ID: 948450502

View in Genome Browser
Species Human (GRCh38)
Location 2:238067588-238067610
Sequence CATGTCGCCCACAGGGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948450502_948450506 -2 Left 948450502 2:238067588-238067610 CCAGGTACCCTGTGGGCGACATG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 948450506 2:238067609-238067631 TGCAAAATGAGATATGGCACTGG 0: 1
1: 0
2: 3
3: 10
4: 238
948450502_948450505 -8 Left 948450502 2:238067588-238067610 CCAGGTACCCTGTGGGCGACATG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 948450505 2:238067603-238067625 GCGACATGCAAAATGAGATATGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948450502 Original CRISPR CATGTCGCCCACAGGGTACC TGG (reversed) Intronic
903373264 1:22850409-22850431 CATCTCACCCTCACGGTACCAGG + Intronic
903653236 1:24933558-24933580 CAATTCGCCCACAGGCTGCCTGG + Intronic
905886751 1:41495856-41495878 CCTGTGGCCCGCAGGGTTCCAGG - Intergenic
907372752 1:54013853-54013875 CATCTCCACCACAGGGGACCGGG - Intronic
920964660 1:210691915-210691937 CAAGTGGCCAACAGGGTAACTGG - Intronic
922697140 1:227736185-227736207 AATGGGGCCCACAGGGGACCTGG + Intronic
1066464367 10:35640160-35640182 CTTGTCGCTCACATGGTTCCTGG - Exonic
1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG + Intronic
1068932999 10:62610749-62610771 GAAGACGCCCACAAGGTACCTGG + Intronic
1070526509 10:77300121-77300143 CATGCCCTGCACAGGGTACCTGG - Intronic
1084004683 11:66316697-66316719 CACGTGGACCACAGGGGACCAGG - Exonic
1085555645 11:77418350-77418372 CATGTTTCCCTCAGGGTACCAGG - Intronic
1091337455 11:134783066-134783088 CATGTCCCCCTCAGGGCAGCAGG - Intergenic
1096806902 12:54146494-54146516 CAGGTCGCCCACATGGCAGCCGG - Intergenic
1100856720 12:98763958-98763980 CATGACATCCACAGGGAACCTGG - Intronic
1110483898 13:76015892-76015914 TATGTGGCACACAGGGTCCCCGG - Intergenic
1112463291 13:99621660-99621682 CATGTGGCCCACAGGCTGCAGGG - Intronic
1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG + Intergenic
1119873944 14:78040800-78040822 CCTATCCCCCACATGGTACCAGG + Intergenic
1121046425 14:90791555-90791577 CATGTCGCCATCAGGGAGCCTGG - Intronic
1121415344 14:93775417-93775439 CATGTCTCCCAGAGGGCACAGGG - Intronic
1124484404 15:30102382-30102404 CAGGTCTCCAACAGGGGACCTGG - Intergenic
1124519179 15:30394842-30394864 CAGGTCTCCAACAGGGGACCTGG + Intergenic
1124539477 15:30571379-30571401 CAGGTCTCCAACAGGGGACCTGG - Intergenic
1124759173 15:32436193-32436215 CAGGTCTCCAACAGGGGACCTGG + Intergenic
1128453665 15:67821328-67821350 CAGGACGCCCCCAGGGTGCCGGG - Intronic
1138023392 16:53503769-53503791 CGTCGGGCCCACAGGGTACCAGG + Intronic
1138062532 16:53906899-53906921 GAGTTCTCCCACAGGGTACCTGG - Intronic
1138121885 16:54406795-54406817 CATGTTGACCACAGGGGACTGGG - Intergenic
1140935014 16:79662325-79662347 CATGTTGTCCACAGGCTCCCTGG + Intergenic
1141291581 16:82722773-82722795 CAAGATGCTCACAGGGTACCAGG + Intronic
1142708377 17:1710221-1710243 CATGGCGCCCACGGGGCTCCTGG - Exonic
1142752625 17:1998002-1998024 GATGTCCCCCTCAGGGTGCCGGG + Intronic
1142881385 17:2884927-2884949 CATGTAGCCCACAGGGTCAAGGG - Intronic
1148146992 17:45372283-45372305 AATGGCACCCTCAGGGTACCTGG - Intergenic
1152886140 17:82851507-82851529 CATGTGGCCCACAGGGCCCGAGG + Intronic
1160978823 19:1807168-1807190 CATGTCGTCCACCAGGTCCCGGG + Exonic
