ID: 948454940

View in Genome Browser
Species Human (GRCh38)
Location 2:238100560-238100582
Sequence AGAACTTGACGCAGTCCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948454940_948454954 25 Left 948454940 2:238100560-238100582 CCACCTGGACTGCGTCAAGTTCT 0: 1
1: 0
2: 0
3: 4
4: 89
Right 948454954 2:238100608-238100630 CAACCAGCGGGCCCACAACGGGG 0: 1
1: 0
2: 1
3: 3
4: 48
948454940_948454949 13 Left 948454940 2:238100560-238100582 CCACCTGGACTGCGTCAAGTTCT 0: 1
1: 0
2: 0
3: 4
4: 89
Right 948454949 2:238100596-238100618 CCAGCTGCCCGGCAACCAGCGGG 0: 1
1: 0
2: 2
3: 23
4: 229
948454940_948454953 24 Left 948454940 2:238100560-238100582 CCACCTGGACTGCGTCAAGTTCT 0: 1
1: 0
2: 0
3: 4
4: 89
Right 948454953 2:238100607-238100629 GCAACCAGCGGGCCCACAACGGG 0: 1
1: 0
2: 0
3: 3
4: 51
948454940_948454952 23 Left 948454940 2:238100560-238100582 CCACCTGGACTGCGTCAAGTTCT 0: 1
1: 0
2: 0
3: 4
4: 89
Right 948454952 2:238100606-238100628 GGCAACCAGCGGGCCCACAACGG 0: 1
1: 0
2: 0
3: 5
4: 76
948454940_948454945 2 Left 948454940 2:238100560-238100582 CCACCTGGACTGCGTCAAGTTCT 0: 1
1: 0
2: 0
3: 4
4: 89
Right 948454945 2:238100585-238100607 GTGCAGCGGGCCCAGCTGCCCGG 0: 1
1: 1
2: 3
3: 28
4: 319
948454940_948454947 12 Left 948454940 2:238100560-238100582 CCACCTGGACTGCGTCAAGTTCT 0: 1
1: 0
2: 0
3: 4
4: 89
Right 948454947 2:238100595-238100617 CCCAGCTGCCCGGCAACCAGCGG 0: 1
1: 0
2: 1
3: 22
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948454940 Original CRISPR AGAACTTGACGCAGTCCAGG TGG (reversed) Exonic
902413257 1:16224628-16224650 AGAACTAGACACAGGCCAGATGG + Intergenic
904557629 1:31375504-31375526 AGAACTTTAGGAGGTCCAGGTGG - Intronic
904891837 1:33785010-33785032 AGAACCTGACGTAGTCCCTGTGG + Intronic
905799517 1:40834328-40834350 AGAGCTTGGAGCAGTTCAGGAGG - Intronic
906095015 1:43217010-43217032 GGAACTTGGCTCAGGCCAGGTGG + Intronic
906719343 1:47994309-47994331 TCAACTTCACGTAGTCCAGGTGG + Exonic
908477140 1:64500603-64500625 AGCACTTGAAGAAGTCGAGGCGG + Intronic
911981835 1:104578762-104578784 AGAACTTCAAGCAGTGCAGCTGG - Intergenic
919503414 1:198367465-198367487 AGAACTTGACGAACTGAAGGTGG - Intergenic
919790310 1:201286237-201286259 AGAACCTGAATCTGTCCAGGGGG - Intronic
920351929 1:205343451-205343473 AGACCTCGAAGCAGTCCATGGGG + Exonic
924794214 1:247280952-247280974 TGTACTTGACACAGTACAGGTGG - Intergenic
1063028729 10:2209903-2209925 TGAACTTGCCGATGTCCAGGAGG - Intergenic
1063053289 10:2476310-2476332 GGAACTTGAGGAAGGCCAGGTGG + Intergenic
1072441961 10:95464894-95464916 AGAAGAGGAAGCAGTCCAGGTGG + Intronic
1072669440 10:97418655-97418677 AGGGCTTGACGCACACCAGGTGG + Intronic
1075379159 10:122004593-122004615 AGAACTGGACTCAGCACAGGAGG + Intronic
