ID: 948461145

View in Genome Browser
Species Human (GRCh38)
Location 2:238130582-238130604
Sequence GGCCCCTGCAGGACACCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948461145 Original CRISPR GGCCCCTGCAGGACACCTGC AGG Exonic
900145339 1:1156803-1156825 GGCCCCAGCTGGACACGGGCAGG + Intergenic
900156884 1:1206731-1206753 CGCCCCTGCCGGCGACCTGCGGG - Intergenic
900458847 1:2790503-2790525 GGCACCGCCAGGACACCAGCTGG + Intronic
901530895 1:9851880-9851902 GGGCCCTACAGGTCACCTCCTGG - Intronic
901812629 1:11776551-11776573 GCTCCCTGCAGGATGCCTGCTGG + Exonic
902671529 1:17977797-17977819 GGCCCCAGGAGGCCACCTTCAGG + Intergenic
903835309 1:26199862-26199884 GGCCCCTGCCTGCCATCTGCAGG + Exonic
904263403 1:29304064-29304086 GGCCTCTGCAGGGATCCTGCTGG - Intronic
904291947 1:29492148-29492170 GACCCCTGCAGGGGTCCTGCTGG + Intergenic
904810159 1:33158281-33158303 GCCCCCTGCAGTACACCATCTGG - Exonic
904858417 1:33517255-33517277 GGGCCCTGCTGGAGACCTGTGGG + Intronic
904893749 1:33798790-33798812 GGACCCTGGAGGACACCCACTGG + Intronic
906197110 1:43936209-43936231 GTCCCCCGCCGGCCACCTGCCGG + Exonic
906790857 1:48657601-48657623 GGCCGCTGCAGAGCCCCTGCAGG - Intronic
906951117 1:50335045-50335067 GGCCCCCACAAGACACCTGCAGG - Intergenic
907334046 1:53688870-53688892 GGCACCTTGAGGACACCTGCTGG + Intronic
907443124 1:54490532-54490554 GGCGGCTGCAGGAGCCCTGCAGG - Intergenic
912363482 1:109113909-109113931 CGCCTCTGCAGCTCACCTGCGGG - Intronic
912734854 1:112141668-112141690 GGCTGCTGGAGGACACCTGAAGG - Intergenic
913228597 1:116721977-116721999 GGGCCCTGCAGGCCACTTGAAGG + Intergenic
915534637 1:156527912-156527934 TGAGCCTGCAGGACATCTGCTGG - Intronic
919924181 1:202183795-202183817 GACCCTTGCTAGACACCTGCTGG - Intergenic
922816483 1:228452967-228452989 GGGCCCTGCTGGTCACCTGCTGG - Intergenic
923339652 1:232996475-232996497 AGGCCCTGCAGGACACCTGCTGG - Intronic
924290703 1:242533845-242533867 GGCCCCTGCAGACCAGGTGCAGG + Intergenic
1063127371 10:3147591-3147613 GTCTCCTGCAGGTCCCCTGCGGG + Exonic
1063401706 10:5752439-5752461 GGGGCCTGCAGGCCACGTGCAGG + Intronic
1063579901 10:7296887-7296909 GGAACCTGCAGGCCGCCTGCTGG - Intronic
1065660233 10:27998749-27998771 GGCGGCTGCAGAACCCCTGCGGG + Intronic
1065966440 10:30774766-30774788 GGACTCTGCAGGGAACCTGCAGG - Intergenic
1067091182 10:43266565-43266587 CGCCCCTTCAGGGCACCTGGCGG - Intronic
1067691361 10:48504264-48504286 GACCCATGCAGGAAACCTGAAGG + Intronic
1067693360 10:48518703-48518725 GGCCTGTGCAGGTCACCTGCGGG - Intronic
1070311384 10:75276238-75276260 AGCCGCTGCAGGGCCCCTGCCGG - Intergenic
1070562625 10:77579204-77579226 GGCCCATGCAGGGCATCTGCCGG + Intronic
1070787711 10:79171610-79171632 GGCCACTGTAGGTCACATGCAGG + Intronic
1071467068 10:85951009-85951031 GGCCCCTGCAGGACTCCATCTGG + Intronic
