ID: 948450831

View in Genome Browser
Species Human (GRCh38)
Location 2:238070192-238070214
Sequence GATCATTAACTTGTAAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948450827_948450831 8 Left 948450827 2:238070161-238070183 CCAAAAGGGAGTGACATGTTCAC 0: 1
1: 0
2: 1
3: 12
4: 135
Right 948450831 2:238070192-238070214 GATCATTAACTTGTAAAAATGGG 0: 1
1: 0
2: 2
3: 18
4: 267
948450826_948450831 9 Left 948450826 2:238070160-238070182 CCCAAAAGGGAGTGACATGTTCA 0: 1
1: 0
2: 0
3: 15
4: 195
Right 948450831 2:238070192-238070214 GATCATTAACTTGTAAAAATGGG 0: 1
1: 0
2: 2
3: 18
4: 267
948450823_948450831 28 Left 948450823 2:238070141-238070163 CCACAGAGTCATAGGAAGTCCCA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 948450831 2:238070192-238070214 GATCATTAACTTGTAAAAATGGG 0: 1
1: 0
2: 2
3: 18
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948450831 Original CRISPR GATCATTAACTTGTAAAAAT GGG Intronic
904588748 1:31595590-31595612 GAGCATTTCCTTGTAAAATTAGG + Intergenic
906336969 1:44941183-44941205 TAAAATTAACTTTTAAAAATAGG - Intronic
910813466 1:91263235-91263257 GATGATCATCTTTTAAAAATGGG - Intronic
911445716 1:97989395-97989417 AATCATTCATTTTTAAAAATTGG + Intergenic
911520232 1:98920746-98920768 GATTATTAACTAGTAAAATGAGG + Intronic
912633840 1:111272257-111272279 GAGCATTCATATGTAAAAATAGG - Intergenic
914823948 1:151127648-151127670 CATCATATAGTTGTAAAAATAGG + Intergenic
915018114 1:152755671-152755693 AATCATTAGCATTTAAAAATAGG + Intronic
916423451 1:164658705-164658727 GATTATTAATCTGTAAAATTGGG + Intronic
916943993 1:169705883-169705905 AAACACTAAGTTGTAAAAATTGG + Intronic
918860748 1:189823802-189823824 CATCATTATATTGTATAAATTGG - Intergenic
918979876 1:191542919-191542941 CATCAATGACTTGTAAAATTGGG - Intergenic
919039847 1:192371226-192371248 AATCAATAACTTTAAAAAATAGG + Intergenic
919109825 1:193204689-193204711 GAACATTTACTTGAATAAATAGG + Intronic
919294235 1:195674091-195674113 AACCCTTCACTTGTAAAAATCGG - Intergenic
919311344 1:195913991-195914013 GTTTATTTACTTTTAAAAATAGG + Intergenic
921621081 1:217327004-217327026 GATTATTAATTTGTCAATATGGG - Intergenic
923764890 1:236884079-236884101 ACTCATTAAATTGTAAAAGTAGG - Intronic
1063895265 10:10674254-10674276 GGACATTAACTAATAAAAATGGG - Intergenic
1064904148 10:20327405-20327427 GATCCTTAATTTGTGAAAAATGG - Intergenic
1071752495 10:88496268-88496290 GATCTTCAAGTTGTAAAACTGGG + Intronic
1073855574 10:107669521-107669543 GTGCATTGACTTTTAAAAATTGG + Intergenic
1074067415 10:110029289-110029311 GATTATAAACTTGTAGTAATTGG + Intronic
1079914698 11:26353896-26353918 GTTCTTCAACTTGTTAAAATTGG - Intronic
1080354220 11:31422993-31423015 GGTGATTAACTTGGGAAAATTGG - Intronic
1080597408 11:33785911-33785933 AAGCTTTAAGTTGTAAAAATGGG + Intergenic
1081025668 11:38010997-38011019 TTTCATTTACTTTTAAAAATAGG + Intergenic
1081264960 11:41009303-41009325 TATCATTATCTAGTAAAATTAGG + Intronic
1081299121 11:41428767-41428789 GATCAATATCTGGTTAAAATAGG - Intronic
1082174713 11:49047650-49047672 GTCCTATAACTTGTAAAAATTGG + Intergenic