1083134029 11:60654803-60654825 AGAACTTCAAGCAGTACACGAGG + Intergenic
1084147618 11:67273450-67273472 ACAAGGTGACCCAGTCCAGGAGG + Intronic
1088589988 11:111395128-111395150 AGAAATTGGCCCAGGCCAGGTGG + Intronic
1091261028 11:134234360-134234382 AGAAATAGACGCAGTCTAGAAGG + Intronic
1096194103 12:49637740-49637762 AGAACTTGAATAAGTCCAGAGGG - Exonic
1102914769 12:116744637-116744659 AGAGCTTGAGGCAACCCAGGAGG - Intronic
1111078807 13:83275556-83275578 TGAAATTGACTCAGTCAAGGAGG - Intergenic
1113151648 13:107270416-107270438 AGTACTTTACTAAGTCCAGGTGG - Intronic
1118819738 14:69337543-69337565 AGAACTGGGCACAGTCCTGGGGG - Intronic
1120877433 14:89387933-89387955 AGCACTTGGGGCAGCCCAGGTGG + Intronic
1121078019 14:91085376-91085398 AGAACGTGGCACAGCCCAGGAGG - Intronic
1126195167 15:45923174-45923196 AGAACTTGAGGCAGACCAGTGGG - Intergenic
1127793386 15:62417943-62417965 AGAACTTAAGACAGGCCAGGGGG - Intronic
1134040739 16:11066372-11066394 TGAGCTTGGGGCAGTCCAGGGGG + Intronic
1140251631 16:73299638-73299660 AGAACGTGCCCCAGCCCAGGAGG + Intergenic
1141740748 16:85890830-85890852 AGAACTTGAAACAGTCCCAGGGG - Intergenic
1142832293 17:2558217-2558239 GGAACTTGACCCATACCAGGAGG + Intergenic
1147465408 17:40607190-40607212 AGAACTTCATCCAGCCCAGGAGG + Intergenic
1147774658 17:42892094-42892116 AGAACCTGTCGCAATCCAGATGG - Intergenic
1148031786 17:44627146-44627168 AGAACTTGCCTCAGGTCAGGTGG - Intergenic
1151963702 17:77420383-77420405 AGGACATGACGCAGCCCAGTAGG - Intronic
1156558059 18:38089735-38089757 AGAACTAGAAGCAATCCAGACGG - Intergenic
1157162676 18:45328532-45328554 AGAAGTTGACGCAGCCCCTGAGG - Intronic
1157496526 18:48161177-48161199 AGACCTTGAGTCAGCCCAGGAGG - Intronic
1158216903 18:55110039-55110061 GGAACTTCAGGCAGCCCAGGAGG + Intergenic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1161807710 19:6454567-6454589 AGACCTTGAGGCGGTCCAGAGGG + Exonic
1161870605 19:6866860-6866882 AGAAATTGACTCTGTCTAGGCGG - Intergenic
1162352821 19:10161399-10161421 AGCACTTGAAGAAGCCCAGGTGG + Intronic
1163403376 19:17107949-17107971 AGGACTTGAAGCAGACCAGGTGG - Intronic
942655836 2:178213225-178213247 AGAACTTGATGCGGTCAAGCAGG - Intronic
944139495 2:196439678-196439700 AGAACTTGAAGTAGTCCTGTTGG + Intronic
948403950 2:237703630-237703652 AGAACTTGACCCAACCCCGGGGG - Intronic
948454940 2:238100560-238100582 AGAACTTGACGCAGTCCAGGTGG - Exonic
1169936735 20:10891702-10891724 AGATCTTGACACTGTCCATGTGG + Intergenic
1170763822 20:19273824-19273846 AGACCTTGACCCAGCCCAAGGGG - Intronic
1170763892 20:19274221-19274243 AGACCTTGACCCAGCCCAAGGGG + Intronic
1174132481 20:48355733-48355755 ACAACCTCCCGCAGTCCAGGGGG + Intergenic
