ID: 948460719

View in Genome Browser
Species Human (GRCh38)
Location 2:238128742-238128764
Sequence TGGCCTGGCCGCACTACAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948460705_948460719 30 Left 948460705 2:238128689-238128711 CCACCCCCTTCTGCACAGGGGAC 0: 1
1: 0
2: 0
3: 37
4: 337
Right 948460719 2:238128742-238128764 TGGCCTGGCCGCACTACAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 96
948460707_948460719 26 Left 948460707 2:238128693-238128715 CCCCTTCTGCACAGGGGACAGAG 0: 1
1: 0
2: 1
3: 33
4: 269
Right 948460719 2:238128742-238128764 TGGCCTGGCCGCACTACAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 96
948460706_948460719 27 Left 948460706 2:238128692-238128714 CCCCCTTCTGCACAGGGGACAGA 0: 1
1: 0
2: 2
3: 19
4: 260
Right 948460719 2:238128742-238128764 TGGCCTGGCCGCACTACAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 96
948460709_948460719 24 Left 948460709 2:238128695-238128717 CCTTCTGCACAGGGGACAGAGAC 0: 1
1: 0
2: 1
3: 27
4: 320
Right 948460719 2:238128742-238128764 TGGCCTGGCCGCACTACAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 96
948460708_948460719 25 Left 948460708 2:238128694-238128716 CCCTTCTGCACAGGGGACAGAGA 0: 1
1: 0
2: 0
3: 31
4: 291
Right 948460719 2:238128742-238128764 TGGCCTGGCCGCACTACAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948460719 Original CRISPR TGGCCTGGCCGCACTACAGC TGG Exonic
902617646 1:17632537-17632559 TTGGCCGGCCGCACTACAGTGGG + Intronic
902840002 1:19068538-19068560 GGGCCTGGCAGCACTCCAGGTGG - Intergenic
903650316 1:24917984-24918006 TGCCCTGGCCACACTCCTGCTGG - Intronic
905825797 1:41025133-41025155 TGGCCTGGCTGCAGGGCAGCGGG - Intergenic
906254605 1:44338491-44338513 TGTCCTGGCAGCATGACAGCTGG + Intronic
907462365 1:54612506-54612528 CTGCCTGGCCCCACTTCAGCTGG - Exonic
907514720 1:54986333-54986355 TGGCCTTGACGGACCACAGCAGG - Exonic
912500913 1:110121386-110121408 AGGCCTGGCCCCACTGCAGCAGG - Intergenic
922219959 1:223550861-223550883 TGGGCTGGCAGCACCACAGGTGG - Intronic
923349519 1:233089940-233089962 TGGCCTGGCCCCACAGCAGGGGG + Intronic
924852196 1:247841623-247841645 TGGCTTGGCCCCAGGACAGCAGG + Exonic
1066659508 10:37726631-37726653 TCGCCTCGCCGCGCTACAGTTGG - Intergenic
1067497452 10:46773543-46773565 TGGCAGGGCGGCACTACTGCAGG - Intergenic
1067597200 10:47566872-47566894 TGGCAGGGCGGCACTACTGCAGG + Intergenic
1069558722 10:69414962-69414984 TGGCCTGGCCCGAAGACAGCGGG - Exonic
1070702527 10:78613983-78614005 TGGCCTGGCTGCACTCCTGATGG + Intergenic
1073303433 10:102484868-102484890 TGGCCTCTCCGCACTGAAGCAGG - Intronic
1073468138 10:103706323-103706345 TGGCCTGGCCTCACCAGGGCTGG + Intronic
1074703377 10:116111310-116111332 TGGGCTGGCCCCACTGCAGTTGG - Intronic
1074869370 10:117564885-117564907 TGGCCTGGCAGCCCAACAGCAGG + Intergenic
1075478421 10:122756839-122756861 CAGCCTGGCCACACTGCAGCTGG - Intergenic
1075479552 10:122768208-122768230 TGGCCTGGCCACATTGCAGCTGG - Intergenic
