ID: 948453855

View in Genome Browser
Species Human (GRCh38)
Location 2:238095217-238095239
Sequence CAAAAATAACTGGCAGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948453853_948453855 30 Left 948453853 2:238095164-238095186 CCAGCTTGGGTGACAGAGTGAGT 0: 15
1: 1651
2: 36020
3: 88602
4: 163922
Right 948453855 2:238095217-238095239 CAAAAATAACTGGCAGAGTAAGG 0: 1
1: 0
2: 2
3: 31
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948453855 Original CRISPR CAAAAATAACTGGCAGAGTA AGG Intronic
900277855 1:1843903-1843925 CAAAAATTACTGGCCGGGTGCGG + Intronic
901384573 1:8899232-8899254 CAAAAAAAATTGGCAGGGCATGG - Intergenic
902855962 1:19205256-19205278 AAAAAAGAACTGGCAGGGTCTGG + Intronic
903112719 1:21150684-21150706 TAAAAATAACTGGCCGGGTGCGG + Intronic
904481332 1:30795624-30795646 CATAAATAAGTGGCAGAGCCAGG + Intergenic
904928386 1:34066448-34066470 CAGAAATAATGGGCAGAGAAAGG + Intronic
905563774 1:38947216-38947238 CAAAAAGAAGAGACAGAGTAGGG - Intergenic
906126785 1:43431841-43431863 CAAAACTCAGTGGCAGAGTTTGG - Exonic
906151335 1:43589362-43589384 TAAAAATAAATGACAGAGCAGGG + Intronic
906503690 1:46361265-46361287 GAAAAATAGCTGCTAGAGTAAGG + Intronic
907257989 1:53194747-53194769 AATAAATAAGTCGCAGAGTAAGG + Intergenic
907383091 1:54107593-54107615 AAAAATTAAATGGCAGAGAAGGG - Intronic
907640885 1:56189204-56189226 CAAAACCAACTGGCAAAGTCGGG - Intergenic
908831118 1:68179484-68179506 CAATTATATCTGGCAGAGTGAGG - Intronic
908877684 1:68696746-68696768 CATAAATCACTAGCAGGGTAAGG - Intergenic
909022120 1:70443910-70443932 CAAAAATAAGTGGCAGAGGCAGG + Intergenic
909266935 1:73571624-73571646 AAAAAATAAGTGGCAGAAAAGGG + Intergenic
909770147 1:79412025-79412047 GACAAATAACTGGCAGATAAAGG + Intergenic
909773373 1:79454647-79454669 CATAAATATCTGTCACAGTAAGG - Intergenic
910122929 1:83810338-83810360 CAGAAATAACTGGGGAAGTAAGG - Intergenic
910489631 1:87754869-87754891 CAAAAATACCTGTAAGAGTAGGG - Intergenic
910704549 1:90113917-90113939 CCAAAATGACTAGCAGAGTGTGG + Intergenic
912273204 1:108230654-108230676 AAAAAAAAATTAGCAGAGTATGG - Intronic
912295016 1:108463668-108463690 AAAAAAAAATTAGCAGAGTATGG + Intronic
912848372 1:113098576-113098598 CATAAATAACTGTTAAAGTAAGG + Intronic
912848784 1:113103358-113103380 AAAAAATAACATCCAGAGTAAGG - Intronic
912848985 1:113104774-113104796 CTAAAATAAATGGTAGAGTTAGG - Intronic
913397628 1:118389507-118389529 CCAAAATAACAGGGAGAGAAGGG - Intergenic
913456745 1:119040089-119040111 CAATAATAAGTAGCAGAGTCAGG - Intronic
913470824 1:119183655-119183677 CAAAAATAATGAACAGAGTAAGG - Intergenic
915762982 1:158334042-158334064 AAAAAAAAACTGGCAGAGCTAGG - Intergenic
915777994 1:158512334-158512356 TAAAAATAAATGCCACAGTAGGG + Intergenic
916584413 1:166137981-166138003 CAAAAAATACTGGCAGGGCAGGG + Intronic
916655901 1:166875450-166875472 CAAAAGTCACTGTCAGAGTTGGG - Intronic
917590770 1:176474492-176474514 CCAAAATATCTGATAGAGTATGG - Intronic
917606764 1:176639193-176639215 CAAAAATAACTAACAGAGAATGG - Intronic
917680745 1:177364550-177364572 AAAAAATGTCTTGCAGAGTAGGG - Intergenic
917945042 1:179960922-179960944 AAAAAATAACTGGCATACTGAGG + Intronic
917971738 1:180212423-180212445 GAAAAACAAATGGCAGGGTATGG + Intergenic
919666140 1:200294627-200294649 CAAAAGTAAGTGGCTGTGTAAGG + Intergenic
919721719 1:200844159-200844181 CAAAAATAAGTGGCTGGGTGTGG - Intronic
919966437 1:202531353-202531375 TAAAAATATATGGAAGAGTAGGG + Intronic
921199674 1:212792687-212792709 CAAAAATACATGGCCGAGTGTGG + Intronic
921400282 1:214714578-214714600 CAAAAATAAATAGCTCAGTAGGG - Intergenic
