ID: 948462515

View in Genome Browser
Species Human (GRCh38)
Location 2:238137200-238137222
Sequence CAGGGGAAAGAGCAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1535
Summary {0: 1, 1: 2, 2: 6, 3: 190, 4: 1336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948462503_948462515 18 Left 948462503 2:238137159-238137181 CCAAGGCTGGGGAAAAACCCTGG 0: 1
1: 0
2: 1
3: 17
4: 274
Right 948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG 0: 1
1: 2
2: 6
3: 190
4: 1336
948462502_948462515 19 Left 948462502 2:238137158-238137180 CCCAAGGCTGGGGAAAAACCCTG 0: 1
1: 0
2: 1
3: 21
4: 208
Right 948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG 0: 1
1: 2
2: 6
3: 190
4: 1336
948462509_948462515 0 Left 948462509 2:238137177-238137199 CCTGGGACAGTGTGGGACACGAG 0: 1
1: 0
2: 0
3: 8
4: 163
Right 948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG 0: 1
1: 2
2: 6
3: 190
4: 1336
948462508_948462515 1 Left 948462508 2:238137176-238137198 CCCTGGGACAGTGTGGGACACGA 0: 1
1: 0
2: 3
3: 7
4: 125
Right 948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG 0: 1
1: 2
2: 6
3: 190
4: 1336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948462515 Original CRISPR CAGGGGAAAGAGCAGGAGCA GGG Intergenic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900020918 1:186316-186338 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900151496 1:1181012-1181034 CAGGGGCAAGGGCAGGGGCAGGG - Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900337198 1:2170090-2170112 CAGGGTGAAGAGCAGAACCAGGG - Intronic
900474578 1:2870147-2870169 GAGGGGACAGAGCTGGAGCCTGG - Intergenic
900951483 1:5860431-5860453 GACGGGGAACAGCAGGAGCAGGG + Intergenic
901387744 1:8922146-8922168 AAGGGGACAGAGCTGGAGCAGGG - Intergenic
901689784 1:10965219-10965241 GAAGAGAAAGAGGAGGAGCAGGG + Intronic
901736647 1:11316742-11316764 CAGGGGCAAGAGAAGGAGAGAGG - Intergenic
901829187 1:11881714-11881736 CAGGGGAATAAGGAGGAGCCAGG + Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902235105 1:15052325-15052347 CAGGCGAGAGAGCATGTGCAGGG + Intronic
902557802 1:17257259-17257281 CAGGGGAAATGGCAGAACCAGGG - Intronic
902699825 1:18164275-18164297 AAGGGGAGAGGGAAGGAGCAAGG - Intronic
902776715 1:18679489-18679511 GAGGGGAAAGAGCAGCAGCTGGG - Intronic
902919062 1:19655880-19655902 CAGGGAAAAGAACAGGTGCAAGG - Intronic
903139145 1:21328248-21328270 CCTGGCAGAGAGCAGGAGCAGGG - Intronic
903269201 1:22177232-22177254 CAGGGGAGGGACAAGGAGCAAGG + Intergenic
903581224 1:24372477-24372499 CCCGGGAGGGAGCAGGAGCAGGG + Intronic
903653393 1:24934402-24934424 GAGGGGAGGGAGAAGGAGCAAGG + Intronic
903894547 1:26595385-26595407 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894550 1:26595391-26595413 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894553 1:26595397-26595419 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894556 1:26595403-26595425 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894559 1:26595409-26595431 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
904310588 1:29626938-29626960 CGGTAGAAAGTGCAGGAGCAGGG - Intergenic
904321239 1:29698896-29698918 CAGGGGCAGGGGCAGGAGCAGGG - Intergenic
904376832 1:30086840-30086862 CAGGGGAAAGACGATGAGAAGGG + Intergenic
904494623 1:30879646-30879668 CAGGGGCAGGAGCCGGAGCCTGG - Intronic
904921573 1:34012223-34012245 CAGCGGGAAGAGCAAGGGCAAGG - Intronic
905037127 1:34925536-34925558 GAGGGGAAGAAGCAGGAGCGAGG + Intronic
905106605 1:35566797-35566819 GAAGGGAGAGAGCAGGTGCAGGG - Intronic