1071528469 10:86372092-86372114 GGCCCTCCCAGGAGACCTGCTGG + Intergenic
1073320841 10:102615492-102615514 AGGCCCTGGAGGACGCCTGCTGG - Intronic
1075086183 10:119415827-119415849 GTCCCCTGCAAGTCACTTGCTGG - Intronic
1075598997 10:123753405-123753427 GGACCCTGAGGGGCACCTGCAGG + Intronic
1075647363 10:124105176-124105198 AGCCCCTGTTGGGCACCTGCAGG - Intergenic
1076218257 10:128712877-128712899 GGCCACAGCATGACACCTACGGG + Intergenic
1076345249 10:129774883-129774905 GGCCTCTGCAGACCACGTGCTGG - Intergenic
1076571520 10:131436257-131436279 GAGCCCAGCAGGACACCTTCGGG + Intergenic
1076816800 10:132919006-132919028 TGCCCATGCGGGGCACCTGCAGG - Intronic
1077005852 11:355835-355857 GGCCCCTCCAGGCCTTCTGCGGG - Intergenic
1077014088 11:392381-392403 GGCCCCTGCAGGGCCCCAGGTGG + Intergenic
1077096949 11:803099-803121 GGCCCCTGCAGAAGACAGGCAGG + Intronic
1077185398 11:1233461-1233483 GGCCCTGGGAGGACACCTGCTGG + Intronic
1077229297 11:1451426-1451448 GGCCCCTGCTGGAGGCCTCCTGG + Intronic
1077331072 11:1984012-1984034 GGATCCTGCAGGAAGCCTGCGGG + Intronic
1077351815 11:2096656-2096678 GGCCTCTGCGGGACACGGGCTGG - Intergenic
1077401917 11:2363133-2363155 GGCCTCTGGGGGACACCTGGAGG - Intergenic
1077489741 11:2855297-2855319 GGCCCCTCCAGGGCACTTGAGGG + Intergenic
1079136604 11:17779162-17779184 GCCCCCAGCACCACACCTGCTGG + Intronic
1083442858 11:62688322-62688344 GCTCCTTGCAGGGCACCTGCAGG + Exonic
1083892673 11:65604424-65604446 AGTCCCTGCAGGACAGATGCTGG + Intronic
1084019675 11:66410059-66410081 GAGCCCTGCCGGACCCCTGCAGG - Intergenic
1084273164 11:68039558-68039580 GGCCCCTCCAGGAACCCAGCAGG - Intronic
1084431640 11:69114583-69114605 GGCCCCAGAAGGACCCCTGTAGG - Intergenic
1085289732 11:75389221-75389243 TGCCCCTGCATGACGCCTGATGG + Intergenic
1085314285 11:75535019-75535041 GGCCACTGAAGGACCCATGCAGG + Intergenic
1086954048 11:92917286-92917308 GGCCCATGCAGGAGTCCTGGAGG + Intergenic
1089149954 11:116356919-116356941 GGCCCCGGCAGGAATCCTCCAGG - Intergenic
1090474158 11:127004451-127004473 GGGCCCTGCAGGAAAGCTGCAGG + Intergenic
1202814053 11_KI270721v1_random:39188-39210 GGATCCTGCAGGAAGCCTGCGGG + Intergenic
1091588812 12:1831014-1831036 GGCCACTGCAGTCCACCTCCAGG - Exonic
1092822548 12:12366043-12366065 GGCCCCTGCAGCAGCCCAGCAGG - Intronic
1094376412 12:29794416-29794438 AGCCACTGCAGGAGAACTGCTGG + Intergenic
1096105935 12:48997198-48997220 GGCCCCCGAAGTAAACCTGCGGG - Exonic
1096599883 12:52721757-52721779 GGCCCCACCAGAAGACCTGCAGG + Intergenic
1097079337 12:56418348-56418370 GGCCCCTGTAGGAAACCTTCTGG - Exonic
1101130638 12:101687680-101687702 GGTCCCTGCAGCCCAGCTGCTGG + Intergenic
1101594542 12:106152425-106152447 GGCCCCTGAGTGAAACCTGCAGG + Intergenic