1085543259 11:77292608-77292630 GATAATTAAATAGAAAAAATAGG + Intronic
1086215651 11:84377285-84377307 TATCATTAAATTTTAAAAAAAGG + Intronic
1086691069 11:89788438-89788460 GTCCTATAACTTGTAAAAATTGG - Intergenic
1086714733 11:90051217-90051239 GTCCTATAACTTGTAAAAATTGG + Intergenic
1086758486 11:90595587-90595609 GATCCTTGACTTTTAAAAAATGG + Intergenic
1086968967 11:93059871-93059893 GGTCTTTAACTTGTCAAAACTGG - Intergenic
1087222469 11:95561242-95561264 GTTTCTTAACCTGTAAAAATGGG - Intergenic
1087804138 11:102537597-102537619 GAAGTGTAACTTGTAAAAATTGG - Intergenic
1088027562 11:105204813-105204835 TAGCATTAACTTGAAAAAATGGG + Intergenic
1090139449 11:124239142-124239164 TATCAGTAACTTGTTAACATAGG - Intergenic
1090429793 11:126636139-126636161 GTTCCTTCATTTGTAAAAATGGG + Intronic
1090917607 11:131179764-131179786 GTTTTTTCACTTGTAAAAATAGG + Intergenic
1093120357 12:15264019-15264041 GATCATTGCCTTATAAAAAGAGG + Intronic
1093614004 12:21198516-21198538 GATAATGAAGTTGTAAAAATAGG + Intronic
1095545544 12:43363598-43363620 GAGAATCAAGTTGTAAAAATAGG + Intronic
1096325096 12:50653288-50653310 AATCATTACCTGGCAAAAATTGG - Intronic
1096421327 12:51460551-51460573 GGCCAATAACTTGTTAAAATAGG + Intronic
1097311175 12:58121284-58121306 GGTTCATAACTTGTAAAAATTGG + Intergenic
1098258415 12:68642228-68642250 GAGCATTTATTTGTAAAAACTGG - Intronic
1099725297 12:86419135-86419157 GATCATGAAATTTTAAAAGTTGG - Intronic
1100315738 12:93442533-93442555 GATGTTTAAATTGTATAAATCGG + Intergenic
1100321709 12:93500158-93500180 GATGATAACCATGTAAAAATAGG - Intronic
1101111227 12:101488206-101488228 AAGCTTTAAGTTGTAAAAATGGG - Intergenic
1102815780 12:115865029-115865051 GATCATCCTCTTGTTAAAATGGG - Intergenic
1102868141 12:116390673-116390695 GATCAATACCTTATAAATATGGG - Intergenic
1106205795 13:27593104-27593126 AATCATAAACCTGTAAACATGGG - Intronic
1106373703 13:29163167-29163189 TATTTTTAACTTTTAAAAATAGG - Intronic
1106529152 13:30572047-30572069 CATCATGAACTTGCAAAATTAGG - Intronic
1106794945 13:33195803-33195825 GTTTATTAACTTGTACAAGTTGG - Intronic
1106982886 13:35310892-35310914 GATATTTAATTTTTAAAAATTGG - Intronic
1108297506 13:49038626-49038648 GATAATTTATTTGTAAATATTGG + Intronic
1108470431 13:50761887-50761909 GATTCTTAACTTGAAAATATTGG + Intronic
1109106823 13:58263294-58263316 GATCAGTTACTTGTAAGTATTGG - Intergenic
1109787103 13:67192041-67192063 GATTAGTAAATTTTAAAAATTGG + Intronic
1110713528 13:78675862-78675884 GAACATGAAATTTTAAAAATGGG - Intergenic
1111847691 13:93532268-93532290 ATTCATTATCTTTTAAAAATTGG + Intronic
1113985544 13:114312903-114312925 GTTCATTAAGTTGTAAAGTTAGG - Intergenic
1114200716 14:20517472-20517494 AATTATTAACTTCAAAAAATGGG + Intergenic
1114518271 14:23315836-23315858 GAGAATTAAGTAGTAAAAATGGG - Intronic
1115177880 14:30585766-30585788 GTTCTTTAAATTGTAAAAGTAGG + Intronic
1115503624 14:34072394-34072416 AATCATGAACATGTAAAAAAAGG + Intronic
1115790036 14:36868205-36868227 CCTCATTCACTTGTATAAATGGG - Intronic
