ID: 948438097

View in Genome Browser
Species Human (GRCh38)
Location 2:237967304-237967326
Sequence CGTGAATGGGAAGGGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948438083_948438097 22 Left 948438083 2:237967259-237967281 CCGGGGGCCTGGCGGGCGCGGGC 0: 1
1: 0
2: 5
3: 61
4: 504
Right 948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
948438085_948438097 15 Left 948438085 2:237967266-237967288 CCTGGCGGGCGCGGGCACCCGGA 0: 1
1: 0
2: 2
3: 13
4: 148
Right 948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
948438079_948438097 29 Left 948438079 2:237967252-237967274 CCTCACGCCGGGGGCCTGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 202
Right 948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
948438088_948438097 -2 Left 948438088 2:237967283-237967305 CCCGGACGCGAGGCCGAGCGGCG 0: 1
1: 0
2: 1
3: 12
4: 75
Right 948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
948438089_948438097 -3 Left 948438089 2:237967284-237967306 CCGGACGCGAGGCCGAGCGGCGT 0: 1
1: 0
2: 0
3: 3
4: 24
Right 948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948438097 Original CRISPR CGTGAATGGGAAGGGGCCGC GGG Intronic