1101986318 12:109450334-109450356 GGCCCCTGCTGGAGCCCGGCTGG - Exonic
1103272944 12:119688566-119688588 GCCACCTGCAGTTCACCTGCTGG - Intronic
1103997814 12:124841567-124841589 GGGCCTTGCAGGACACCTGGAGG - Intronic
1104823670 12:131693474-131693496 GGCCCCTGGAAGACACATGAGGG - Intergenic
1104981107 12:132573480-132573502 GGTCCCTGCTCGACACCTGCAGG - Intronic
1113883417 13:113642693-113642715 GGGCCCTGCAGGACACCATCAGG + Intergenic
1114378339 14:22173612-22173634 GGCCCCAATAGGAGACCTGCTGG + Intergenic
1114621968 14:24101477-24101499 CCCCCCTCCAGGACACCTGAAGG + Intronic
1119231575 14:72984093-72984115 GGCCTCTGCAGTAGCCCTGCAGG - Intronic
1119378394 14:74213427-74213449 TTACCCTGCAGGACACCTGCAGG - Intergenic
1119861638 14:77940355-77940377 GGCCCCTGCTGGGCACCAACAGG - Intergenic
1121645748 14:95516408-95516430 GGCCCCGGCGTGACAGCTGCGGG - Intronic
1123934941 15:25189578-25189600 AGGCCCTGAAGGACACCTTCGGG + Intergenic
1124027649 15:25981739-25981761 GTCCCCTGCAGACCCCCTGCAGG - Intergenic
1124613359 15:31224120-31224142 GGCCCCCGCGAGACACCTGAGGG + Intergenic
1124615876 15:31241729-31241751 GGCTCCTGCAGAACCCCTTCTGG + Intergenic
1125542267 15:40476401-40476423 GGCCCCTGCAGGACACAACAAGG + Intergenic
1126255221 15:46617373-46617395 GACTTCAGCAGGACACCTGCAGG - Intergenic
1128618803 15:69131649-69131671 GGCTCCTGCAAGCAACCTGCTGG - Intergenic
1129200332 15:73994841-73994863 GGCCCCAGCAGGACCCCGCCCGG + Exonic
1129206093 15:74037778-74037800 GGGCCCAGCAGCAAACCTGCAGG - Intronic
1129276076 15:74446138-74446160 GGGCCCTGCAGGCCACCGGTGGG - Exonic
1129878356 15:78991830-78991852 GGCCCATGACGGACACCTCCTGG + Intronic
1129878929 15:78994548-78994570 GGCCCCTGCATCACAGCGGCTGG - Intronic
1130253203 15:82314093-82314115 GGCTCCTGCAGGCCTGCTGCTGG - Intergenic
1131256251 15:90864599-90864621 GGCCTCTGCAGGACAAGAGCTGG - Intergenic
1132209347 15:100008518-100008540 GGGCCCAGGAGGACACCTGAGGG + Intronic
1132518930 16:378587-378609 GGCTCCTTCCTGACACCTGCTGG - Intronic
1132762959 16:1519865-1519887 GGCCCCGGGGGCACACCTGCGGG + Exonic
1132781676 16:1629982-1630004 GGCCCCTCCAGGTCACCTCACGG + Intronic
1132855373 16:2042526-2042548 GGCCCCTTTGGGACTCCTGCAGG - Intronic
1137729813 16:50681104-50681126 GGGCCCTGCCTGGCACCTGCTGG - Intronic
1138416832 16:56876469-56876491 GGGCTCTGCAGGGCCCCTGCAGG - Intronic
1141097439 16:81172826-81172848 GTCCCCTGCTGGGCTCCTGCTGG - Intergenic
1141704285 16:85656106-85656128 GTCTCCTGCAGTAAACCTGCAGG + Intronic
1141813611 16:86393641-86393663 GGCCGGTGAAGGACTCCTGCAGG + Intergenic
1142420506 16:89966749-89966771 AGCCCCTGCTGCACACCTGGAGG - Exonic
1142750449 17:1984240-1984262 GGCTCCTACAGGGCACCTGGTGG - Intronic
1142917391 17:3153051-3153073 GGACCCTCCAGGACAGGTGCAGG + Intergenic
1143162152 17:4878816-4878838 GGCCCCAGCAGGCCAGCTGTGGG - Intronic