1116360106 14:43983596-43983618 AAACATTAAAGTGTAAAAATGGG - Intergenic
1116547999 14:46195638-46195660 GATAATTAACTATTAACAATGGG + Intergenic
1116581989 14:46653633-46653655 GATCCCTAACTTGGTAAAATGGG - Intergenic
1118080977 14:62360462-62360484 GATCAATAGATTGTAATAATTGG + Intergenic
1118903736 14:70008082-70008104 GCTCACTAATTTGGAAAAATGGG - Intronic
1125092598 15:35811962-35811984 GACCATCAACTTTTTAAAATTGG + Intergenic
1125308311 15:38348489-38348511 GATAGTTAACTTTTAAAACTGGG + Intronic
1125876684 15:43154083-43154105 ACTAATTAACTTGTAAAAAATGG + Intronic
1127544538 15:59979072-59979094 GATAATTAACAAGCAAAAATAGG + Intergenic
1127544816 15:59982069-59982091 GATGATTAACTAGTATACATGGG + Intergenic
1129142739 15:73615741-73615763 GAACATCAGCTTTTAAAAATCGG - Intronic
1130810022 15:87367032-87367054 GATCAATTACTTTGAAAAATTGG + Intergenic
1138283514 16:55790663-55790685 GAGCATTACCTTTTAAAAATGGG - Intergenic
1138285488 16:55806324-55806346 GAGCATTACCTTTTAAAAATGGG + Exonic
1138300711 16:55927593-55927615 GATTTTTGACTTGTAAAAATTGG - Intronic
1139085661 16:63582290-63582312 GTTTATTAAGTTGTTAAAATGGG + Intergenic
1139276805 16:65735498-65735520 GTTCTTAAACTTTTAAAAATTGG - Intergenic
1140282868 16:73571080-73571102 AATCAGTAATTTCTAAAAATGGG + Intergenic
1141730578 16:85820339-85820361 GATCCTTAACTTGTAAAATGGGG - Intergenic
1141784896 16:86192955-86192977 GAGCAATAACTCTTAAAAATGGG - Intergenic
1141809313 16:86364261-86364283 GGTCATAAACTTTTAAAAATAGG - Intergenic
1144082456 17:11776541-11776563 TTTAATTAACTTGTTAAAATGGG - Intronic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1145082465 17:19906285-19906307 CATCCTTAATTTGTAATAATAGG - Intronic
1149165009 17:53740928-53740950 TATGATTAAAGTGTAAAAATGGG + Intergenic
1151023613 17:70650381-70650403 GATAATTCACTTATAATAATTGG - Intergenic
1151071064 17:71212113-71212135 CATCATTACCTGGCAAAAATTGG + Intergenic
1153536957 18:6112266-6112288 GATCAATTCCTTTTAAAAATAGG - Intronic
1153552958 18:6281861-6281883 TATCATAAACTTTTAAAAACTGG + Intronic
1153731691 18:8019954-8019976 CATCATTAAATTTTAAAAAGGGG + Intronic
1153891961 18:9525444-9525466 CATCATTAACTAGTAAGCATTGG - Intronic
1154421823 18:14237284-14237306 GATAATTCAATTTTAAAAATGGG - Intergenic
1154503455 18:15008544-15008566 CTTCATTAATTTTTAAAAATGGG + Intergenic
1155649948 18:28129528-28129550 AATAAATAACTTATAAAAATTGG + Intronic
1156003599 18:32413621-32413643 GATCATTAAGTTTTATAGATAGG + Intronic
1157619891 18:49010872-49010894 GTTCATAAACTTATAAAAAGAGG - Intergenic
1157913756 18:51644155-51644177 GATCATACATTTGTAAATATTGG + Intergenic
1158315385 18:56206648-56206670 GATGACTAATTTGTAAAAGTTGG + Intergenic
1159789608 18:72762124-72762146 GATTATTAACATGTAAAGTTGGG + Intronic
1159983720 18:74817494-74817516 GATAATTTATATGTAAAAATAGG + Intronic
1160547914 18:79673442-79673464 GATTATTAACTTTTAGAAACAGG + Intergenic
926727809 2:16012288-16012310 ATTCATTATTTTGTAAAAATGGG - Intergenic
928717646 2:34080759-34080781 AATCTTTAACTTGTAATTATAGG + Intergenic
928871094 2:35980787-35980809 GAACATTAACTTGTAGATGTAGG + Intergenic
932154310 2:69402252-69402274 CATAAATAACTTGTACAAATTGG - Intronic
933041699 2:77476729-77476751 GACTATTAATTTGTAAAACTCGG - Intronic
933378905 2:81517729-81517751 GGTAATTAAATTGTAAACATGGG + Intergenic
938502628 2:131838674-131838696 CTTCATTAATTTTTAAAAATGGG + Intergenic
939276077 2:139998025-139998047 AATCATGAACCTGTCAAAATAGG - Intergenic
941941996 2:171049426-171049448 GAACATTAACATGTAAGGATTGG + Intronic
943403333 2:187445933-187445955 GTTCATTCACTTTGAAAAATTGG - Intronic
943739316 2:191394068-191394090 CCTCATTAATTTGTAAAACTTGG - Intronic
944049175 2:195447531-195447553 GATCATTGTCTTGAAACAATGGG - Intergenic
944194647 2:197039871-197039893 GATCCTAAACTTGTAAAAATAGG + Intronic
944378808 2:199081964-199081986 GATCCTTTATTTTTAAAAATGGG + Intergenic
945385655 2:209196995-209197017 GATCCTTAATTTGTAAAATTAGG - Intergenic
948297398 2:236872174-236872196 GACCATGAACTTCTAAACATGGG - Intergenic
948450831 2:238070192-238070214 GATCATTAACTTGTAAAAATGGG + Intronic
1169239162 20:3960367-3960389 CATGATTAAATTTTAAAAATTGG + Intronic
1170008445 20:11694419-11694441 GCTCATAATCTTTTAAAAATGGG - Intergenic
1170184225 20:13569806-13569828 AATAACTAACTAGTAAAAATTGG + Intronic
1172388373 20:34549420-34549442 GGTGATGAACTCGTAAAAATGGG - Intronic
1173708228 20:45130256-45130278 AATCACTAACATGTAAAATTGGG - Intergenic
1182684270 22:32109192-32109214 ATTCAGTGACTTGTAAAAATGGG + Intronic
950986616 3:17377143-17377165 GAAAATAAACTTGTTAAAATAGG + Intronic
951077939 3:18419777-18419799 GATCTTTATCTATTAAAAATGGG - Intronic
952050355 3:29377196-29377218 GCTCATTAACTTCTAAGAAGTGG - Intronic
952410446 3:33045194-33045216 GATTGTTAATTTGTAAAACTGGG - Intronic
952549847 3:34464385-34464407 GTTCATTAAGTTGTACAAAATGG - Intergenic
955082983 3:55675031-55675053 GATCCTGCACTTGTAAACATGGG - Intronic
955630930 3:60974128-60974150 TATCATTAATTTTTAAAAAGTGG - Intronic
955719660 3:61867529-61867551 ATTTATTAACTTGAAAAAATAGG + Intronic
956314791 3:67922045-67922067 GGCCATTAACATTTAAAAATTGG - Intergenic
956388986 3:68751558-68751580 GATCTTTAACATTTAAAAAATGG - Intronic
956430920 3:69185578-69185600 GTTCATCAACTAGTAAACATGGG - Intronic
956453110 3:69393376-69393398 GTTGATTAACTAGTAAAAATGGG - Intronic
963447460 3:145431625-145431647 TATCATTAATTTGTTAAAAGTGG + Intergenic
963627131 3:147687939-147687961 GATCATTGATTTGTAAAGTTGGG - Intergenic
963713348 3:148773408-148773430 GTTCCTTAGCTTGAAAAAATAGG + Intergenic
965173453 3:165298902-165298924 GATCATTTAATTCTGAAAATTGG - Intergenic
965339362 3:167467837-167467859 ATTCATGAACTTGTAGAAATAGG - Intronic
965850844 3:173020853-173020875 TCCCATCAACTTGTAAAAATAGG - Intronic
966451793 3:180071699-180071721 GATCATTACCTTGAATAAAATGG + Intergenic
967487539 3:190051519-190051541 AAGCTGTAACTTGTAAAAATTGG - Intronic
970460779 4:16272660-16272682 CATCATTAAGTTTTAATAATGGG + Intergenic
971621460 4:28859198-28859220 TATCATTAATTTGTAATTATTGG - Intergenic
