ID: 948441658

View in Genome Browser
Species Human (GRCh38)
Location 2:237995119-237995141
Sequence GGTCACACTATTCCTACGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948441658_948441663 28 Left 948441658 2:237995119-237995141 CCTTACGTAGGAATAGTGTGACC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 948441663 2:237995170-237995192 CAGCCTGCCTATCTACAAAGTGG 0: 1
1: 0
2: 1
3: 21
4: 184
948441658_948441664 29 Left 948441658 2:237995119-237995141 CCTTACGTAGGAATAGTGTGACC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 948441664 2:237995171-237995193 AGCCTGCCTATCTACAAAGTGGG 0: 1
1: 0
2: 2
3: 17
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948441658 Original CRISPR GGTCACACTATTCCTACGTA AGG (reversed) Intronic
923061892 1:230483426-230483448 GGACACACTACTCCAAAGTACGG + Intergenic
1087270682 11:96108474-96108496 GGTCACACTACTAGTAAGTAGGG - Intronic
1088618147 11:111654121-111654143 GGTCTTACTATTCCTTCCTAAGG + Intronic
1092596253 12:10008196-10008218 GGTCACACTAGTCATACTTCAGG - Intronic
1111642538 13:90987719-90987741 GGTCACATTATAGCTAGGTAAGG - Intergenic
1140881083 16:79198677-79198699 GGTCACACAGCTACTACGTAGGG - Intronic
1162337020 19:10068061-10068083 GGTCACACTCCTCCTCCGTTGGG - Intergenic
927628170 2:24746060-24746082 GGTCACACTCTGCTCACGTAAGG - Intronic
931841023 2:66148366-66148388 GGTCAAATTATTCCTCCTTATGG - Intergenic
940097412 2:149993331-149993353 GGACACACTATTCCAAAATATGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948441658 2:237995119-237995141 GGTCACACTATTCCTACGTAAGG - Intronic
1178243084 21:30925149-30925171 GGTCACACTACTTCTACTGAAGG - Intergenic
1178765713 21:35449320-35449342 TGTGACACTATTCTTACATACGG - Intronic
956829186 3:73028772-73028794 AGACACACTAGTCCTACTTAAGG - Intronic
956849544 3:73216425-73216447 GGTCACATTATCCCTATTTAGGG + Intergenic
975164496 4:71162778-71162800 GGTCAAACTTTTATTACGTAAGG + Intergenic
997466479 5:134091306-134091328 GTTACCACTATTCCAACGTAGGG + Intergenic
1001330863 5:170761418-170761440 GGTCATATTATCCCCACGTAAGG - Intergenic
1014081611 6:117292917-117292939 GGTCACACTAATCAAAAGTAAGG - Intronic
1016468820 6:144353450-144353472 GGTCTCACTATTCCCAGGTTAGG + Intronic
1022154987 7:27651652-27651674 GGTCAAACAATTCATAAGTATGG + Intronic
1025259844 7:57411559-57411581 GGACACACTCTTACTACTTAAGG + Intergenic
1042738304 8:72013323-72013345 GGTCACACAGTTCCTAAGTGTGG + Intronic
1189658673 X:43275152-43275174 GGTGAAAATATGCCTACGTATGG + Intergenic
1196403680 X:115342391-115342413 GGTCACACTTTGTCCACGTAGGG - Intergenic