922512441 1:226180458-226180480 CAAAATTAAGTGGCAGAGCAAGG + Intronic
923724001 1:236490702-236490724 TAAAAATAATTCCCAGAGTATGG - Intergenic
923996284 1:239498393-239498415 CAAAAATAACTTGCAAAAAATGG + Intronic
1062779672 10:190533-190555 GAAAAATAACTGACAGAATTAGG - Intronic
1063553705 10:7057802-7057824 CAAAAATAACTGGCCAGGCAGGG - Intergenic
1063632287 10:7745591-7745613 TAAAAATAATTAGCAGGGTATGG + Intronic
1063911515 10:10835237-10835259 AAAAAATAACTAGCCGAGCACGG - Intergenic
1064658664 10:17583090-17583112 TAAAAATATCTGTCAGACTATGG + Intergenic
1064970736 10:21063914-21063936 CAAAAAAAATTAGCAGAGTGTGG + Intronic
1065176665 10:23082739-23082761 GAAAAGTAATTGGCAGAGTGTGG + Intergenic
1065197112 10:23277260-23277282 CAGAAATAAGTGGCTGGGTATGG + Intronic
1066401921 10:35085136-35085158 AAAAAATAACTGGCTGGGTGTGG + Intronic
1067378143 10:45747294-45747316 CAAAAAAAATTGGCTGAGCATGG - Intronic
1068886004 10:62097852-62097874 CTAAAGTGACTGGCTGAGTATGG + Intergenic
1069142699 10:64846962-64846984 CTAAATTAACTTGCAGACTATGG + Intergenic
1070514896 10:77195656-77195678 AATAAATAGCTGGCTGAGTATGG + Intronic
1071576578 10:86730997-86731019 CAAAAAAAATTAGCTGAGTATGG + Intronic
1071598770 10:86946001-86946023 CAAAACTAACAGCCAGAGTGTGG + Intronic
1071846602 10:89527185-89527207 AAAAAATAAGGGGCTGAGTAGGG + Intronic
1072169329 10:92845040-92845062 TAAAAGTAATTGGCAAAGTAAGG - Intronic
1072260744 10:93669277-93669299 TTAAAATAATTGGCAGAGCATGG + Exonic
1073525414 10:104177240-104177262 AAAAAAGATTTGGCAGAGTAAGG + Intronic
1073740628 10:106402186-106402208 TAAAAATAACTAAAAGAGTATGG + Intergenic
1073795184 10:106979640-106979662 CAAAATTAGCTGGAAGAGTGTGG + Intronic
1074054784 10:109913095-109913117 TGAAAATACCTGGCAGTGTATGG - Intronic
1079368523 11:19830413-19830435 CACAAATAAGTGGCAGAGCCAGG - Intronic
1081303542 11:41483681-41483703 CAACAAAAACAGGCAGACTAGGG - Intergenic
1081401323 11:42646511-42646533 TAAAAAAAATTGGCCGAGTATGG + Intergenic
1081561973 11:44226127-44226149 AAAAAATAACTTGCAAAGAATGG + Intronic
1082217160 11:49585334-49585356 CTAAAGTTAGTGGCAGAGTAAGG + Intergenic
1082220618 11:49631302-49631324 CAAAAAAAACTGGTTGGGTATGG + Intergenic
1082839763 11:57679460-57679482 CAAATAAAATTGGCAGAGTGGGG - Intronic
1082960683 11:58916131-58916153 CAAAAAAGACTGGAAGAGGAAGG - Intronic
1083580304 11:63820447-63820469 CAAAAATAACTTGTATAGAAGGG + Intronic
1084737842 11:71117308-71117330 CAGAAATAACTGGCTGGGTGAGG - Intronic
1085094625 11:73749868-73749890 AAAAACAAACTGGCAGGGTATGG + Intronic
1086122153 11:83315463-83315485 AAAAAAAAACTGGCTGAGTATGG - Intergenic
1087024960 11:93640793-93640815 CAAAAATAATTAGCAGGGTGTGG - Intergenic
1087413448 11:97822130-97822152 CAAAATTTATTGGCAGATTATGG - Intergenic
1088195315 11:107267748-107267770 CAAAAAAAACTAGCTGAGCATGG - Intergenic
1089928994 11:122289867-122289889 CAAAAATAATTGGGATAGTTTGG - Intergenic
1090453837 11:126830032-126830054 CAAAAATAAATCCAAGAGTATGG + Intronic
1090607111 11:128432797-128432819 CCAAAATAAGTGGCAGAGCTGGG - Intergenic
1090958063 11:131531292-131531314 CAAAAAAAATTAGCAGAGCATGG - Intronic
1091250772 11:134142007-134142029 CAAAAATAAGAGGCAAAGGAGGG - Intronic
1092149866 12:6240452-6240474 CAAAAAAAACTGGCTGGGCATGG + Intergenic
1092220675 12:6710979-6711001 AAAAAATAACTGGCTGGGCATGG + Intergenic
1092651462 12:10639729-10639751 TAAAAAAAAATGGCAGAGCAAGG + Intronic
1092990913 12:13898399-13898421 AACTAATAAATGGCAGAGTAAGG + Intronic
1093257698 12:16891210-16891232 TAAAAATGACTGACAGAGTCAGG - Intergenic