972234375 4:37113732-37113754 AATCACTAACTTAGAAAAATAGG + Intergenic
972678272 4:41280951-41280973 TATCATTCCCTTTTAAAAATTGG - Intergenic
973240168 4:47948477-47948499 GATCCTTAAGTTGCAAGAATGGG - Intronic
974556390 4:63454592-63454614 GATTTTTAAAATGTAAAAATAGG + Intergenic
974749546 4:66118591-66118613 TCTCATTCACGTGTAAAAATAGG + Intergenic
976234927 4:82887083-82887105 GATCATTTACTTTTTAAAAAAGG + Intronic
976568286 4:86577788-86577810 GATCATTGAATTGGAAAAACAGG + Intronic
977086732 4:92608833-92608855 GCTCTTCAATTTGTAAAAATTGG + Intronic
977448225 4:97159278-97159300 TATCATCAACTTGTGAAAATAGG + Intergenic
977853380 4:101857751-101857773 GATAATTAACTTACATAAATAGG - Intronic
978004077 4:103595421-103595443 GATTCTTAACTGCTAAAAATAGG - Intronic
978753209 4:112275271-112275293 GATCAATAACGTGTAAAACTTGG + Exonic
978812197 4:112862207-112862229 GAGCATTCAATTTTAAAAATAGG + Intronic
978961893 4:114689948-114689970 AAACATTAACATGTGAAAATAGG - Intergenic
979586313 4:122422532-122422554 GAGCATTAAGTTGGTAAAATTGG - Intronic
982967072 4:161923834-161923856 GTTCATTAACTTCTACAAAATGG - Intronic
983784209 4:171711893-171711915 TATCATTAACTTACAAATATTGG - Intergenic
984149209 4:176105784-176105806 GTTCCTTAAGTTGTAAAAATAGG - Intronic
984347749 4:178552630-178552652 GATCATTAACAGATAAAACTTGG + Intergenic
986196254 5:5538704-5538726 AATCAGTAACTTGGAAATATGGG + Intergenic
986434591 5:7716022-7716044 GATATTTAACTTCTAAGAATAGG + Intronic
987947612 5:24632071-24632093 GATAATTATCTTGTATAAACAGG + Intronic
989084704 5:37663646-37663668 TCTCATTTACTTGGAAAAATAGG + Intronic
989282084 5:39656046-39656068 GATAATTACCTTTTACAAATTGG - Intergenic
989990716 5:50762056-50762078 GAACCTTAATTTCTAAAAATAGG - Intronic
990251761 5:53923026-53923048 GATGATTAATTTTTAAAAAGTGG + Intronic
990255254 5:53961633-53961655 GAACATTAAATTTTAAAAAGGGG + Intronic
990668074 5:58095817-58095839 GATGATTTCCTTGTAAAACTAGG - Intergenic
991219796 5:64200058-64200080 TACCATTAAATTTTAAAAATAGG - Intronic
992194581 5:74326597-74326619 TATCAGTAAATTGAAAAAATAGG - Intergenic
992659718 5:78946424-78946446 AATCAGTAACATATAAAAATCGG + Intronic
993080476 5:83291372-83291394 GATTATTATCTTTAAAAAATTGG + Intronic
993085120 5:83354507-83354529 TATCATTAACTTGTCACAAAAGG + Intergenic
993243680 5:85423800-85423822 GTACATTAACTTGTGAAAAAGGG - Intergenic
993268031 5:85752783-85752805 TAGCTTTAACTTTTAAAAATTGG - Intergenic
993317005 5:86422328-86422350 TATCTTTAACTTGAAAAAAAAGG - Intergenic
994611717 5:102049359-102049381 GATGATTAATTTGTAGCAATAGG + Intergenic
994611828 5:102051439-102051461 GATGATTAATTTGTAGCAATAGG + Intergenic
994629136 5:102260937-102260959 GATTATTAACTTTTGGAAATGGG - Intronic
995259716 5:110088938-110088960 GAACACAAACTTGTAAAAACAGG + Intergenic
997061013 5:130502955-130502977 ATTCATTAACTTTTAAAACTTGG - Intergenic
998663690 5:144270607-144270629 GTTCTTTTACTTGTAAAATTAGG - Intronic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
1000287293 5:159837684-159837706 GAGCATATACTTTTAAAAATGGG - Intergenic