1166633605 19:44429740-44429762 CATGTCTCCCACAGGGGCTCTGG + Exonic
927599452 2:24427884-24427906 CATTTTGCCCACAGTGTTCCAGG + Intergenic
928210095 2:29317489-29317511 TATTTAGCCCACAGGGTGCCTGG - Intronic
928317107 2:30255067-30255089 CATGTGACCCACAGAGTCCCGGG + Intronic
929551411 2:42895480-42895502 CATGTGGCCCTCTGGGTTCCTGG - Intergenic
934845802 2:97660724-97660746 ATAGTCGCCCAGAGGGTACCTGG + Intronic
936091062 2:109501747-109501769 CATGGCGCCCCAAGGGTTCCAGG + Intronic
937974974 2:127576988-127577010 CCTGTGGCCCACTGGGCACCGGG - Intronic
941203007 2:162538128-162538150 CATGTAGCCCACAGGCCACGGGG - Intronic
946163000 2:217847509-217847531 CTGGTGGCCCACAGGGTAGCAGG - Exonic
948168984 2:235885987-235886009 CATGACGCCCACCTGGGACCAGG + Intronic
948315847 2:237027622-237027644 CATGTCACCCACCGGCCACCAGG - Intergenic
948450502 2:238067588-238067610 CATGTCGCCCACAGGGTACCTGG - Intronic
948924635 2:241087510-241087532 CATGTAGCCCACAGGGTGATGGG + Exonic
1173254616 20:41385359-41385381 CATGTAGTCCACATGGTACATGG + Intergenic
1173818098 20:46002982-46003004 CATGTGGCGCACAGGGAAACCGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1179961668 21:44770903-44770925 CATGGGGCCCACAGGGAACCAGG + Exonic
1181760880 22:25057967-25057989 CATGTCTGCCACAGGGTGCTAGG - Intronic
1182090499 22:27591357-27591379 CCTGTGGGCCACAGGGTCCCAGG + Intergenic
1183350638 22:37332887-37332909 CAGCTCCCCCACGGGGTACCCGG - Intergenic
957989546 3:87611809-87611831 CAAGCCGCCCACAGGTTACTGGG + Intergenic
973229302 4:47823778-47823800 CATGGCGCCCACATGGCAGCTGG - Intronic
974065388 4:57072672-57072694 CCTTTTGCCCACAAGGTACCGGG - Intronic
987118604 5:14745921-14745943 CATGTGACCCACAGGGTATGTGG + Exonic
994956991 5:106545237-106545259 CATGTCTCCCAGTGGGTCCCTGG + Intergenic
1002563977 5:180099893-180099915 CATGTTGCCCAAGGGGTGCCAGG + Intergenic
1011492649 6:87908261-87908283 CATGTAGCAGACAGGGTATCAGG - Intergenic
1013227344 6:108129530-108129552 CATGTGGCCCACAGGGCAGCTGG + Intronic
1018721895 6:166579383-166579405 CCTGTCGCCCACAGGCCATCTGG + Intronic
1019181839 6:170192307-170192329 CATGGAGACCACAGGGTTCCTGG + Intergenic
1019275823 7:175117-175139 CATGAGGCCCACAGAGTGCCTGG - Intergenic
1035026721 7:155831198-155831220 CCTGTCACTCACAGGGCACCCGG - Intergenic
1035068300 7:156123472-156123494 GATGTCTCCCACAGGGAAACGGG + Intergenic
1036557934 8:9876376-9876398 CATTTTGCCCACGGGGTACTTGG + Intergenic
1036751222 8:11444637-11444659 CATGGCACCCACAGGCTTCCAGG - Exonic
1038943700 8:32333799-32333821 CATTTCGTACACAGGGTAACAGG - Intronic
1040087143 8:43355923-43355945 CCTGTTGCTCACAGTGTACCAGG - Intergenic
1041647022 8:60263563-60263585 CATGTTCCCAAAAGGGTACCTGG + Intronic
1043496793 8:80810148-80810170 CCTCATGCCCACAGGGTACCAGG + Intronic
1043872244 8:85446469-85446491 CTTGGCCCCCAAAGGGTACCAGG + Intronic
1048447397 8:134502207-134502229 CAGGTGGCCCACAGGGCACCAGG + Intronic
1051191648 9:14518988-14519010 GATTTCACCCACAGTGTACCAGG - Intergenic
1054462108 9:65470943-65470965 CAAGTGGGTCACAGGGTACCAGG + Intergenic
1057283248 9:93727507-93727529 CATGACCCCCACAGGGACCCGGG - Intergenic
1060526097 9:124322149-124322171 CATGTCCACCAAAGGGTCCCAGG - Intronic
1062433573 9:136536264-136536286 CATGTCCCCTGCAGGGCACCAGG - Intronic
1189398980 X:40647518-40647540 CATGTCTCCCACTTGGAACCAGG + Exonic
1198533664 X:137567207-137567229 CCCGTCGCCCACAGGGCACGTGG + Exonic