ID: 948450435

View in Genome Browser
Species Human (GRCh38)
Location 2:238067018-238067040
Sequence CATCAGAGGGACCCGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5088
Summary {0: 1, 1: 11, 2: 243, 3: 1509, 4: 3324}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948450435_948450447 22 Left 948450435 2:238067018-238067040 CCTCCCACCGGGTCCCTCTGATG 0: 1
1: 11
2: 243
3: 1509
4: 3324
Right 948450447 2:238067063-238067085 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
948450435_948450449 24 Left 948450435 2:238067018-238067040 CCTCCCACCGGGTCCCTCTGATG 0: 1
1: 11
2: 243
3: 1509
4: 3324
Right 948450449 2:238067065-238067087 TTCAAGATGAGATTTGGGTGGGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
948450435_948450443 -8 Left 948450435 2:238067018-238067040 CCTCCCACCGGGTCCCTCTGATG 0: 1
1: 11
2: 243
3: 1509
4: 3324
Right 948450443 2:238067033-238067055 CTCTGATGACGTGGGAATTATGG 0: 1
1: 2
2: 16
3: 69
4: 234
948450435_948450448 23 Left 948450435 2:238067018-238067040 CCTCCCACCGGGTCCCTCTGATG 0: 1
1: 11
2: 243
3: 1509
4: 3324
Right 948450448 2:238067064-238067086 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
948450435_948450446 19 Left 948450435 2:238067018-238067040 CCTCCCACCGGGTCCCTCTGATG 0: 1
1: 11
2: 243
3: 1509
4: 3324
Right 948450446 2:238067060-238067082 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
948450435_948450444 -7 Left 948450435 2:238067018-238067040 CCTCCCACCGGGTCCCTCTGATG 0: 1
1: 11
2: 243
3: 1509
4: 3324
Right 948450444 2:238067034-238067056 TCTGATGACGTGGGAATTATGGG 0: 1
1: 3
2: 14
3: 62
4: 236
948450435_948450445 18 Left 948450435 2:238067018-238067040 CCTCCCACCGGGTCCCTCTGATG 0: 1
1: 11
2: 243
3: 1509
4: 3324
Right 948450445 2:238067059-238067081 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948450435 Original CRISPR CATCAGAGGGACCCGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr