ID: 948438097

View in Genome Browser
Species Human (GRCh38)
Location 2:237967304-237967326
Sequence CGTGAATGGGAAGGGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948438079_948438097 29 Left 948438079 2:237967252-237967274 CCTCACGCCGGGGGCCTGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 202
Right 948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
948438088_948438097 -2 Left 948438088 2:237967283-237967305 CCCGGACGCGAGGCCGAGCGGCG 0: 1
1: 0
2: 1
3: 12
4: 75
Right 948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
948438085_948438097 15 Left 948438085 2:237967266-237967288 CCTGGCGGGCGCGGGCACCCGGA 0: 1
1: 0
2: 2
3: 13
4: 148
Right 948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
948438089_948438097 -3 Left 948438089 2:237967284-237967306 CCGGACGCGAGGCCGAGCGGCGT 0: 1
1: 0
2: 0
3: 3
4: 24
Right 948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
948438083_948438097 22 Left 948438083 2:237967259-237967281 CCGGGGGCCTGGCGGGCGCGGGC 0: 1
1: 0
2: 5
3: 61
4: 504
Right 948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948438097 Original CRISPR CGTGAATGGGAAGGGGCCGC GGG Intronic
900599863 1:3498349-3498371 CGTGAGTGGGGCGGGGCAGCAGG - Exonic
901624488 1:10616252-10616274 CATGAGGGGGAAGGGGCTGCTGG - Intronic
901807813 1:11749129-11749151 GGTGAGTGGGGAGGGGCCGGTGG - Intronic
902361027 1:15942763-15942785 CCTTTGTGGGAAGGGGCCGCAGG + Intronic
902429474 1:16352171-16352193 CGGGACTGGCAAGGGGCAGCGGG - Intronic
902518049 1:17000336-17000358 CGTGAGTGGGTGGGGGCCCCTGG + Intronic
903233980 1:21937585-21937607 CGGGCATGGGATGGGGCCGCCGG + Intergenic
904539336 1:31222332-31222354 CGTGAAAGGGAAGTGGCTACTGG + Intronic
905628992 1:39508424-39508446 TGTGAAAGGGCAGGGGCCGTGGG - Intronic
907185628 1:52607038-52607060 CAGGAAGGGGAAGGGGCCCCAGG - Intronic
910257012 1:85259033-85259055 CGTCAAAGGGAAGGGGTCTCAGG + Intronic
917612124 1:176699389-176699411 CGTGGATGGGAAGGTGTCGGGGG + Exonic
922790380 1:228307850-228307872 CAGGAATGGGAAGGGGTCGTGGG - Intronic
1062932806 10:1363798-1363820 CGCGAAGAGGAAGCGGCCGCTGG - Exonic
1063679683 10:8175054-8175076 AGTGCATGGGGAGGGGCCTCTGG + Intergenic
1064107079 10:12509173-12509195 CGCCAATGGGAAGGGGCCCCAGG + Intronic
1067697818 10:48548342-48548364 CGTAAATGGGGTGGGGCCGGGGG - Intronic
1067856598 10:49799020-49799042 CGTGAATGGGATTGGGAGGCTGG + Intergenic
1070891575 10:79945331-79945353 CGTGAATGGGATGGGGCTTGGGG - Intronic
1073350475 10:102816010-102816032 CGTGAATGAGACGGGGTCGGTGG + Exonic
1076894945 10:133306279-133306301 CTTGGATTTGAAGGGGCCGCTGG - Intronic
1077325041 11:1960034-1960056 CGTGCATGGGAAGGGGTGGAGGG + Intronic
1077361087 11:2140400-2140422 AGCCAAGGGGAAGGGGCCGCCGG + Intronic
1078177790 11:8983395-8983417 TCTGAATGGGAAGGAGCCCCTGG + Exonic
1080637291 11:34135141-34135163 CGTGAAGGGGAAGAGGCCGAGGG - Intronic
1082776115 11:57245507-57245529 CTGGAATGGGAATGGGCTGCTGG - Intergenic
1083414734 11:62518132-62518154 CGTCAATGCCAAGGGGCCACAGG - Exonic
1083764352 11:64834963-64834985 CCTGAATGGGAAGGGGCTCAGGG + Exonic