1093482560 12:19619663-19619685 AAAAAAAAACTGGCAGACCAAGG - Intronic
1095525408 12:43119188-43119210 CAAATATAACAGACAGAGGAAGG - Intergenic
1095638200 12:44456110-44456132 GAAAAATAAATGGCAGATAAAGG - Intergenic
1096319022 12:50594094-50594116 CAAAAAAAATTAGCAGAGCATGG - Intronic
1096767542 12:53905323-53905345 AAAAAAGAACTGGCAGATGATGG + Intergenic
1097490746 12:60267559-60267581 CAAAATTCAGTAGCAGAGTAAGG - Intergenic
1097781099 12:63705877-63705899 CAAAAATTACTGGCTGAGGGAGG + Intergenic
1098771866 12:74562536-74562558 AAAAAAATTCTGGCAGAGTATGG - Intergenic
1099036648 12:77595549-77595571 AAAAAATAACTGGGAGAAGATGG + Intergenic
1099200280 12:79668424-79668446 CAAAAACAACTGGTTAAGTAAGG + Intronic
1099387831 12:82038598-82038620 CAAAGATAGATGGCAGAGTGTGG + Intergenic
1100246407 12:92762216-92762238 CAACAAAAACAGCCAGAGTAGGG + Intronic
1101120515 12:101574653-101574675 CAAAAATAACTGGCATAAACAGG - Intronic
1103951203 12:124552163-124552185 TCAAAACAACTGGCAGAGCATGG + Intronic
1104188848 12:126458529-126458551 CAAAACTTACAGGCAGAGTGTGG - Intergenic
1106249488 13:27972688-27972710 CACAAATATCGGGCAGAGCATGG - Intergenic
1107697919 13:43018657-43018679 CAAAAATTACTGGCCGGGCACGG - Intergenic
1108359538 13:49656738-49656760 CAGAAAAAACTGGCAGGGTGTGG + Intergenic
1108588564 13:51892457-51892479 CAACAATACCAAGCAGAGTAGGG - Intergenic
1109610132 13:64754116-64754138 AAAAAAAAACTTGGAGAGTAAGG + Intergenic
1111320852 13:86626704-86626726 TAAAAATACATGACAGAGTAGGG - Intergenic
1112001543 13:95214593-95214615 CAAAAATAACTGGCCAGGTGCGG + Intronic
1113062782 13:106341743-106341765 CCAAAACAACAGGAAGAGTAGGG + Intergenic
1113285682 13:108845867-108845889 AAAAAAAAAATGGCAGAGAATGG - Intronic
1114863287 14:26553991-26554013 CAAAAAAAACTGGCTGGGCATGG + Intronic
1115538801 14:34399667-34399689 CAAAAAAAAATAGCAGAGGAGGG + Intronic
1116833277 14:49743242-49743264 CAAAAAAAATTAGCAGAGCATGG + Intronic
1119124023 14:72107482-72107504 CAAAAAGAACTGGGGGAGCAGGG - Intronic
1119856613 14:77905656-77905678 CAAAAACAACAGGCAGGGCACGG + Intronic
1123710653 15:22984719-22984741 AAAAAGTAACTGGCTGTGTATGG + Intronic
1125392903 15:39214194-39214216 AAGTAATAATTGGCAGAGTAGGG - Intergenic
1125710255 15:41779497-41779519 CAAAAATAACTGGCCGGGCGTGG - Intronic
1125958832 15:43811440-43811462 AAAAAATTACAGGCTGAGTATGG + Intronic
1125979929 15:43991184-43991206 CAAAAATAATTGGCAGCTTCGGG - Intronic
1125984478 15:44036835-44036857 CCAAAAGAAGTGGCAGAGTCAGG - Intronic
1127418867 15:58784923-58784945 AAAAAATAACAGGCTGGGTACGG - Intronic
1128397200 15:67240133-67240155 CAAAAATAATAGCCAGAATAGGG + Intronic
1128483731 15:68064137-68064159 AAAAAATGGCTGGCAAAGTATGG + Intronic
1128701985 15:69811478-69811500 CAAATTTAACTGGCAGACCAAGG - Intergenic
1129853464 15:78809037-78809059 GAAAAATAACTGGCAGGGTGGGG + Intronic
1130425427 15:83793342-83793364 CAAAAATAACTGTGAGATAATGG + Intronic
1131685878 15:94767188-94767210 AAGAAATAACTGGCCGAGGATGG + Intergenic
1131766503 15:95681314-95681336 CAAAAAAAATTAGCAGAGTATGG + Intergenic
1131953937 15:97711117-97711139 GAAAAAAAAATGGCAGAGGAAGG + Intergenic
1133902818 16:9993398-9993420 TAAAAAGAAATAGCAGAGTATGG + Intronic
1134054651 16:11162155-11162177 CCAAAATAACTGGCAGAACACGG + Intronic
1135142095 16:19930532-19930554 CAAGAGTAAGTGGCAGAGTTGGG - Intergenic
1135467920 16:22703078-22703100 CAAAAACAAGTGGCAGGGTGTGG - Intergenic
1135540591 16:23327239-23327261 CAAAAATAATTGGCTGGGAATGG + Intronic
1135907175 16:26523206-26523228 AAAAAATAGCTGGCAGATAAAGG - Intergenic