1077136614 11:1002682-1002704 TGGCCTGGTCTCCATACAGCAGG + Intronic
1078900590 11:15638811-15638833 AGCCCTGGCCACCCTACAGCAGG + Intergenic
1083812983 11:65115995-65116017 TGGCCTGGCAGGAGTACTGCCGG + Exonic
1090629442 11:128633433-128633455 TGGCCAGGCCCCACTTGAGCTGG - Intergenic
1091591317 12:1844456-1844478 AGGCCTGGCGGTACCACAGCGGG + Exonic
1101203118 12:102457427-102457449 TGGCCTGGCAGCTCTACAAAAGG + Intronic
1104772015 12:131369433-131369455 TGTCCTGGCCTCTCTCCAGCGGG + Intergenic
1111952249 13:94718009-94718031 AGGCCTGGCCCCAGAACAGCAGG - Intergenic
1113926975 13:113947074-113947096 CAGCCTGGCAGCACTACAGAAGG + Intergenic
1120997397 14:90427041-90427063 TGGCCTGGACGAAATACATCAGG + Intergenic
1121236898 14:92398314-92398336 TGGCCTGGCAGAACTGCAGCAGG + Intronic
1122207357 14:100154641-100154663 TGGGCTGGCCTCCCTTCAGCAGG - Intronic
1135919374 16:26634791-26634813 TGACCTGGCAGCACTACCTCAGG + Intergenic
1136625399 16:31459084-31459106 AGGCCGGGCCGCACCACCGCTGG + Exonic
1141623901 16:85251493-85251515 CGGCCTGGCCGCACCCCCGCTGG - Intergenic
1141875413 16:86820736-86820758 TGGCCTGGGGGCACCACAGAGGG - Intergenic
1142123192 16:88397090-88397112 TTGCCTGGCCTCCCTGCAGCAGG - Intergenic
1142265892 16:89063835-89063857 TGGCCTGGCTGGACCACACCTGG - Intergenic
1144729205 17:17517056-17517078 TGGCCTCCCCGCAGCACAGCAGG - Intronic
1146805795 17:35864248-35864270 TGTCATGGAGGCACTACAGCAGG - Exonic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1151595136 17:75073935-75073957 GGGCCTGGCAGCACTGCCGCAGG + Intergenic
1154405558 18:14086707-14086729 TGGCCTGGAAGGACTAGAGCGGG - Intronic
1156476032 18:37405878-37405900 TGGGCTGGCCCCCCTCCAGCCGG + Intronic
1160345028 18:78125075-78125097 TGGGCTGGCCGCCCTCCTGCTGG - Intergenic
1160455391 18:78995487-78995509 TGGCTCGGCCGCACCGCAGCCGG - Intronic
1161493094 19:4573169-4573191 CGGCCTCGCTGCACTCCAGCTGG + Intergenic
1164570731 19:29372516-29372538 TGGCCTGGCCTACCTGCAGCTGG + Intergenic
1167357657 19:49014142-49014164 TGGGCTGGCCCCGCTGCAGCAGG + Intronic
929231398 2:39564469-39564491 TTGCCTGGACCCACTACAACTGG - Intergenic
938508186 2:131909127-131909149 TGCCCAGGCTGGACTACAGCTGG - Intergenic
941621971 2:167788663-167788685 TGGCCTGGCCACACAGCAGGAGG - Intergenic
941709599 2:168698185-168698207 TGGCACCGCCGCACTCCAGCCGG + Intronic
948460719 2:238128742-238128764 TGGCCTGGCCGCACTACAGCTGG + Exonic
948742794 2:240058821-240058843 TGGCCTTGCTGCCCTTCAGCAGG + Intergenic
1176364091 21:6022198-6022220 TAGCCTGGCCCCACTGCAGGTGG - Intergenic
1179026175 21:37680643-37680665 TTGCCTGACTGTACTACAGCTGG + Intronic
1179759427 21:43516347-43516369 TAGCCTGGCCCCACTGCAGGTGG + Intergenic
1182704685 22:32269768-32269790 TGGCCTGGGCGCAGTCCAGGGGG - Intergenic
1183497246 22:38153949-38153971 TGGCCTGGCAGCACTGCCACAGG + Intronic
1183807644 22:40225162-40225184 TGGCCTGGCTGCAGTGTAGCAGG + Intronic
1183955943 22:41381123-41381145 AGGCTTGGCCGCCCTAGAGCGGG - Intronic
1184059768 22:42074614-42074636 TGGCCTGGCCCCCCTACTGGTGG + Intronic