1143271414 17:5678285-5678307 GGTGCCTGCTGGACCCCTGCAGG + Intergenic
1143520391 17:7441109-7441131 TGCCCCTTCAGTACCCCTGCTGG + Intronic
1144735953 17:17555591-17555613 GGCCCCTCCAGGACCTATGCTGG + Intronic
1144779354 17:17800046-17800068 GGCCCCGACAGGACTCCTGCAGG + Intronic
1145963521 17:28901408-28901430 GGCCCCAGCAGGGCCCCCGCTGG + Intronic
1146400397 17:32496579-32496601 GGCCCCTGCAGCCCTCGTGCTGG + Intronic
1147217259 17:38908166-38908188 TGTCCCTGCAGGCCCCCTGCTGG + Intronic
1147624825 17:41893215-41893237 GGCCCCTGCAGGTCTCCTGGGGG - Intronic
1150139724 17:62717566-62717588 GGCCCCGGCAGGAGACCCGAGGG + Intronic
1150289682 17:63974039-63974061 GACCCCTGCAGACCAGCTGCAGG + Intergenic
1150821032 17:68434500-68434522 GGTCCCTGCGGGACTTCTGCGGG + Intronic
1151188132 17:72378873-72378895 GGCTCCTGGAGGACTCCTGCTGG + Intergenic
1151998787 17:77631577-77631599 GGCTACTGCAGGAGAGCTGCAGG - Intergenic
1152250990 17:79212440-79212462 GGCCCCTGCAGCAGTCCTACAGG - Intronic
1152263953 17:79282627-79282649 GGCTCCTCCAGGACCCCTTCTGG - Intronic
1152544236 17:80992565-80992587 GACCCCGGCAGGACCCCGGCAGG - Intronic
1152565413 17:81098077-81098099 GGCCCCTCCATGACCCCAGCTGG - Intronic
1154124566 18:11678781-11678803 AGGCCCTGCTGGACCCCTGCAGG - Intergenic
1154315896 18:13303139-13303161 CACCCCTGCAGGGCACATGCTGG + Intronic
1156407514 18:36796881-36796903 GGCCCTTTCTGGCCACCTGCAGG + Intronic
1157470455 18:47984248-47984270 GGCATCTGCAGGCCAACTGCAGG + Intergenic
1157603856 18:48913350-48913372 TGCCCTTGGAGGACACCTGGTGG + Intergenic
1158478741 18:57802924-57802946 GGAACCTGCAGGACACCGCCGGG + Intronic
1160143103 18:76343377-76343399 GCCCTTTGCTGGACACCTGCTGG - Intergenic
1161015553 19:1981097-1981119 GGCCCCTGCAATATACCTGCAGG - Exonic
1161274516 19:3408186-3408208 GGCCCCAGCAGGGCATCTGCTGG - Intronic
1161719970 19:5897252-5897274 GGCTCCTGCAGAGCACCTGCTGG + Intronic
1161719982 19:5897293-5897315 GGCCCTGGCAGGGCACCGGCCGG + Intronic
1161724629 19:5921355-5921377 GGCTGCAGCAGGACACCAGCTGG - Intronic
1162464661 19:10832546-10832568 GGCCCCTGCAGGAGAGGGGCCGG + Exonic
1162637968 19:11985190-11985212 GGCAGCTGGAGGCCACCTGCAGG - Intergenic
1164604710 19:29589455-29589477 GTCCCCTGCAAGAAATCTGCAGG + Intergenic
1164619056 19:29682918-29682940 GGTCCCTGGAGCACACCAGCAGG + Intergenic
1165419212 19:35714779-35714801 GGCCCCTGCGGCCCAGCTGCTGG - Exonic
1166139432 19:40798242-40798264 GTCCCCTGCAGGCCACCTGAGGG - Intronic
1166260181 19:41633566-41633588 GGCTCCTCCAGGACACATACTGG - Intronic
1166288825 19:41848784-41848806 TGCCCCTGCAGAACTCCTGTGGG + Exonic
1166357659 19:42236578-42236600 GGTCCCAGCAGCCCACCTGCTGG + Intronic
1166711545 19:44940869-44940891 GGCCTATGCAGGAGAGCTGCAGG - Intergenic