1137456506 16:48621775-48621797 CAAAAATAACTTGCAGTTTCCGG + Intergenic
1137910041 16:52368536-52368558 CATAATTAAGTGGCAGAGTCAGG - Intergenic
1138675264 16:58646682-58646704 CAAAAAAAATTGGCTGAGTGTGG - Intergenic
1139085049 16:63574401-63574423 AAAAAATAATTAGCAGAGTGTGG + Intergenic
1139856119 16:69981629-69981651 AAAAAAAAACTGGCCGAATATGG + Intergenic
1140264683 16:73410118-73410140 CAAAAATAACTGCAAGAGGCAGG + Intergenic
1140828919 16:78733455-78733477 AAAAAATAACTGGCTGGGCATGG + Intronic
1143212586 17:5199647-5199669 CAAAAATACCAGGCCGGGTACGG + Intergenic
1143932062 17:10439288-10439310 GAAGCATAACTGGCAGGGTAGGG + Intergenic
1144618148 17:16795903-16795925 AAAATATAACTGGCTGGGTATGG - Intronic
1145137670 17:20424452-20424474 AAAATATAACTGGCTGGGTATGG - Intergenic
1145915077 17:28568587-28568609 CACAAATAAGTGGCAGAATAAGG + Intronic
1146171119 17:30634412-30634434 AATAAATTAGTGGCAGAGTAAGG - Intergenic
1146344577 17:32050421-32050443 AATAAATTAGTGGCAGAGTAAGG - Intronic
1146531958 17:33615430-33615452 AAAAAATAACTGGAAAATTATGG + Intronic
1146764677 17:35508500-35508522 CAAAAATAATTGGCTCAGCATGG - Intronic
1148170186 17:45512847-45512869 AATAAATTAGTGGCAGAGTAAGG + Intergenic
1148170663 17:45516840-45516862 AATAAATTAGTGGCAGAGTAAGG + Intergenic
1148279023 17:46332973-46332995 AATAAATTAGTGGCAGAGTAAGG - Intronic
1148301238 17:46550826-46550848 AATAAATTAGTGGCAGAGTAAGG - Intronic
1148365362 17:47051716-47051738 AATAAATTAGTGGCAGAGTAAGG - Intergenic
1149014029 17:51887539-51887561 CAAAAGTAATTGGCAGAGCAAGG - Intronic
1149541387 17:57470624-57470646 CAGACCTAGCTGGCAGAGTAGGG + Intronic
1150046317 17:61916531-61916553 CAAAAATAAATGACAGGGAAAGG + Intronic
1150203481 17:63380933-63380955 CTAAAATAACTGGCAAGGTATGG + Intronic
1150683175 17:67299579-67299601 CAAAAAAAACTAGCTGAGCATGG - Intergenic
1150729754 17:67682043-67682065 CAAAAATAGTTAGCTGAGTATGG + Intronic
1150781381 17:68125450-68125472 AATAAATTAGTGGCAGAGTAAGG + Intergenic
1151539001 17:74755124-74755146 CAGAAACACCTGGCAGAGTCAGG - Intronic
1152819743 17:82431156-82431178 TAAAAAAAACTGGCCGGGTATGG - Intronic
1153359901 18:4182427-4182449 GGAAAATAACTGGCAGAGAAAGG - Intronic
1153842950 18:9023475-9023497 CAAAAAAAACTGGCTGAGTATGG - Intergenic
1154935337 18:21049336-21049358 TAAAAATAACTGAAACAGTAAGG - Intronic
1155564899 18:27123281-27123303 AAAACATAACTGTCAGAGTATGG - Intronic
1155739556 18:29271081-29271103 CAAAAATAATTAGCTGGGTATGG - Intergenic
1156604138 18:38645562-38645584 CAAAGATAAGTGCCAGAGAAGGG - Intergenic
1157883403 18:51343333-51343355 TACAAACAACAGGCAGAGTATGG + Intergenic
1158104147 18:53865592-53865614 CAAGAATAAATGGAAGTGTAAGG + Intergenic
1159745105 18:72223736-72223758 CAGAAATAACTTGTGGAGTAAGG - Intergenic
1162773977 19:12967683-12967705 TAAAAAGAACTGGCAGGGCATGG + Intronic
1163195210 19:15714539-15714561 AAGAAATAACTGGCTGGGTATGG + Intergenic
1163198112 19:15739962-15739984 CAAAAATAATTAGCTGAGCATGG + Intergenic
1163247459 19:16105768-16105790 AATAAATAACTGGCTGAGCACGG + Intergenic
1164146105 19:22513524-22513546 CAAAAAAAACTGTCAGAGCTGGG + Intronic
1165281526 19:34802359-34802381 CAAAAACCATTGGCAGAGGAGGG - Intergenic
1165746842 19:38234489-38234511 AAAAAATAACTGGCTGAGCATGG + Intergenic
1166025967 19:40084954-40084976 CACAAATAGCTGGCAGTGAACGG + Intronic
1166125269 19:40711528-40711550 CAGAAATAACTGGCTTAGAAAGG - Intronic
1166615814 19:44244579-44244601 CAAGAACAACTGGCTGTGTATGG - Intronic
1168307917 19:55445600-55445622 CAAAAATAACTAGCCGGGCATGG + Intergenic
