAGGGGGCGGGCGGG - Intronic
1005652091 6:27893943-27893965 CCCTCCTAATGGAGGCCGGCCGG - Intergenic
1013617405 6:111858000-111858022 TCTCCCTGCTGGAGGCTGGCTGG - Intronic
1014237557 6:118976758-118976780 TATCCCTAAAGGAGCCTGGCTGG + Intronic
1018790565 6:167144533-167144555 TCTTCCTCAAGGACCCTGCCAGG + Intergenic
1019356447 7:582417-582439 TCCTCCAAAAAGTGGCTGGCGGG - Intronic
1019721236 7:2572866-2572888 TCTTCCTTAAGGAGGATAGGTGG - Intronic
1019744511 7:2692175-2692197 TCTTCCTCCAGGAGCCTGGCTGG - Intronic
1022467889 7:30663634-30663656 CCTTCCCAAAGGAGGCAGGGAGG + Intronic
1022484194 7:30765478-30765500 TCCTCCTACTGGAGCCTGGCTGG + Intronic
1026440381 7:70438686-70438708 TCTTCACAGAGGAGGCTGACAGG - Intronic
1027151009 7:75733640-75733662 GCTTCCTGGAGGAGGCTGGCAGG + Intronic
1029005318 7:97203170-97203192 TCTTCCAAAAGGAGACTGCAGGG + Intergenic
1029472806 7:100765193-100765215 GCTTCCCCAAGGAGCCTGGCTGG - Intronic
1030303809 7:108000839-108000861 TTTTTAAAAAGGAGGCTGGCCGG - Intronic
1030919106 7:115357872-115357894 TCTCATAAAAGGAGGCTGGCTGG - Intergenic
1032840020 7:135706049-135706071 TCTCCCTAGAGGAGCCAGGCAGG + Intronic
1033921154 7:146393705-146393727 TCTTCATAGATGTGGCTGGCAGG + Intronic
1036670851 8:10786530-10786552 TTTTCCTAAAGTAGGCTGGAGGG - Intronic
1041956843 8:63565761-63565783 TATTCCTGACGGAGGCTGGCAGG - Intergenic
1042075813 8:64993479-64993501 CCTCTCTTAAGGAGGCTGGCTGG + Intergenic
1047235601 8:123039576-123039598 TCTACCCAAAGCTGGCTGGCTGG + Intronic
1047501780 8:125447133-125447155 TCTTCCAACAGGAGGGTGGGAGG - Intergenic
1048459867 8:134612466-134612488 TCTTTCTTAGGGAGGCAGGCTGG + Intronic
1048684903 8:136893627-136893649 ACTTTATAAAAGAGGCTGGCGGG + Intergenic
1048787581 8:138066789-138066811 TCTTAAGAAAGGAGGCTGCCAGG - Intergenic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1050039075 9:1469431-1469453 TCTTCCTAAAGCAGCCTGCTTGG + Intergenic
1050284605 9:4088244-4088266 TCTCCCAAAAGGAGGCAGGTCGG - Intronic
1050364652 9:4863121-4863143 TCATCATGATGGAGGCTGGCTGG - Intronic
1050872232 9:10587239-10587261 TTATCCTAAAGGAGGCAGGGCGG - Intronic
1053214733 9:36260987-36261009 CCTTCCTACTGGAGGCTGCCAGG + Intronic
1053803267 9:41777459-41777481 TATTCCCAATGGAGGCTGGTCGG + Intergenic
1054141995 9:61537665-61537687 TATTCCCAATGGAGGCTGGTCGG - Intergenic
1054191561 9:61988769-61988791 TATTCCCAATGGAGGCTGGTCGG + Intergenic
1054461755 9:65468843-65468865 TATTCCCAATGGAGGCTGGTGGG - Intergenic
1054646810 9:67598943-67598965 TATTCCCAATGGAGGCTGGTCGG - Intergenic
1055829024 9:80358751-80358773 TCTTCTGAAAGGAGGCTGGAAGG + Intergenic
1056794497 9:89648288-89648310 CCTTCCAAAATGAGTCTGGCCGG + Intergenic
1060490818 9:124082943-124082965 TATTCCAAGAGGAGCCTGGCTGG + Intergenic
1060719474 9:125965827-125965849 TCAGGCTAATGGAGGCTGGCAGG + Exonic
1060820213 9:126657568-126657590 GCCTCCTCAGGGAGGCTGGCTGG + Intronic
1060923055 9:127436243-127436265 TCATCCTTATGGAGGCTGCCAGG + Intronic
1062103658 9:134741044-134741066 GCTTCCTGAACAAGGCTGGCCGG - Intronic
1188751345 X:33909107-33909129 TCTTTCCAAAGGAGGCAGACAGG + Intergenic
1195281070 X:103333009-103333031 TCTTCCTGAAGGCTCCTGGCAGG + Intergenic
1195301116 X:103530712-103530734 ACTTTCTAAGGGAGGCTAGCAGG + Intergenic
1195836891 X:109125817-109125839 TCTTCCCAAAGGAGGCCATCTGG - Intergenic
1196724496 X:118884208-118884230 TCTTCATAAAAGAGGCAGGAAGG - Intergenic