1166934265 19:46321612-46321634 GGGGCCTGGAGGACCCCTGCTGG - Intronic
1167232049 19:48291007-48291029 AGCCCCTCCCGGCCACCTGCTGG - Intergenic
1167661578 19:50798767-50798789 GGGCCCGGCTGTACACCTGCAGG + Exonic
1168289193 19:55348809-55348831 GGCAGCTACAGGTCACCTGCTGG + Intergenic
1168692060 19:58383212-58383234 TGCCCCTGCATGAACCCTGCAGG - Intergenic
927498185 2:23564469-23564491 AGCCCCTGCAGGAAACAGGCCGG - Intronic
928411497 2:31057883-31057905 GGCACCTGCAGGAGACCTTCAGG + Intronic
929434599 2:41918876-41918898 GGTCCCTGAATGCCACCTGCAGG - Intergenic
932468643 2:71939812-71939834 GGCCCCTCCAAGAGCCCTGCAGG + Intergenic
934553789 2:95277096-95277118 CGCCCCAGGAGGACACCCGCTGG - Intronic
934567973 2:95351073-95351095 GGCCCCTGCCCCAAACCTGCGGG + Intronic
934762595 2:96864743-96864765 ACACCCTGCAGGACACCTCCTGG - Exonic
935328987 2:101962498-101962520 GGCCCCTGCAGAAGACCGGGAGG - Intergenic
936261820 2:110966343-110966365 GCTCCCTGCTGGACCCCTGCTGG - Intronic
937304222 2:120861348-120861370 GGCCCCTGCAGGCTTCCTGGAGG + Intronic
938342089 2:130542373-130542395 GGTCCCAGGAGGACTCCTGCAGG - Intronic
938347743 2:130578338-130578360 GGTCCCAGGAGGACTCCTGCAGG + Intronic
942061718 2:172234111-172234133 GGCGCCAGCAGGACACCAGTGGG + Intergenic
943032767 2:182705128-182705150 TGGCCCTTCAGGACACCTGGAGG - Intergenic
946225759 2:218263305-218263327 GCCAGCTGCAGGACATCTGCCGG + Exonic
946373574 2:219294974-219294996 GGCCCCTGCTGGACTTCCGCAGG - Exonic
947749541 2:232525287-232525309 GGCCGCTGAAGGCCACATGCCGG - Exonic
948461145 2:238130582-238130604 GGCCCCTGCAGGACACCTGCAGG + Exonic
948479724 2:238241617-238241639 GACCCCTGCAGGCTTCCTGCTGG + Intergenic
948594056 2:239068192-239068214 GGGACCTGCAGGCCACCTCCAGG - Intronic
948609288 2:239156605-239156627 TGCCCGTGCAGGAGACCTCCCGG + Intronic
948845936 2:240682860-240682882 TGTGCCTGCAGGACACCTGAGGG + Exonic
948847920 2:240691869-240691891 TGTGCCTGCAGGACACCTGAGGG - Exonic
948874080 2:240818201-240818223 TGCCCGGGGAGGACACCTGCAGG + Intronic
1170557015 20:17522929-17522951 GGGCTCTGCAGCTCACCTGCGGG + Intronic
1170566638 20:17611542-17611564 TGCTCCTTCAGGCCACCTGCTGG - Intergenic
1170614671 20:17939022-17939044 GTCCCCTCCAGGATTCCTGCGGG - Intergenic
1170640734 20:18150424-18150446 GGCACCTGGAGGCCTCCTGCTGG + Intronic
1171131074 20:22653236-22653258 GGCCCCTGCTCCACCCCTGCAGG - Intergenic
1173808332 20:45940666-45940688 AGCCCCTGCAGGGAGCCTGCAGG - Intronic
1174188060 20:48721013-48721035 GGCCCCAACAGGACACATCCTGG - Intronic
1175383172 20:58577499-58577521 GGCACCTGCGGGAGACCTGGGGG - Intergenic
1175414922 20:58794909-58794931 GGCTGCTGCAGGACAGCCGCGGG - Intergenic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1175967555 20:62667042-62667064 GGCCCCGGGAGTGCACCTGCAGG + Intronic