925685879 2:6472995-6473017 CATCAACAACTGGCAGAGTCTGG - Intergenic
927931593 2:27049246-27049268 CAAAAATAATTAGCAGAGGATGG - Intronic
928160743 2:28921864-28921886 CAATAAAAATTAGCAGAGTATGG - Intronic
928651984 2:33413210-33413232 CAAAATTAACTGTAAGAGTATGG - Intergenic
929466015 2:42144676-42144698 CAAAAAAAATTAGCTGAGTAGGG - Intergenic
929735596 2:44545621-44545643 ACAAGATAAGTGGCAGAGTAAGG + Intronic
929822817 2:45287063-45287085 CAAATAAAATTGGCAGAGCAAGG + Intergenic
929984890 2:46719132-46719154 TAAAAATAACTGGCAGGAGATGG + Intronic
930420497 2:51146901-51146923 CAAAAATAACTACCAGGGTGTGG - Intergenic
931280410 2:60786381-60786403 CAAAAAAAATTGGCCGAGTATGG - Intronic
935068192 2:99670103-99670125 CAAAACTAAGTAGCAGAGTGGGG + Intronic
935108200 2:100066109-100066131 CAAAAATATCTGGCAGGGGGAGG - Intronic
935539334 2:104330747-104330769 CAAACACAACTGGCAGTTTAGGG - Intergenic
937682529 2:124659461-124659483 CAAAAATAAGTGGCAGAGTGGGG - Intronic
938868627 2:135451269-135451291 AAAAAATTACTGGCCGGGTACGG + Intronic
938882055 2:135600590-135600612 AAAATATAACTGGCAGAGCTGGG + Intronic
939531198 2:143363870-143363892 CAAAAATAATTGTCAGATAAAGG + Intronic
939798465 2:146678133-146678155 AAAAAATATCTGGCAGGGTGCGG - Intergenic
940338521 2:152554787-152554809 TAAAAATAACTGACAAACTATGG - Intronic
940701256 2:157045902-157045924 CAATAGTAAGTGGCAGAGCAGGG - Intergenic
940848502 2:158666164-158666186 CAAAAATATCTGGCAGATGGTGG + Intronic
941212266 2:162655405-162655427 CACAAATAAATGGCAGAGCTGGG - Intronic
942111255 2:172684714-172684736 TAAAAATAACTAGCAGATTCTGG - Intergenic
942373610 2:175312353-175312375 CAAAAATAACTTACAGAGAAAGG + Intergenic
944646843 2:201788639-201788661 CAAAAATAGCTAGCAGAGAAGGG + Intergenic
945087326 2:206145441-206145463 CATAAATTCCTGGCACAGTAAGG + Intronic
947411677 2:229847912-229847934 CAAAAATAAGAGGGAGAGAAGGG + Intronic
947512062 2:230765140-230765162 CAAAAAAAATTAGCTGAGTATGG - Intronic
947784219 2:232800725-232800747 GAAAAATAATTAGCTGAGTATGG - Intronic
947859613 2:233349230-233349252 CCAAAATAACTAGGAGGGTAAGG - Intergenic
947952592 2:234161018-234161040 CAAAAACTGCTGGCAGATTAGGG + Intergenic
948453855 2:238095217-238095239 CAAAAATAACTGGCAGAGTAAGG + Intronic
1169362176 20:4959937-4959959 AAAAAATAATTAGCTGAGTATGG - Intronic
1169532570 20:6501638-6501660 AGAAAATAAGTGGCAGAGTCTGG + Intergenic
1170531567 20:17297830-17297852 TAAAAATAACTGACATAGGAAGG - Intronic
1171391445 20:24803984-24804006 CAAAAAAAAATAGCAGAGTGTGG - Intergenic
1171967686 20:31542885-31542907 CACTAATAAGTGGCAGAGTTAGG + Intronic
1177457539 21:21361543-21361565 CAAGAAAAAATGGCAGACTAGGG - Intronic
1177896986 21:26865108-26865130 CAAAAATAATTAGAAAAGTAGGG - Intergenic
1178839714 21:36129055-36129077 AAAAAATAACTGGCCGGGCATGG - Intergenic
1178850821 21:36210654-36210676 CAAAAAAAATTAGCAGAGCATGG + Intronic
1180676262 22:17588492-17588514 CAAAAAAAATTAGCAGAGTGTGG + Intronic
1182316533 22:29451184-29451206 TAAAAATATTTGGCAGAGTGCGG + Intergenic
1182805743 22:33068660-33068682 TAAAAATAAATGACAGAGTTAGG + Intergenic
1184354660 22:43971010-43971032 CAAAAAATATTGGCAGAGTGTGG + Intronic
949305448 3:2635542-2635564 CAAAAATAACTGAAAGACAAAGG - Intronic
949489731 3:4577094-4577116 CACATATAACTGGCAGCGTGGGG - Intronic
950041880 3:9924955-9924977 AAAAAAAAACTAGCTGAGTATGG - Intronic
950396797 3:12739714-12739736 TAAAAATCACTGGCAAAGTTAGG - Intronic
951388106 3:22067731-22067753 CAAAAATATCTGGCTGGGCATGG + Intronic
951563147 3:23987968-23987990 CAAAAAGAACTGGCCGGGTGTGG - Intergenic