1184805555 22:46792943-46792965 TGTCCTGGCCCCTCCACAGCAGG + Intronic
1185061668 22:48610198-48610220 GGGCCTGGCTGCACTGCTGCAGG + Intronic
1185310067 22:50149445-50149467 TGGCCTGTCCTCCCTCCAGCCGG + Intronic
951308711 3:21098293-21098315 GGGCCTGGACACATTACAGCAGG - Intergenic
960541195 3:118864448-118864470 TGACCTGGTAGCACCACAGCTGG + Intergenic
960950017 3:122993167-122993189 TGGTCTGGCCGCAGAAAAGCAGG + Intronic
961180929 3:124876789-124876811 TTGCCTGACCTCACTTCAGCAGG + Intronic
968688472 4:1977077-1977099 TGGCCTGGCTGCACTACAGTGGG + Intronic
969605109 4:8198526-8198548 TGGCCTGGGCTCACGTCAGCTGG - Intronic
974770338 4:66403622-66403644 TTGCCTGGCGGCACTCCACCTGG - Intergenic
976359789 4:84164214-84164236 TTGGCTGGCCGCAATACAGCTGG - Intergenic
979705385 4:123713983-123714005 TGGCTTTGCCGCACCACAGTGGG - Intergenic
980352194 4:131698014-131698036 TGCCCTGGCTGCCCTCCAGCTGG - Intergenic
983523292 4:168733772-168733794 TGCCCTGGCCGGACTGCAGTGGG + Intronic
999135536 5:149316295-149316317 TGCCCTGGACCCACCACAGCAGG - Exonic
1007292587 6:40798646-40798668 TGGCCTGGCAGAACTGGAGCTGG + Intergenic
1017034198 6:150252321-150252343 GGGCCTGGCTGCACTGCAGATGG - Intergenic
1018862178 6:167719205-167719227 TGGCCTGTCCACACCACCGCAGG + Intergenic
1019331559 7:463062-463084 TGGCCTGGCCCTGATACAGCGGG + Intergenic
1020986711 7:15144675-15144697 TGCCCTTGCCGCTTTACAGCAGG + Intergenic
1023240888 7:38146365-38146387 TGGGCTAGCCCCACTACTGCGGG + Intergenic
1024527312 7:50359908-50359930 TGACCTGACCCCACTACAGGTGG - Intronic
1029494372 7:100889283-100889305 TGGACTGGCCGCCGTACAGGCGG - Exonic
1032501268 7:132401993-132402015 TTGCCTGACTGCACTTCAGCTGG + Intronic
1035361774 7:158318168-158318190 TGGACAGGCCGCACCACAGGCGG + Intronic
1036168838 8:6463627-6463649 TGGCCTGGCCACACTGCATCTGG - Intronic
1041660544 8:60397318-60397340 TGGCATGGCAGCACTGCAGTTGG - Intergenic
1044067953 8:87721415-87721437 TGGCTTTGCCGCACTGCAGTGGG + Intergenic
1047527888 8:125649262-125649284 TGGCCTGGCCCCACAACTGGAGG - Intergenic
1049465188 8:142748038-142748060 TGCCCTGGCCCCATTACATCTGG - Intergenic
1049612730 8:143562919-143562941 TGGCCTGGCAGCTCTCCAGCAGG + Exonic
1050744166 9:8857810-8857832 TGGGCTGGCCGCACGAGGGCTGG - Intronic
1057314832 9:93961409-93961431 TGGCCTGCCCACATTCCAGCAGG + Intergenic
1061089623 9:128419652-128419674 CGGCCTGGCGGCACCACAGATGG - Intronic
1062185123 9:135214140-135214162 TGCCCTGGCCCCACTAACGCAGG - Intergenic
1062332480 9:136050819-136050841 TGGCGTGGGCGCACTCCTGCCGG - Intronic
1186978039 X:14929261-14929283 TGTCATGGACTCACTACAGCAGG + Intergenic
1189504512 X:41598092-41598114 TTGCATGACCGCACTCCAGCCGG + Intronic
1195687604 X:107600743-107600765 GGGCCTGGCCACACTAGGGCAGG + Exonic
1196775560 X:119333929-119333951 GGGACTGGCCGCAGTAGAGCAGG - Intergenic
1201705733 Y:16934766-16934788 TGGCCTGACAGCACTACAGATGG + Intergenic
1202150111 Y:21836729-21836751 TGGTCTGGCCTTACTTCAGCAGG + Intergenic