1084319543 11:68365750-68365772 CGGGAATGGGTTGCGGCCGCCGG + Intronic
1202808023 11_KI270721v1_random:15213-15235 CGTGCATGGGAAGGGGTGGAGGG + Intergenic
1096797390 12:54086327-54086349 CGTGCATGGGAAGGGGGCAGTGG - Intergenic
1100979936 12:100155892-100155914 GGTGACTGGGAAGGGGTGGCTGG + Intergenic
1102262610 12:111453648-111453670 CGTGTGTGTGCAGGGGCCGCCGG - Intronic
1102952560 12:117040364-117040386 AGGGAATGGGAAGGGCCAGCTGG + Intronic
1104017795 12:124972013-124972035 AGGGAAAGGGGAGGGGCCGCTGG - Intronic
1104654958 12:130567604-130567626 CGTCCCTGGGAAGGGGCAGCAGG + Intronic
1105256971 13:18750154-18750176 CATGGATGGGAGGGGGCCGGGGG - Intergenic
1106925031 13:34605069-34605091 CATGACTGGCAAGGGGCTGCTGG + Intergenic
1121342597 14:93114668-93114690 CATGAAAGGGAAGGGGACGAAGG + Intronic
1121792800 14:96711713-96711735 CCTGAATGGAAACGGGCCCCTGG + Intergenic
1125200597 15:37098211-37098233 CGGGAAGGGGGAGGGGGCGCAGG + Intronic
1129646118 15:77435153-77435175 AGTGAATGGGAAGGGGCATAAGG + Intronic
1131189154 15:90300409-90300431 GGTGACTGGGAAGGGGTGGCAGG - Intronic
1132852054 16:2029287-2029309 CGGGGCTGGGAAGGGGCTGCAGG - Intronic
1133026618 16:2991443-2991465 GGTGGCTGGGCAGGGGCCGCAGG + Intergenic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1133788248 16:8989485-8989507 CATGAAAGAGAAGGGGCCGAGGG - Intergenic
1134509395 16:14834162-14834184 CGCGACTGGGGAGGGGCTGCAGG - Intronic
1134697100 16:16232977-16232999 CGCGACTGGGGAGGGGCTGCAGG - Intronic
1134974743 16:18561708-18561730 CGCGACTGGGGAGGGGCTGCAGG + Intronic
1136281976 16:29218659-29218681 CGGGAACGGGAAGGTGGCGCGGG - Intergenic
1136566709 16:31074692-31074714 CGGGAAGGAGAGGGGGCCGCCGG + Intronic
1137772875 16:51031012-51031034 GGTGAGTGGGAAGGTGCAGCAGG - Intergenic
1139296935 16:65909411-65909433 AGTGAATGTGAGGGGGCCTCTGG - Intergenic
1139441608 16:66970762-66970784 CGTGAATGGGAAGGGTTCTGGGG - Intronic
1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG + Exonic
1142086352 16:88184575-88184597 CGGGAACGGGAAGGTGGCGCGGG - Intergenic
1147976896 17:44253050-44253072 GGGGAAGGGGAAGGGGCCGGGGG + Intronic
1152560003 17:81073151-81073173 CTGGCATGGGGAGGGGCCGCTGG - Intronic
1154309231 18:13254558-13254580 CATGAATGGAAAGATGCCGCTGG - Intronic
1154429119 18:14294868-14294890 CATGGATGGGAGGGGGCCGGGGG + Intergenic
1154431389 18:14311212-14311234 CATGGATGGGAGGGGGCCGGAGG + Intergenic
1154434066 18:14330518-14330540 CATGGATGGGAGGGGGCCGGAGG + Intergenic
1155063996 18:22253465-22253487 CGTGTTTGGGAGGGGGCCGAGGG - Intergenic
1161425301 19:4199720-4199742 CGGGATGGGGCAGGGGCCGCAGG - Exonic
1161535934 19:4818461-4818483 AGTGAATGGGTAGGGGACACTGG - Exonic
1161812138 19:6477052-6477074 CGTGAGTGGGGAGGGGTCTCTGG - Exonic
1163458083 19:17420448-17420470 CGTGAATGGGCAGGGGAGGTGGG - Intronic
1165073502 19:33268723-33268745 AGGGAACGGGAAGGGGACGCAGG - Intergenic
1165452036 19:35889457-35889479 AGTGAAGGGAAAGGGGCTGCTGG + Intronic
924985285 2:264544-264566 CTTGGAGGGGAAGGAGCCGCGGG - Intronic