952175801 3:30861378-30861400 GAATGATGACTGGCAGAGTAAGG + Intronic
953128835 3:40117934-40117956 CAAAAGCAAATGGCAGACTAGGG + Intronic
953264097 3:41369500-41369522 AAAAAAAAAATGGCAGAGCACGG + Intronic
955103875 3:55877403-55877425 CAACTACAACTGGCAGAGTCAGG + Intronic
955785909 3:62538642-62538664 CAAGCCAAACTGGCAGAGTAAGG - Intronic
955792703 3:62605026-62605048 CATAAATAACTGGGAGACTCTGG + Intronic
955858188 3:63297295-63297317 CATAAAGAACTGGCAAAGTCTGG - Intronic
956957438 3:74357077-74357099 CAAAAATAATTAGCTGGGTATGG - Intronic
957573894 3:81984957-81984979 AAAAAATAATTGGCTGGGTACGG - Intergenic
959182110 3:102994248-102994270 CAAAGATAACTGGCAATGCAGGG - Intergenic
960967824 3:123117105-123117127 CAAAAAAACCTGGCAGGGTGGGG - Intronic
962569066 3:136693722-136693744 AAAAAATAATTAGCTGAGTATGG - Intronic
962574951 3:136748099-136748121 TAAAAATAACTGGCCGGGCACGG + Intronic
962709081 3:138070690-138070712 CAAAAAAATTTTGCAGAGTATGG - Intronic
962912520 3:139866390-139866412 CAAAAGTCAGTGGCAGAGTTGGG + Intergenic
964183113 3:153911818-153911840 TAATAATAACAGGCAGTGTATGG + Intergenic
964523211 3:157589094-157589116 TAAAACAAATTGGCAGAGTAGGG + Intronic
965371893 3:167873080-167873102 CATGAATAAGTGGCAGAGTCAGG + Intergenic
965593508 3:170384991-170385013 CAAAAATAACTTGCAGTCTGAGG - Intronic
965779431 3:172268868-172268890 CAAAAGGAACTGGCAGGGCATGG - Intronic
966266117 3:178046380-178046402 CAAATATCACTGGAAGAGAAGGG + Intergenic
966556327 3:181264730-181264752 CAATAATGACTAGCAGAGTTTGG - Intergenic
966571669 3:181450966-181450988 CACCAATAAGTGGCAGAGTTGGG - Intergenic
966742208 3:183244209-183244231 AAAAAAAAACAGGCAGAGGAAGG + Intronic
967921021 3:194614557-194614579 CAAAAAAAATTGGCCGGGTATGG - Intronic
968682591 4:1931487-1931509 TAAAAATAACTGACATATTAGGG + Intronic
974068043 4:57098468-57098490 AGAAAATAACTGGCAGGGCAGGG - Intronic
975830716 4:78365806-78365828 CAAAAAGAACTAGCAGGGCATGG + Intronic
976976548 4:91172239-91172261 CAAAATAAACTGGAAGAGTAGGG + Intronic
977161113 4:93636923-93636945 CAAAAGGAACTGGCAGAACAGGG - Intronic
978671477 4:111252320-111252342 CAAGAACAAATGGCAGAGTAAGG - Intergenic
980920059 4:139075241-139075263 CAGAAATAAGTGGCAGAGACTGG - Intronic
982097140 4:151933540-151933562 TAAAAAAAAGTGGCAGAGCATGG - Intergenic
982807291 4:159782305-159782327 CAAGAATACCTGGCTAAGTAAGG - Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
983629568 4:169836409-169836431 CTAAAATAACCAGCAGGGTATGG + Intergenic
983731625 4:171000849-171000871 CAAAAAAAATTGGCTGGGTATGG + Intergenic
984473246 4:180203972-180203994 GAAAAAAAACTGGCAGGGTGTGG + Intergenic
987078366 5:14404510-14404532 AAAGAACAACTGGCAGAGTTTGG - Intronic
987164558 5:15181952-15181974 CTAAAATTACTGAAAGAGTATGG + Intergenic
987361692 5:17112890-17112912 AAAAAGTATCTGGCAGAGTGTGG + Intronic
988024505 5:25667919-25667941 CAAAAACAAGGGGCAGAGAATGG + Intergenic
990224411 5:53633092-53633114 CAAGTATAACTGGCAGAGACAGG - Intronic
992133624 5:73720422-73720444 CAAAAATAGCAGGCAGAGAGAGG + Intronic
992568229 5:78023963-78023985 AAGAAATAACTGGTAGAGCAAGG + Intronic
992783267 5:80147141-80147163 CACAAATAACTTGAATAGTAAGG - Intronic
992907362 5:81359274-81359296 CAAAAAGAAAGGGCAGAGGAGGG + Intronic
993301666 5:86219395-86219417 AAAAAGTAACTGGCTGGGTACGG + Intergenic
993307364 5:86289428-86289450 AAAAAAAAATTAGCAGAGTATGG + Intergenic
994029826 5:95128984-95129006 AAAAAATAACTGGAAAAGTTTGG + Intronic
994942734 5:106345855-106345877 AAAAAATAACTGGGAGAGGCTGG + Intergenic
996444624 5:123531961-123531983 CAAAAATTACAGGAAGAGAATGG - Intronic