905108350 1:35577156-35577178 AAGGGGAAGGGGCAGGAGCCGGG + Intronic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
906103024 1:43275171-43275193 AAGAGAAAAGAGCAGAAGCAGGG - Intergenic
906159538 1:43637536-43637558 AAGGGGCAGGAGCAGAAGCAGGG + Intergenic
906592171 1:47035597-47035619 CAGCGGAGTGAGAAGGAGCATGG - Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906724668 1:48035578-48035600 CAAAGGAAAGAGCAGGGGGAGGG + Intergenic
906733867 1:48105694-48105716 CAGGGGAGATAGCTGGTGCAGGG - Intergenic
906869091 1:49456720-49456742 CAGAGGAAAGGGTAGGAGCGGGG - Intronic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907999123 1:59663278-59663300 AAGTGGAAAGAGCAGAAGCCTGG - Intronic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909685181 1:78339817-78339839 CAGGAGAAAGAGCTAGAGCAAGG + Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912696929 1:111848911-111848933 CAGGGGAAAAGGGAAGAGCAAGG - Intronic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
912788633 1:112628983-112629005 CAGGAGCAACAGCAGAAGCAGGG - Intronic
912798001 1:112704603-112704625 CAGGAGGGAGAGCAGAAGCAGGG + Intronic
913044143 1:115059123-115059145 CAGGGGAAAGGGTAGGAGTGAGG + Intronic
913088546 1:115460362-115460384 TATGGAAAGGAGCAGGAGCAAGG + Intergenic
913185213 1:116364478-116364500 CAGTGGAAAGAGAAGGGGCTGGG + Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913509688 1:119550450-119550472 CAGGAGAAAGAGAAGGCGCACGG + Intergenic
913998571 1:143672802-143672824 CAGGGGAGAGGGCAGGGTCAGGG - Intergenic
914382487 1:147130065-147130087 CACGGCTAAGTGCAGGAGCAAGG - Intergenic
915004423 1:152623298-152623320 CAGGGGAGAGGGCCGGAGGAAGG - Intergenic
915191869 1:154157601-154157623 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
915306599 1:154983362-154983384 CAAGGGAAAGAGCCGGTGAAGGG + Exonic
915601538 1:156925609-156925631 TATGGGAAGGAGCAGGAGCAAGG + Intronic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
916126882 1:161579625-161579647 GAGGGGAAAGAGGAAGAGTATGG - Intergenic
916136801 1:161661429-161661451 GAGGGGAAAGAGGAAGAGTATGG - Intronic
916149655 1:161774298-161774320 GAGGGGCAAGGGCAGAAGCAGGG + Intronic
916273250 1:162966861-162966883 CGGGGGAAAGAGTAGAAGCAAGG + Intergenic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916451402 1:164923945-164923967 GAGGGGGAAGACAAGGAGCAGGG + Intergenic
916745006 1:167678474-167678496 CAAGGGAAAGAGAAGAATCATGG - Intronic
917079726 1:171245132-171245154 TAGGGGAAAGGGCAGGAGGGAGG + Intergenic
917165684 1:172110124-172110146 CAGGGGCAAGAGAAGGAACAGGG - Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919592635 1:199523605-199523627 CAGGGGAAAGGGTAGGAGGGAGG - Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919879945 1:201894817-201894839 CAGGGGAAGGAGCTAGGGCAGGG + Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920037186 1:203073839-203073861 CTAGGGTAAGAGCAGGATCATGG + Intronic
920039249 1:203085221-203085243 CTGAAGAAAGATCAGGAGCAAGG - Intronic
920189984 1:204187555-204187577 CAGGGGCAAGAGCAGATGCCTGG + Intergenic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
920805039 1:209224968-209224990 AAAGGGAAAGAGAAGGAGAATGG - Intergenic
921137113 1:212271494-212271516 TAAGGGAAACAGCATGAGCAAGG - Intergenic
921238579 1:213153306-213153328 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
921238582 1:213153312-213153334 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
921736659 1:218635746-218635768 GAGGGGAGAGAGAAGGAGCGGGG + Intergenic
922067010 1:222154146-222154168 CTGAGGACAGTGCAGGAGCACGG - Intergenic