1176121911 20:63457849-63457871 GGCCCTGGCAGGAAACCCGCTGG + Intronic
1176129428 20:63490427-63490449 GGCGCCTGCTGGACAGCAGCAGG - Intronic
1176151963 20:63596015-63596037 GGCACCTCCAGGACACCCACTGG - Intronic
1176296661 21:5076735-5076757 GGCCCCAGCAGGGCACCCGGAGG + Intergenic
1178405828 21:32322617-32322639 GGCCCCAGCAGGACGCCCCCTGG + Intronic
1179231282 21:39506115-39506137 GGCCCCTCCAGGCCACTTTCTGG - Intronic
1179426131 21:41280140-41280162 GGCCCACGCAGGACACAGGCAGG + Intronic
1179860388 21:44185386-44185408 GGCCCCAGCAGGGCACCCGGAGG - Intergenic
1179950987 21:44708741-44708763 AGGCCCTCCTGGACACCTGCAGG + Intronic
1180028351 21:45181966-45181988 GGACCCTGGAAGTCACCTGCCGG - Intronic
1180045082 21:45301532-45301554 GGCCCCTGCAGGTGACCTCGAGG - Intergenic
1181469519 22:23129130-23129152 GGCCCATGAAGGACACCACCTGG + Intronic
1181493373 22:23274567-23274589 GGCCCAGGCAGGACACAGGCTGG + Intronic
1181681765 22:24500326-24500348 TGCCCTTGGAGCACACCTGCAGG + Intronic
1182420156 22:30245057-30245079 GGCCCCAGGAAGACAGCTGCAGG - Intronic
1182557865 22:31138784-31138806 GGTCCCTGGAAGACCCCTGCAGG + Exonic
1182900812 22:33896853-33896875 GGCCCCTGTAGCACAGCTGGGGG - Intronic
1183335650 22:37244414-37244436 GGCTCCAGCAGGAGACCTGGGGG + Intronic
1183696975 22:39428991-39429013 GGCCTCTCCAGCACCCCTGCCGG + Intronic
1185065165 22:48628400-48628422 GGAACCTGCAGGACCCCAGCAGG - Intronic
1185207049 22:49545901-49545923 GGAGCCTGCAGGACACAGGCAGG - Intronic
950718604 3:14866823-14866845 GGCCCCCACAGGACACATGAAGG - Intronic
950863858 3:16173708-16173730 GGACCATGCAGGACACCCCCTGG - Intergenic
954635441 3:52068510-52068532 GGCCCCTGCAGGAGGCCCCCAGG + Intergenic
955412085 3:58662172-58662194 GGCCCCTGCAGGCCTGCTGCTGG + Intronic
955927668 3:64023551-64023573 GTCCTCTGCTGGACACCTCCGGG + Intronic
956696260 3:71921721-71921743 GTCCACTGCAGGACCACTGCAGG + Intergenic
958021611 3:88004163-88004185 GGCCTCTGCAGGACAGCTAATGG - Intergenic
960674703 3:120182856-120182878 GGTATCAGCAGGACACCTGCTGG + Intronic
961403080 3:126660760-126660782 GGCCCCCTCAGCAGACCTGCAGG + Intergenic
961810386 3:129518633-129518655 CCTCCCTGCAGGACCCCTGCTGG + Intronic
967097741 3:186191446-186191468 GGCCCCTGAATGACACCTACAGG + Intronic
968455802 4:699048-699070 CTCCTCTGCAGGGCACCTGCGGG + Intergenic
969143415 4:5099874-5099896 GGTTCCTGCAGGACAACAGCTGG - Intronic
970763585 4:19519309-19519331 AGCACCTGCAGGAGACTTGCGGG + Intergenic
970933073 4:21536215-21536237 AGCCTCAGCAGGACACCAGCTGG - Intronic
971714147 4:30153642-30153664 GGCACCTGCAGGACAGCACCTGG + Intergenic
973634073 4:52845809-52845831 GGCTCCTGGAGGCCACCTACAGG + Intergenic
975373313 4:73613220-73613242 GTCTCATGCAGGACACCTGGAGG + Intronic
975844131 4:78507148-78507170 GGCCCCTGCCTGACACTGGCTGG - Intronic