926165904 2:10522087-10522109 CTGGAATGGGGAGGGGCCCCAGG - Intergenic
927051125 2:19330505-19330527 AGTGAGAGGGAAGGGGCCTCTGG + Intergenic
937044567 2:118844341-118844363 TAGGAATGGGAAGGGGCCACAGG + Intronic
940198719 2:151126279-151126301 GGAGGATGGGAAGGGGCCGTGGG + Intergenic
948229352 2:236338175-236338197 CATGCATGGGAAGGGGCTGGGGG + Intronic
948360909 2:237419524-237419546 AGGGAATGGGGAGGGGCAGCTGG - Intergenic
948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG + Intronic
948523510 2:238557026-238557048 CCTGAAAGGCAAGGGGCTGCCGG - Intergenic
1169145635 20:3250399-3250421 CGGGAACGTGAAGGGGCAGCTGG - Exonic
1172090134 20:32424946-32424968 TGTGACTGGGAAGGGGCAGTGGG - Intronic
1173720621 20:45254514-45254536 CAGGAAGGGGAAGAGGCCGCTGG + Exonic
1173955968 20:47032968-47032990 CGGGAATTGGAAGGGGGCCCTGG - Intronic
1174507036 20:51023438-51023460 CGTGCAGGCGAAGGGGCCGCAGG - Intergenic
1176062944 20:63180117-63180139 AGAGAAGGGGAAGGGGCCCCAGG + Intergenic
1176848389 21:13894106-13894128 CATGGATGGGAGGGGGCCGGGGG - Intergenic
1177355466 21:20000240-20000262 GGTGATTGGGAAGGGGCAGTTGG - Intergenic
1180095299 21:45553650-45553672 GGGGACTGGGAAGGGGGCGCGGG - Intergenic
1180095512 21:45554095-45554117 GGGGACTGGGAAGGGGGCGCGGG - Intergenic
1180095647 21:45554376-45554398 GGGGACTGGGAAGGGGGCGCGGG - Intergenic
1180984021 22:19893552-19893574 CGGGACTGGCAAGGGGCAGCTGG - Intronic
1182557428 22:31136843-31136865 CAGGCATGGGAAGGGGCCCCTGG - Intronic
1183498069 22:38161778-38161800 CGTGGAGGGGAAGGGGCTGCAGG + Intronic
1185069667 22:48649103-48649125 GAAGAAGGGGAAGGGGCCGCGGG + Intronic
1185313877 22:50170579-50170601 CGGGACGGGGACGGGGCCGCGGG - Intergenic
951080371 3:18444945-18444967 CGGGAGGGGGAAGGGGCCGGCGG + Intronic
952279739 3:31911381-31911403 GTGGAATGGGAAGTGGCCGCTGG + Intronic
953391481 3:42536312-42536334 GGTGAGTGGGAAGGGGCGGGAGG - Exonic
953788300 3:45927778-45927800 GGTGTATGGGAAGGAGCTGCTGG + Intronic
954576218 3:51677803-51677825 CCTGTATGGGAAGAGGCTGCAGG + Intronic
954753662 3:52827537-52827559 CGTGAAATGGAAGGGGCAGGTGG - Intronic
955344882 3:58153537-58153559 GGTGAACTGGAAGGGGCTGCCGG - Exonic
955402098 3:58599565-58599587 AGTGGATGGGAAGGGGCAGGAGG + Intronic
961447935 3:126989814-126989836 CCTGGAGGGGATGGGGCCGCGGG - Intronic
961450497 3:127000260-127000282 CGGGCATGGGAACGGGCCACAGG - Intronic
962409539 3:135129120-135129142 CATGAATGGGAAGGGGGCAGTGG + Intronic
965823865 3:172711063-172711085 CGTGAATGAGCAGCTGCCGCGGG - Exonic
968092687 3:195908757-195908779 CCTGAACGGGAAGGAGCCCCAGG - Intronic
968107620 3:196013808-196013830 CATGCAGGGGAAGGGGCTGCAGG - Intergenic
968950785 4:3690336-3690358 CGTGAATGGGGGTGGGGCGCTGG + Intergenic
986785929 5:11113794-11113816 CTGGAATGGGCAGGGGCTGCTGG + Intronic