1000656115 5:163880152-163880174 GATCATAAACTTGTAAAGGAAGG + Intergenic
1001409892 5:171503744-171503766 GAACATTTACTTTTAAACATAGG - Intergenic
1003894516 6:10594580-10594602 GAGAATTAAATTTTAAAAATGGG + Intronic
1005143018 6:22655780-22655802 GGTGATTAATTAGTAAAAATGGG + Intergenic
1005664274 6:28034740-28034762 GGTCATTAAGTTGTAGAAAAGGG - Intergenic
1008668284 6:53739414-53739436 CATTATTAACTTCTAAAACTGGG - Intergenic
1010167988 6:72939870-72939892 GATGAGTAAAATGTAAAAATGGG + Intronic
1010875345 6:81097640-81097662 GTTCATTAAGTTGTAAAATTAGG + Intergenic
1010895283 6:81355204-81355226 GATGATTCAGTTTTAAAAATTGG + Intergenic
1010936208 6:81865389-81865411 GTGCATGAACTTCTAAAAATGGG - Intergenic
1011133561 6:84075776-84075798 GCTCAGGACCTTGTAAAAATGGG + Intronic
1011166747 6:84456349-84456371 CTTCATTAAGTTATAAAAATTGG + Intergenic
1013572015 6:111437795-111437817 GATCACTGAATTGTATAAATAGG + Intronic
1014669790 6:124287768-124287790 TATCATTAACTTATAAACACTGG - Intronic
1015033648 6:128626659-128626681 GATGATTAAAATGCAAAAATTGG + Intergenic
1015221154 6:130804802-130804824 GTTCCTTAACTTGTAAAATTAGG + Intergenic
1015665895 6:135628369-135628391 GTACATTAACTAGAAAAAATTGG + Intergenic
1016142926 6:140635393-140635415 TATCTTTAAATTGTAAAATTTGG - Intergenic
1016291037 6:142528207-142528229 GATCATTAACATGTAATAGAAGG + Intergenic
1016825711 6:148386746-148386768 GATCTGTAACTCATAAAAATGGG + Intronic
1016859634 6:148704931-148704953 GATCCCTAACTTTTAAAATTAGG - Intergenic
1017413687 6:154196482-154196504 GATAATTTATTTGTATAAATTGG + Intronic
1017578328 6:155831489-155831511 GTTGATTAATTTGTCAAAATGGG + Intergenic
1017830704 6:158126430-158126452 AATTATAAACTTTTAAAAATAGG + Intronic
1018730167 6:166644089-166644111 GAGGATTAACTTGTGACAATTGG + Intronic
1020370741 7:7429621-7429643 GATCATAAACTTGAAAATAAAGG - Intronic
1020375117 7:7477010-7477032 AATAATTAACTTCTAAAAATTGG + Intronic
1021129070 7:16889030-16889052 CATGATTAACTTACAAAAATGGG - Intergenic
1021463849 7:20919626-20919648 GACCATGAACTTGAAAAACTAGG - Intergenic
1021594350 7:22298867-22298889 GATCATTAATTTGAAAACTTAGG - Intronic
1022015810 7:26347367-26347389 GTTTTTTAACTTTTAAAAATTGG + Intronic
1022400814 7:30035571-30035593 AACAATTAACTTTTAAAAATAGG - Intronic
1022402932 7:30058130-30058152 AACAATTAACTTTTAAAAATGGG - Intronic
1022668525 7:32433084-32433106 GGTCATTAACTTGGAATCATAGG + Intergenic
1022674584 7:32487101-32487123 CATGATTAACTTACAAAAATGGG + Exonic
1025640851 7:63367264-63367286 CATCAATAGCTTGTTAAAATTGG + Intergenic
1025736251 7:64149614-64149636 TATCACTAACTTGTTAAAAATGG + Intronic
1025765541 7:64443755-64443777 TATCACTAACTTGTTAAAAAGGG + Intergenic
1026366108 7:69650129-69650151 GATGATTAACTTATTAAATTGGG + Intronic
1027940903 7:84677797-84677819 GTTCTTTAACCAGTAAAAATTGG - Intergenic
1028358639 7:89939924-89939946 AATCATTAACTTGCAAAAGTGGG - Intergenic
1028914842 7:96246897-96246919 TTTAATTAACATGTAAAAATTGG - Intronic
1030300980 7:107974606-107974628 TATCAGTAGCTTGTAGAAATGGG - Intronic