977693813 4:99946343-99946365 GGCCCCTCCTGGAGGCCTGCGGG - Intronic
981010523 4:139920820-139920842 GGCCCCAGCTGGGCTCCTGCAGG - Intronic
984706256 4:182849281-182849303 GGCGCCAGAAGGACACCAGCAGG - Intergenic
985608434 5:871967-871989 TGCCCCTGCAGGACTCGAGCTGG - Intronic
985872553 5:2568876-2568898 GGCCCATGCAGGTCCCCTCCTGG + Intergenic
986339329 5:6775892-6775914 GGGCGCTGCAGGCCACCCGCAGG + Intergenic
989798002 5:45499254-45499276 GGCCCCTCCAAGCCACGTGCAGG + Intronic
992013731 5:72556081-72556103 GGCCCCAGGGGGAAACCTGCTGG - Intergenic
992093442 5:73339365-73339387 TGCCTCTGCGGGAAACCTGCAGG + Intergenic
995022569 5:107382764-107382786 GGCAACTGCTGAACACCTGCAGG - Intronic
1000350294 5:160347438-160347460 GTCCCCTGCAGCACCCCTGTGGG - Intergenic
1000430981 5:161152231-161152253 GGCACCTGCAGCAAATCTGCTGG + Intergenic
1001096421 5:168779031-168779053 GGCCCCTGCTGTTCACCTGGTGG - Intronic
1001542370 5:172548604-172548626 TACCCCAGCAGGACACGTGCAGG + Intergenic
1002319738 5:178367901-178367923 AGCCCCTCCAGGACAGCAGCTGG - Intronic
1002691918 5:181055855-181055877 TGCCCAGGCAGGACCCCTGCTGG + Intronic
1002783343 6:383372-383394 TGGCTCTGCAGGACACGTGCGGG + Intergenic
1002815959 6:680580-680602 GAGCCCTGCAGGGCAGCTGCTGG + Intronic
1006459767 6:34151617-34151639 GGCCCTGGGAGGAGACCTGCAGG + Intronic
1007553081 6:42745236-42745258 TGGCCCTGCTGGTCACCTGCAGG + Exonic
1007601366 6:43083759-43083781 GGGATCTGCAGGACACCTGGTGG - Intronic
1014747208 6:125214164-125214186 AGCCCCTGCAGGACACTGGAGGG - Intronic
1015440311 6:133240854-133240876 GGCCACTGCGGGCCCCCTGCCGG - Intronic
1017751608 6:157494043-157494065 GGGCCCTGCAGGGCTCCTGCGGG - Intronic
1018243950 6:161804020-161804042 GGCAGCTGCAGGTCACCTGGAGG - Intronic
1018696683 6:166396531-166396553 GCCTCCTGAGGGACACCTGCTGG - Intergenic
1018758107 6:166866999-166867021 GACCCCTTCCGGACACCTTCAGG + Intronic
1019276541 7:178793-178815 TGCCCCCGCAAGACACCTCCTGG - Intergenic
1019408861 7:898049-898071 GGCGTCTGCAGGTCACCTGGGGG - Exonic
1019423381 7:962209-962231 GGCCCGTGCAGGACCACTGTGGG + Intronic
1020282446 7:6656369-6656391 GACAGCTGCAGGACAGCTGCTGG - Exonic
1024008222 7:45242929-45242951 GGGCCCTGCAGGACACAGGTAGG - Intergenic
1024405599 7:48975952-48975974 AGCAGCTGAAGGACACCTGCAGG - Intergenic
1025004311 7:55343038-55343060 GGCCCCTGCAGGGAAGCTGGTGG + Intergenic
1026992590 7:74595704-74595726 CCCCTCTGCAGGGCACCTGCAGG - Intronic
1027446512 7:78279909-78279931 GCCTCATACAGGACACCTGCAGG + Intronic
1029116663 7:98241173-98241195 GGTCCCTGCTGGACACCCCCGGG - Exonic
1029450710 7:100640685-100640707 GGCGCCTGGAGGACACCATCAGG - Exonic
1029458885 7:100684382-100684404 GGACTCTGCTGGACTCCTGCCGG + Intronic
1029737332 7:102472131-102472153 GGCATCTGCAGCGCACCTGCTGG - Intronic