1181480133 22:23193609-23193631 AGAACTCCACTCAGCCCAGGAGG - Intronic
1183819973 22:40338250-40338272 AGACCTTGACACTGTCCAGCAGG + Intergenic
1185347579 22:50317149-50317171 AGAGCTGGACACAGCCCAGGTGG + Intronic
950409453 3:12825740-12825762 AGGACTTGACCCAGGCCATGTGG - Intronic
951122629 3:18946042-18946064 AGAACTTGAAGCAGTGCAAATGG + Intergenic
951314537 3:21172526-21172548 AGAACTTGACAAATTCCAAGAGG - Intergenic
954804506 3:53209259-53209281 AGAAGTGGACTCAGTGCAGGAGG - Intergenic
955941032 3:64147195-64147217 AGAACTTCCTACAGTCCAGGAGG - Exonic
958074061 3:88654078-88654100 AGTACTTGAGGCAGCCCTGGCGG + Intergenic
961356927 3:126345175-126345197 AGAATTGGATGCAGTCCTGGAGG - Intronic
962850251 3:139303025-139303047 AGAACATGACGTAGAACAGGTGG + Intronic
966265796 3:178041368-178041390 AGAACTTACAGCATTCCAGGTGG - Intergenic
966528417 3:180945418-180945440 AGAACGAGACCCTGTCCAGGGGG - Intronic
967978205 3:195047100-195047122 ATAACTTGCCACATTCCAGGAGG - Intergenic
971952446 4:33371512-33371534 AGAAATGGACGCATTCCTGGAGG + Intergenic
974712130 4:65611906-65611928 AGAAATTGAGGCTATCCAGGAGG + Intronic
976958066 4:90929543-90929565 AGACCTGGTGGCAGTCCAGGGGG - Intronic
980290892 4:130846681-130846703 AGAACTTGACTCAGATCATGGGG - Intergenic
980912669 4:139007807-139007829 AGAGCTGGACTCAGTGCAGGAGG + Intergenic
982069778 4:151685247-151685269 AGAACTAGACACAGTGCAGTGGG - Intronic
986743524 5:10724847-10724869 AGAGCTTGACTCTGTCCAGATGG - Intronic
987310780 5:16679277-16679299 AGAACCTGACGCAAAGCAGGTGG + Intronic
996245340 5:121256562-121256584 AGAACTTGAAGAAGTCAAGGTGG - Intergenic
1000085228 5:157882557-157882579 AGACCTTGATGCAGACCACGGGG + Intergenic
1005714219 6:28531776-28531798 AGAACTAAATGCACTCCAGGAGG + Exonic
1010986226 6:82427653-82427675 TGAACTTCAGGCAGTCCAGAAGG + Intergenic
1016404047 6:143711259-143711281 AGAACTGGAAGCAGGCCAGAAGG - Intronic
1026073699 7:67146011-67146033 AGTACTTTGCGAAGTCCAGGTGG - Intronic
1026889656 7:73974487-73974509 AGAAGTTGGGGCAGTGCAGGTGG + Intergenic
1036645571 8:10609810-10609832 GGAAGATGACCCAGTCCAGGAGG - Exonic
1039904726 8:41777991-41778013 AGCACTTGAGGCAGTAGAGGCGG - Intronic
1045321519 8:101085387-101085409 AGAACTTCCCGGATTCCAGGGGG - Intergenic
1049798012 8:144505341-144505363 AGAGCTGGGCGCAGTGCAGGTGG + Exonic
1056473033 9:86924478-86924500 AGAAATTGACTCAGTCCTGGAGG + Intergenic
1059162012 9:112043377-112043399 AGAAATTGACTCAGTGCAAGAGG + Intronic
1059949804 9:119450550-119450572 TGGACTTGGAGCAGTCCAGGTGG - Intergenic
1062123068 9:134844346-134844368 TGACCTAGACGCAGTCCACGGGG - Exonic
1198520144 X:137444300-137444322 AGAACTTGAGGCAGGCATGGTGG - Intergenic
1199970873 X:152860058-152860080 AAAACTTGAAGCAAGCCAGGGGG + Intronic