ID: 948456486

View in Genome Browser
Species Human (GRCh38)
Location 2:238106838-238106860
Sequence CCGTGGGGCTCCTTCGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948456486 Original CRISPR CCGTGGGGCTCCTTCGCATC TGG (reversed) Intronic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
902788980 1:18752179-18752201 CCGGGGGTCACCTTCTCATCTGG + Intergenic
902802545 1:18839428-18839450 CCTTGGAGGTCCTTTGCATCTGG - Intergenic
905563468 1:38945132-38945154 CCTTGGGGCACCTTGGCCTCTGG - Intergenic
906104421 1:43283338-43283360 CCCTGGGGCTGCCTGGCATCTGG - Exonic
906149077 1:43577368-43577390 CCCTGGTGCTCCCTGGCATCTGG + Intronic
915497749 1:156293542-156293564 CTGTGGGGCTCCCTCCCATCAGG - Exonic
923726623 1:236511066-236511088 GTGTGGGGCTCCATCGCATGTGG + Intergenic
1062896511 10:1107234-1107256 CTGTGGGGCCCCTCTGCATCTGG - Intronic
1062919234 10:1266566-1266588 CCCTGGGCCGCCTTCCCATCTGG + Intronic
1081603978 11:44515272-44515294 GCGTGGGGATTCTTGGCATCTGG + Intergenic
1082027625 11:47584467-47584489 CCCTGGAGCTACTTGGCATCAGG - Exonic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1089489190 11:118871299-118871321 CTGTGGTGCTCATTCTCATCAGG - Intergenic
1104942083 12:132399901-132399923 CCGCTGGGCTCCCTCGCACCCGG - Intergenic
1105698673 13:22916284-22916306 CTGTGGGTCTCCTTTGCTTCTGG - Intergenic
1106316479 13:28598871-28598893 CCTTTGGGCTCCATCCCATCAGG - Intergenic
1106505098 13:30364302-30364324 CCGTGGGCCTCATTCCTATCAGG + Intergenic
1106956394 13:34942867-34942889 CCGTGGGGCTCATTGCCGTCGGG + Exonic
1121440377 14:93945093-93945115 CAGTGGGGCTCCTTCTCTCCTGG + Intronic
1124402178 15:29358462-29358484 CCTGTGGGCTCCTTCCCATCTGG - Intronic
1132872676 16:2122762-2122784 CCTTAGGGCTCCTGCGCCTCGGG - Intronic
1133614764 16:7465675-7465697 CCCTGGGGATCCTTTGCTTCTGG + Intronic
1134231393 16:12433052-12433074 CCCTGGGGCTCCTTCCACTCAGG - Intronic
1136355945 16:29744883-29744905 CCATGGGGCTGCTTCCCATGCGG + Exonic
1138268596 16:55678552-55678574 CTGTGGGGCTGCTTGGCTTCAGG - Intronic
1142880366 17:2878770-2878792 CCGTGGGGCTCCTGGGCAGCAGG - Intronic
1143055163 17:4156915-4156937 CAGCGGGGCTCCTTAGCACCTGG - Exonic
1143261448 17:5601865-5601887 ACATGGGGCTTCTTAGCATCTGG + Intronic
1143490221 17:7281742-7281764 CAGTGGGGCTCCCGCGGATCTGG - Exonic
1143541987 17:7574276-7574298 CCTTCGGGCTCCATCCCATCGGG - Exonic
1147333897 17:39715559-39715581 CCCTGGGACTCCTCCCCATCAGG - Intronic
1147965789 17:44193609-44193631 CCATGGGCCTCCTTGGCAGCAGG - Exonic
1152667021 17:81577059-81577081 CCGTGGGGTTTGTTGGCATCTGG - Intronic
1161227040 19:3151526-3151548 CCTTGGGGCTCCATTGCCTCAGG + Intronic
1161854177 19:6754115-6754137 CCGTGTGGCTCCTTCGGAGCTGG + Exonic
1162765869 19:12919108-12919130 CATTGGGGCTCCCTCTCATCAGG - Intronic
1163200214 19:15761209-15761231 CCGGGGGGCTCCTCCCCATGAGG + Intergenic
1163258038 19:16169658-16169680 TCGTAGGGCACCTTCACATCGGG + Exonic
1163492521 19:17625154-17625176 CATTGGGGCCCCTTCCCATCTGG - Intronic
1165050573 19:33139043-33139065 CTCTGGGTCTCCTTCTCATCTGG + Intronic
937074483 2:119091027-119091049 CCTTGGGTCTCCGTCGCTTCTGG - Intergenic
937408663 2:121653583-121653605 CAGTGGGGCTCCTCTGCCTCTGG - Intergenic
948456486 2:238106838-238106860 CCGTGGGGCTCCTTCGCATCTGG - Intronic
1168968617 20:1915465-1915487 GCGTGGGCCTCCTTTGCCTCTGG + Intronic
1183028527 22:35084564-35084586 CCGAGGTGCTTCTTCACATCTGG - Intronic
951881357 3:27484029-27484051 CGGTGGGGCTCCTCCGCAGGGGG - Intronic
956546059 3:70404453-70404475 CAGTGTAGCTCCTTCCCATCTGG - Intergenic
987223464 5:15814954-15814976 CAGTGGGGCTGCTTAGGATCAGG - Intronic
1012583810 6:100898778-100898800 CCCTGGGGCTCCTTTGAAACAGG + Intergenic
1026661752 7:72308845-72308867 CCCTGGGGATCATTCCCATCTGG + Intronic
1034255797 7:149724015-149724037 CAGTGGGGATCCCCCGCATCCGG - Intronic
1034560132 7:151875244-151875266 CTGTGGGGCTACTTGGCATCAGG + Intronic
1049771532 8:144384455-144384477 ACGTGGGTCTCCCTGGCATCTGG + Intronic
1057962844 9:99473555-99473577 CCGTGGTGCTCCTTCTCAGAGGG - Intergenic
1060991728 9:127853528-127853550 CTGTGGGGCTCCTTGGCCTGGGG - Intronic
1061757295 9:132824086-132824108 CCCTGTGGCTTCTTGGCATCCGG - Intronic
1194294790 X:92114400-92114422 CCTTCGGGCTCCATCCCATCGGG + Intronic
1196746257 X:119073684-119073706 CAGTGCGGCGCCTCCGCATCAGG - Intergenic
1200921876 Y:8620475-8620497 CCTTGGGGCCCCTTCGTGTCGGG - Intergenic