922080064 1:222287308-222287330 GTGGGGAAATAGCAGGAGCTCGG - Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922195215 1:223353736-223353758 CAGAGGAAGGGGCAGCAGCAGGG + Intronic
922204666 1:223436053-223436075 AAGAGGAAAAAGCAGGAGAAGGG + Intergenic
922361642 1:224828162-224828184 CAGGGGAAAGATCTGAAGCAGGG + Intergenic
922558367 1:226549565-226549587 CCGGGGAAAGAGGACGAGCCGGG + Intronic
922724927 1:227918294-227918316 CTGGGGAAAGAGGAGGACCTGGG - Intergenic
922744497 1:228036669-228036691 CAGGGGACAGAGAAGCTGCACGG - Intronic
922747340 1:228051847-228051869 CATGGGCCAGAGCAGGAGCAAGG + Intronic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923143323 1:231179911-231179933 CTGGGCAAAGAGTAGGAGAAGGG + Intronic
923186175 1:231575740-231575762 CAGGAGAAAGACCAAGAGTATGG - Intronic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923384252 1:233450842-233450864 CAGGCAAAAGAGCATGTGCAGGG + Intergenic
923481142 1:234385322-234385344 CAGGTGATAAAGCAGCAGCAGGG - Intergenic
923543682 1:234908591-234908613 CAGGGGATAGAGGGGAAGCAAGG + Intergenic
924043483 1:240006285-240006307 CAGAAGAAAGAGAAGAAGCATGG - Intergenic
924258247 1:242203618-242203640 CAGTGGCAAGAGAGGGAGCAAGG - Intronic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
924886954 1:248229213-248229235 CTAGGGAACCAGCAGGAGCAGGG + Intergenic
924903724 1:248429982-248430004 CAAGGGAAAGAGAAGCACCAGGG - Intergenic
924924147 1:248662018-248662040 CAAGGGAAAGAGAAGCACCAGGG + Intergenic
924955842 1:248925841-248925863 CAAAGGAAAGAGCAGGATCCTGG - Intergenic
1062969186 10:1633062-1633084 CAGGAGAGGAAGCAGGAGCACGG - Intronic
1063121346 10:3106997-3107019 CAGGGGTGAGAGGAGGGGCAGGG - Intronic
1063474993 10:6320494-6320516 CAGGTGAAAGGGCAGTGGCACGG + Intergenic
1063675590 10:8138515-8138537 CAGGGGACAGAGAAGGGGCCTGG - Intergenic
1063821282 10:9839269-9839291 CAGGGGAAAGGGCAAGAGTGGGG + Intergenic
1064263839 10:13808675-13808697 CAGGGGAAAGGGCAGGTGTCAGG - Intronic
1064283287 10:13970309-13970331 CAGGTGAAGAAGCAGGAGCAGGG + Intronic
1064302802 10:14137827-14137849 AAGGGGAAAGAGGAGAGGCAAGG - Intronic
1064555599 10:16544307-16544329 CAGTGGAAAGAGCAGGGGTGGGG - Intergenic
1065081792 10:22136466-22136488 TTGGGGAATGAGCAGGAGCCAGG - Intergenic
1065223978 10:23524218-23524240 TAGGAGCAGGAGCAGGAGCAGGG + Intergenic
1065223985 10:23524236-23524258 CAGGGGCAAGAGCAGGGGTGGGG + Intergenic
1065359078 10:24872220-24872242 CAAGGGCAGTAGCAGGAGCATGG - Intronic
1065611252 10:27472721-27472743 CAGGTGCAAGAGCAGAAGTAGGG + Intergenic
1065890766 10:30119241-30119263 CAGGGGAAAAGGCAGGAGGGAGG + Intergenic
1066025048 10:31348170-31348192 CTGGGAAAAAAGCAGAAGCAGGG + Intronic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066391602 10:34981270-34981292 CAGAGGAAAGAGTAAGACCATGG + Intergenic
1066431610 10:35357166-35357188 CAGGGGCAGGGGCAGGAGCAGGG - Intronic
1066478730 10:35774036-35774058 CAGAGGAATGATTAGGAGCATGG + Intergenic
1066753367 10:38683435-38683457 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1067024841 10:42836080-42836102 CAGGGGCCAGAGCAGCAGCAAGG - Intergenic
1067166048 10:43867385-43867407 CGGGGGCAAGGGCAGGGGCAGGG + Intergenic
1067437280 10:46287129-46287151 CTGGTGAAAGGGCAGGAGGAGGG + Exonic
1067683717 10:48455314-48455336 CAGTGGATAGAGCTGGGGCAGGG + Intronic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1067978997 10:51061245-51061267 CAGGCAAAAGAGCATGTGCAGGG + Intronic
1068432163 10:56947887-56947909 CATGGGAAAGACTGGGAGCAAGG - Intergenic
1068922686 10:62501306-62501328 CAGAGGGAAGAGCATGTGCAAGG - Intronic