997151033 5:131495339-131495361 AAAAAATAAATGGAAGAGTCAGG + Intronic
998385040 5:141752723-141752745 CAAAAATAGTTGGGTGAGTATGG - Intergenic
999205540 5:149845415-149845437 CAAAAGCAAGTGGCAGAGCAGGG - Intronic
999590499 5:153139816-153139838 CATAAATAACTGGCAGGTTCAGG - Intergenic
999625044 5:153511829-153511851 CAGAAAGAACTGGCAGACTCGGG + Intronic
1000504202 5:162093579-162093601 TAAAAATAACTGGCAAAACATGG + Intronic
1002652099 5:180706075-180706097 CAAAAATAACTGTAAAAGGAGGG - Intergenic
1003090700 6:3100266-3100288 CAAAAAAAACTGGCCAGGTATGG + Intronic
1003156286 6:3598327-3598349 TAACAATCAATGGCAGAGTAGGG - Intergenic
1003627703 6:7758355-7758377 CAGAAATAACTGGCAGAATCAGG + Intronic
1005580131 6:27226005-27226027 CAAAAAAAACTAGCAGGGCATGG + Intergenic
1006595208 6:35188121-35188143 CAAAAAAAACTAGCAGAGCCTGG - Intergenic
1006825208 6:36929668-36929690 GAAAAATACACGGCAGAGTATGG - Intergenic
1006952865 6:37839470-37839492 AAAAAATAACTGGCCGGGCACGG - Intronic
1007358551 6:41339356-41339378 CAAAAACAAGTGGCATAGTCTGG - Intronic
1007403370 6:41617329-41617351 CAAAAAAAATTGGCTGAGTATGG + Intergenic
1007452649 6:41951912-41951934 CAAAAAAAACTAGCTGAGTGTGG - Intronic
1007621065 6:43214992-43215014 GAAAAATAAGTGGCAGAGCTGGG + Intronic
1007911696 6:45521702-45521724 CAAAAAAAACAGGCAGAGGTGGG - Intronic
1008347366 6:50444142-50444164 CAAAAATAAATGGCAGAGCCAGG + Intergenic
1009198288 6:60713319-60713341 CAAAAGTAACTTGCAAAATAAGG - Intergenic
1009562480 6:65265735-65265757 CAAATGTAACTTACAGAGTAAGG + Intronic
1010193741 6:73220036-73220058 CAAAAAAAACTAGCTGAGCATGG - Intronic
1011673103 6:89703343-89703365 CAAAAATAACTGACCATGTATGG + Intronic
1012270611 6:97205231-97205253 AAAAAATACGTGGCCGAGTATGG - Intronic
1012960579 6:105617429-105617451 CAAAAAAAATTGGCAGAGTCTGG - Intergenic
1013002524 6:106038273-106038295 CAAAAATAGCAGGCTGGGTATGG - Intergenic
1014050436 6:116946605-116946627 GAGAAACAACTGGCAGAGGAAGG + Intergenic
1015518051 6:134103649-134103671 CAAAAATAACAGCCAGAGATAGG - Intergenic
1016899681 6:149089197-149089219 CAAAAATAATTAGCTGAGTGTGG + Intergenic
1017395260 6:153991385-153991407 CAAAAAAAACTAGCTGGGTATGG - Intergenic
1020426900 7:8077515-8077537 CATAATTAAGTGGCAGAGCAGGG - Intronic
1020863144 7:13520277-13520299 AAAAAATAATTAGCAGAGCATGG - Intergenic
1022939686 7:35221941-35221963 CAAAAATTACTGGCTGAGGGAGG + Intronic
1025618670 7:63147466-63147488 CAAAAAAAATTAGCAGGGTATGG + Intergenic
1026037613 7:66840709-66840731 CAAAAATAATTAGCCGGGTATGG - Intergenic
1026419457 7:70218579-70218601 CAAAAATAATTGACAGAGGTGGG - Intronic
1027883792 7:83876242-83876264 CAAAAATTACTAGAAGATTATGG + Intergenic
1028050491 7:86178833-86178855 CAAAAACAAGTAACAGAGTAAGG + Intergenic
1028906609 7:96161345-96161367 CAAAAATTAGTGGGAGAGTAGGG - Intronic
1029118381 7:98250110-98250132 CACAAATAACTTGAAAAGTAAGG + Intronic
1029245474 7:99196439-99196461 CAAAACAAAATGGCAGACTAAGG + Intronic
1030345166 7:108424771-108424793 CAAAAATAACATGCAGATTTGGG - Intronic
1030621283 7:111794038-111794060 TAAAAATAACTGGGAGAGTGTGG + Intronic
1030868335 7:114727006-114727028 TAAAAATAAATGGCTGAGTGTGG - Intergenic
1030964449 7:115972065-115972087 CAAGAATAGCTGGTAGAATAGGG - Intronic
1031051423 7:116949878-116949900 AAAAAAAAACAGGCAGAGCACGG - Intergenic
1032205047 7:129856190-129856212 CAAAAGTAACTTGCAGATTGTGG + Intronic
1034515983 7:151579973-151579995 CAAAAAGGATTGGCAAAGTAAGG + Intronic
1035298828 7:157883748-157883770 CAAAAATGACTGTCAGAGATCGG + Intronic
1037339075 8:17823184-17823206 CAAAAAAAATTAGCTGAGTATGG + Intergenic