987405252 5:17518193-17518215 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987405697 5:17521627-17521649 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987406144 5:17525061-17525083 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987406591 5:17528495-17528517 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987407105 5:17582476-17582498 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987407555 5:17585910-17585932 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987407806 5:17587675-17587697 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987408253 5:17591112-17591134 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987408701 5:17594546-17594568 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987409157 5:17597980-17598002 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987409272 5:17598711-17598733 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
991736768 5:69635389-69635411 CGTGAGTGGGAAGAGGTGGCAGG - Intergenic
997259799 5:132457092-132457114 AGTGAACAGGAAGGGGCCTCGGG - Intronic
998402215 5:141853817-141853839 CATAAAGGGGAAGGGGCCCCTGG + Exonic
1003354978 6:5359800-5359822 TGTGAATGGTAAGGGGCTGCTGG + Intronic
1005813512 6:29532914-29532936 CCTGAAAGGGAAGGGGCACCAGG + Intergenic
1006108209 6:31729149-31729171 TGTGGATGGGATGGGGACGCCGG - Exonic
1007415938 6:41691237-41691259 TGTGGATGAGAAGGGGCAGCAGG + Intronic
1012980986 6:105830839-105830861 GGAGGAGGGGAAGGGGCCGCAGG + Intergenic
1015031687 6:128603003-128603025 CGTGAGTGGGAAGGGGCAGGAGG - Intergenic
1019030810 6:169009211-169009233 GGTGACTGGGAAGAGGCCACTGG - Intergenic
1020021730 7:4873416-4873438 CGAGAAAGGGAAGGGACCCCTGG - Intronic
1027419275 7:78004132-78004154 CGCTAAGGGGAAGGGGCAGCGGG - Intergenic
1027654930 7:80919049-80919071 AGTGAATGGAAAGTGGCCGGAGG + Exonic
1029098434 7:98107323-98107345 CGTGGAGGGGAGGGGGCGGCAGG + Intronic
1029608691 7:101615128-101615150 CATGAAGGGGAAGTGGCTGCAGG - Intronic
1035521254 8:276366-276388 CATGACAGGGAAGAGGCCGCTGG + Intergenic
1039906759 8:41792003-41792025 CGTGTAGGGGAAGGTGGCGCAGG - Intronic
1049659947 8:143815455-143815477 CGCGCATGGGGAGGGGGCGCAGG + Intergenic
1053786956 9:41658899-41658921 CGTGCATGGGAAGGGGGCCGTGG - Intergenic
1054158107 9:61655291-61655313 CGTGCATGGGAAGGGGGCAGTGG + Intergenic
1054477880 9:65586296-65586318 CGTGCATGGGAAGGGGGCAGTGG + Intergenic
1054751520 9:68912064-68912086 CTTGAATGAGTAGGGGCAGCTGG - Intronic
1056044940 9:82705338-82705360 GGTGAAGGGGAAGGGGCTGAGGG + Intergenic
1058881879 9:109292515-109292537 CATGAATGGGAATGGGAGGCAGG + Intronic
1061238202 9:129354075-129354097 TGGGAATGGGCAGAGGCCGCTGG - Intergenic
1062013743 9:134280855-134280877 TGTGATTGGGAAGGGCCCGGGGG + Intergenic
1062027598 9:134347668-134347690 TGTGCATGGGAAGGAGCAGCCGG + Intronic
1189323703 X:40100772-40100794 TGTAAATGCGAAGGGGCCGAGGG + Intronic
1192261152 X:69506404-69506426 CATGAGTGGGGAGGGGCCGCAGG + Intronic
1192308711 X:69990607-69990629 TGTGAATGGGGTGGGGCCACAGG + Intronic
1197745979 X:129932424-129932446 CGCGGAAGGGAGGGGGCCGCGGG - Intergenic
1197777108 X:130125626-130125648 CGGGAAAGGGAAGGGGCAGTGGG + Intergenic
1198373637 X:136015981-136016003 TGTGAATGGGATGGGGCAGGCGG + Intronic
1199400197 X:147389882-147389904 CGTGAAGGGTATGGGGCTGCTGG - Intergenic