1029927057 7:104329034-104329056 TGCCCCTGCAGGTCAGCTCCCGG - Exonic
1032523023 7:132560757-132560779 TGCCCAGGCAAGACACCTGCAGG + Intronic
1033217736 7:139505772-139505794 GGCATCTGCACGACACCTGGGGG + Intergenic
1034335970 7:150323620-150323642 GGCCCCGGGGGGCCACCTGCTGG + Intronic
1034445573 7:151112437-151112459 GGCCCCAGCTGCACACATGCTGG - Intronic
1035386782 7:158478260-158478282 GTCCACTGCAGTGCACCTGCAGG - Intronic
1036922764 8:12873620-12873642 GGCCACTGCAGAACAACTCCAGG - Intergenic
1038287016 8:26214244-26214266 GGCCCCTGCAGGACAAGAGGAGG - Intergenic
1038486281 8:27937409-27937431 GGCCCCTGCTGCACAGCTCCTGG + Intronic
1040587448 8:48756972-48756994 GGCTCCATCAGGACACGTGCTGG + Intergenic
1042615256 8:70642011-70642033 GGCCCCTGCACAAAACCTGATGG + Intronic
1044781653 8:95749926-95749948 GGCCGCTGCAGGAGTCCTGGAGG + Intergenic
1046660037 8:116938734-116938756 GGGCCCTGCAGGACCCATGGTGG + Intronic
1046770250 8:118111040-118111062 GACCCAGGCAGGACACATGCAGG - Exonic
1048228264 8:132611769-132611791 GGCAGCTGCAGAACAGCTGCAGG - Intronic
1048513099 8:135079973-135079995 GGACTCTGCATGACACCTGGGGG + Intergenic
1049347248 8:142145584-142145606 GGCCCCTGCGGGACAAGGGCTGG + Intergenic
1049415483 8:142492980-142493002 GGCTCCTGAAGGCCACCAGCAGG - Intronic
1049610843 8:143554016-143554038 GGCCCCTCCCAGACACCGGCAGG - Intronic
1049918970 9:345722-345744 GCCCCACGCAGGACACCTGAAGG - Intronic
1055462126 9:76528959-76528981 GGCCCCCACAGCACAGCTGCGGG + Intergenic
1055769869 9:79705448-79705470 CGGCCCTGTAGGACACCAGCAGG - Intronic
1056446972 9:86675617-86675639 GGCTCCTGCAGGATGCATGCAGG + Intergenic
1056569186 9:87800784-87800806 GGCCCCTGCTGGACAGCAGAGGG + Intergenic
1057074834 9:92133031-92133053 GACCCTTGCTAGACACCTGCTGG - Intergenic
1057689592 9:97271543-97271565 GGCCCCTACAGCACAGCGGCAGG + Intergenic
1060933681 9:127504135-127504157 GCCCCCTGGAGGCCACCAGCCGG - Intergenic
1062445023 9:136590012-136590034 GGAGCCGGCAGCACACCTGCTGG + Intergenic
1187701511 X:21968171-21968193 GGGCCCTGCAGCACTGCTGCTGG - Intronic
1189145589 X:38651651-38651673 TGCTCCTGCAGGATACATGCAGG - Intronic
1190532795 X:51396336-51396358 AGGCCCTGCTGGACACCTTCTGG + Intergenic
1190598478 X:52067935-52067957 GCCCCTTCCTGGACACCTGCTGG - Intronic
1190610346 X:52186138-52186160 GCCCCTTCCTGGACACCTGCTGG + Intronic
1191253446 X:58269923-58269945 AGCCCCTGCATGGCACCTGGGGG - Intergenic
1192211215 X:69129074-69129096 GGCCCCTGGAGCACAACTGGAGG - Intergenic
1195732547 X:107981369-107981391 AGCCCCTGCAAGACCTCTGCGGG + Exonic
1197873836 X:131083981-131084003 GGCCCCTGCCTGAAACCTGGAGG - Intronic
1197958792 X:131981168-131981190 GCCCCCAGCAGGACGCCAGCAGG - Intergenic
1200234018 X:154459641-154459663 GGCCCCTGCAGGGGACATGGTGG + Intronic