1031019981 7:116616978-116617000 GAACAATAACTTCTCAAAATGGG - Intergenic
1031520399 7:122757621-122757643 GATCAATAATTTTTAAAATTTGG - Intronic
1034823516 7:154238809-154238831 GGTTTTTAACTTGTAAAACTGGG - Intronic
1037776896 8:21841465-21841487 GGTCATTATCAGGTAAAAATAGG - Intergenic
1038173379 8:25159411-25159433 TATTATTAACTTTTAAAGATGGG - Intergenic
1041576940 8:59408702-59408724 GATCAGTATCTTGCAAAAACTGG - Intergenic
1041630816 8:60084593-60084615 ATTCATGAACTTGTAATAATCGG + Intergenic
1042377201 8:68065292-68065314 GATTATTAAGGTATAAAAATGGG + Intronic
1044106668 8:88216277-88216299 AGTCATAAACTTGTAAAAATTGG + Intronic
1044470868 8:92565595-92565617 GAGCAATAACTTGTAAAAATTGG + Intergenic
1045002577 8:97891183-97891205 GATCATTAATTTGGTAGAATCGG + Intronic
1047265623 8:123305422-123305444 GTTCCTTAAGTTGTAAAACTAGG + Intergenic
1048894080 8:138973453-138973475 AATAATTTAATTGTAAAAATGGG - Intergenic
1049134127 8:140878765-140878787 GAGGTATAACTTGTAAAAATGGG - Intronic
1050658558 9:7857005-7857027 GATTCTTAATTTGTAAAATTGGG + Intronic
1050790130 9:9458017-9458039 GATCATTAATCTATAAAATTTGG + Intronic
1050983575 9:12052841-12052863 GTTCATTAATGTGTAAAATTAGG + Intergenic
1051006972 9:12356814-12356836 GATCATTAATTTGAATCAATAGG - Intergenic
1052302200 9:26965002-26965024 TATCATTATAATGTAAAAATTGG + Intronic
1055889929 9:81113004-81113026 GATTAATCAGTTGTAAAAATTGG - Intergenic
1055933419 9:81582830-81582852 GTTCATTAACCTGTAAAAGGTGG - Intergenic
1056320143 9:85428109-85428131 GACGATTAATTTTTAAAAATCGG + Intergenic
1057875421 9:98750040-98750062 AATCATTGAATTGTATAAATAGG - Intronic
1058977678 9:110139689-110139711 TCTCATTAACTTTTTAAAATTGG + Intronic
1059611537 9:115902743-115902765 GATTCTAAACTTGTAAGAATGGG + Intergenic
1060538133 9:124408429-124408451 TATCATTAATGTTTAAAAATTGG + Intronic
1186392743 X:9177001-9177023 AATCATTAAATTATTAAAATTGG - Intergenic
1186626559 X:11299726-11299748 CATCAATAACATGTATAAATTGG - Intronic
1187232922 X:17439801-17439823 GATCATGAACTTGAACAAATGGG + Intronic
1187439500 X:19305352-19305374 GATAATTAATTTGGAAACATTGG + Intergenic
1187957657 X:24535732-24535754 GATCATTGACATGGAAAGATGGG - Intronic
1189999096 X:46667924-46667946 AATAATTCACTTGTAAGAATTGG + Intronic
1190451054 X:50581224-50581246 AATAATAAACTTTTAAAAATTGG + Intergenic
1194272649 X:91836845-91836867 GATCATTAACTTGATAAATGTGG - Intronic
1194565953 X:95488042-95488064 GATCATTTACCTCTAAAATTGGG - Intergenic
1194826259 X:98566444-98566466 GATCAAAGACTTTTAAAAATGGG - Intergenic
1195003161 X:100661861-100661883 GATCATGGACTTGAAAAAACAGG - Intronic
1196081226 X:111634178-111634200 AAGCAATAACGTGTAAAAATTGG + Intergenic
1198647701 X:138827698-138827720 AGTCATTGACATGTAAAAATGGG - Intronic
1200742285 Y:6867264-6867286 CATCAATAGCTTGTATAAATTGG + Intronic
1201347010 Y:12995911-12995933 CATCATTAACTTTTATAATTTGG + Intergenic
1201495262 Y:14586051-14586073 GAATATTAATTTGTGAAAATAGG - Intronic
1202237366 Y:22726912-22726934 AATCATTCACTTGTACCAATGGG + Intergenic