1038253887 8:25932388-25932410 AAAAAAGAACGGGCAGCGTACGG + Intronic
1039006405 8:33042589-33042611 CAAAAATAAATGCCTGTGTAAGG - Intergenic
1039874884 8:41577255-41577277 TAAGAATAAAGGGCAGAGTATGG - Intronic
1040028504 8:42803366-42803388 CAAAAAAAACTGGCTGGGTGCGG - Intergenic
1040817998 8:51529180-51529202 CAAAAATATTTGTCAGAGTTTGG + Intronic
1040957340 8:52992968-52992990 CAGAAATAACTAGAACAGTATGG + Intergenic
1041407300 8:57514112-57514134 GAAAAAAAACTGGCTGAGCATGG + Intergenic
1041603189 8:59747383-59747405 AAAAATTAACTGGCACAGTCAGG - Intergenic
1042534116 8:69841608-69841630 AAAAAAAAAATGGCAGAGTTTGG + Intergenic
1042648522 8:71013594-71013616 CAAAATTAATTGGCAGAAGATGG + Intergenic
1043049477 8:75366982-75367004 GAAAAATAACTGGCAGGGCATGG + Intergenic
1043151778 8:76726837-76726859 CAAAAATAATTGAAAGTGTAAGG + Intronic
1043336364 8:79181315-79181337 CAACAAAAACTGGCAGTGTTTGG - Intergenic
1044513637 8:93112975-93112997 AAAAAATAACAGGCAGAATCAGG + Intergenic
1044742528 8:95342503-95342525 CAGAAATAACTGGCAGTCAACGG - Intergenic
1044976078 8:97666985-97667007 CAAAACAAAATGGCAGGGTACGG - Intronic
1046326949 8:112661454-112661476 CAAAATCAAATGTCAGAGTACGG + Intronic
1047178847 8:122567932-122567954 CACAGATAACTGTCAGTGTACGG + Intergenic
1049696831 8:143988138-143988160 AAAAAAAAAAAGGCAGAGTAAGG - Intronic
1049735863 8:144204264-144204286 ACAAAAAAACTGGCAGAGTGTGG - Intronic
1050999645 9:12265372-12265394 CAAAAATTACTGGCCGGGAATGG + Intergenic
1051077885 9:13261739-13261761 CAAAGGTAACTGACAGAGTATGG + Intronic
1052005339 9:23341082-23341104 GACAAATAAGTGGCAGAGTTAGG - Intergenic
1052907372 9:33847905-33847927 CAAAAAAAACTAGCCGAGTGTGG - Intronic
1053340021 9:37317884-37317906 CAAAAGTAATTGGCAGACCATGG + Intronic
1055190735 9:73520513-73520535 CAAAAAGTAATGGCAAAGTATGG - Intergenic
1055631693 9:78231350-78231372 CAAGAATAAGTGGCAGGGTGTGG + Intergenic
1056500354 9:87202825-87202847 CATAAATATCTGGCAGATAATGG - Intergenic
1057350854 9:94296889-94296911 CAAAAAAAACTAGCCGAGTGTGG + Intronic
1058759323 9:108115117-108115139 CAAATATGACTGTCAGAGTAGGG + Intergenic
1061143441 9:128782500-128782522 CAAAAATAATTAGCAGGGCATGG - Intergenic
1062652931 9:137587585-137587607 CAAAAATAACTGCGAGATTCAGG + Intronic
1186583240 X:10843748-10843770 AAAAAAAAACTGGCAGTGAAGGG - Intergenic
1186699361 X:12072863-12072885 CAAAAATAACTGGCAACCTGAGG + Intergenic
1187078868 X:15965090-15965112 GACAAATAACTGGCAGAAAACGG + Intergenic
1187734603 X:22290952-22290974 AACAAATAATTGTCAGAGTAAGG - Intergenic
1188694153 X:33168418-33168440 CAAAAACAACTTTCAGAGTATGG - Intronic
1189638392 X:43038206-43038228 CACCAAAAAATGGCAGAGTAAGG - Intergenic
1191712788 X:64169515-64169537 CCAAAATAAGTGGAAGAGGAGGG - Intergenic
1194282446 X:91969888-91969910 TAAAAAGAACTGGCAGAATCAGG - Intronic
1194414287 X:93591334-93591356 CAAAAATGAATGGCTGAATAAGG - Intergenic
1194563960 X:95458851-95458873 GAAAAATAACTGGGAGATCATGG - Intergenic
1194634353 X:96325726-96325748 CATAAATAACTAGAAGAATAAGG - Intergenic
1197107011 X:122728949-122728971 CAAAAATAACTGTCTGAGACTGG + Intergenic
1198068321 X:133122188-133122210 CAAAAATAACTGCAAGATTTTGG - Intergenic
1198713903 X:139535416-139535438 CAAAAGGAACTTGCAGAGCAAGG + Intronic
1199030813 X:142997112-142997134 GAAAATTAAATGGTAGAGTAAGG + Intergenic
1199151979 X:144497930-144497952 CCAAAATCACTGGGAGAGGAAGG + Intergenic
1199849196 X:151713414-151713436 AAAAAATAAGTTGCAGAATATGG + Intergenic
1201958831 Y:19656183-19656205 CAACAAAACCTGGAAGAGTAGGG - Intergenic