1068935516 10:62632217-62632239 CAGTGGAAAGAGCAGGGGCTGGG - Intronic
1069246888 10:66217959-66217981 TAGGGGAAGGAGCTGGAGCCAGG + Intronic
1069576945 10:69537507-69537529 CAGGAGAGAGGGCTGGAGCAAGG - Intergenic
1069838805 10:71326597-71326619 CAGTGGACAGAGGAGGGGCAGGG - Intronic
1070415697 10:76187375-76187397 CAAGGGAAAGGAAAGGAGCAAGG - Intronic
1070522078 10:77262692-77262714 CAAGAGAGGGAGCAGGAGCAAGG - Intronic
1070539559 10:77406419-77406441 CAGGGGCACGAGAAGAAGCAAGG - Intronic
1070586345 10:77769735-77769757 AAGTGGAAAGAGCAGGAGCCAGG - Intergenic
1070671364 10:78379840-78379862 CAGGGTAAAGTTCAGGAGCCAGG - Intergenic
1070772009 10:79088106-79088128 CAGGGGAAAGGGCAAAAGAAGGG - Intronic
1070777930 10:79120882-79120904 CAGGTGGGAGAGCGGGAGCAGGG - Intronic
1071105552 10:82089951-82089973 GAGGGCAAAGAGCTGGGGCAGGG - Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071473576 10:86005406-86005428 AAGGAGAAAGATCATGAGCAAGG + Intronic
1071809569 10:89164726-89164748 AAGGGAAAAGAGTTGGAGCAAGG + Intergenic
1071877761 10:89861320-89861342 GAGGGGGAAGAGGAGGAGTAGGG - Intergenic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1071889944 10:89993479-89993501 CAGGGGAAAGGGTGGGAGAATGG - Intergenic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072411955 10:95210991-95211013 GAGGGAAAAGAGGAAGAGCAGGG + Intronic
1072423664 10:95310859-95310881 GAGGGGCAATAGCAGAAGCAGGG + Intergenic
1072563592 10:96599127-96599149 CAGCTGAAAGAGCAGCAGAACGG + Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072826247 10:98609781-98609803 CATAGGAAACAGCAGGAGCCTGG - Intronic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1073053433 10:100684034-100684056 CAGGGGGGAGGGGAGGAGCAGGG + Intergenic
1073091132 10:100940773-100940795 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1073091135 10:100940779-100940801 GAGGGGCAGGGGCAGGAGCAGGG - Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073249943 10:102115059-102115081 GAGAGGAAAGAGGAAGAGCAAGG + Intronic
1073703244 10:105954154-105954176 CAAAGGAAAGAACAGGAGGAAGG + Intergenic
1073990817 10:109260792-109260814 CAGGCAAAAGAGCACGTGCAGGG + Intergenic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074672200 10:115804455-115804477 AAGAGCAAAGAGCAGGAGCCAGG - Intronic
1074825866 10:117215597-117215619 CAGGGGATGGAGTGGGAGCATGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075570979 10:123545211-123545233 CAGGCAAAAGAGCATGTGCAGGG + Intergenic
1075709048 10:124521045-124521067 AAGGGGACAGTGCAGGAGGAGGG - Intronic
1076197243 10:128527716-128527738 CAGGGGAGGGAGCGGGAGCTGGG - Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076318956 10:129564419-129564441 GAAGGGGAAGAGAAGGAGCAAGG - Intronic
1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG + Intronic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1077233639 11:1469629-1469651 CAGGAGCAGGAGCAGGTGCAGGG + Intronic
1077235844 11:1481703-1481725 CAGGGGCAGGAGCAGGGGCAGGG + Intronic
1077235850 11:1481715-1481737 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1077235853 11:1481721-1481743 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1077405617 11:2381247-2381269 CAGGGCACAGAGCAAAAGCAGGG + Intronic
1077511320 11:2965130-2965152 GAGGAGAAAGAGCAGAAGCCTGG + Intronic
1078662741 11:13300073-13300095 CAGGGGAAAGGCCAAGATCAGGG - Intronic
1078696111 11:13633721-13633743 CAGGAGAAAGAGCAAGAGTGGGG + Intergenic
1078914717 11:15768674-15768696 AAGAGGAAAGAGCAGGACAAAGG - Intergenic
1079049702 11:17143319-17143341 CAGGTGAAAGATAAAGAGCATGG - Intronic
1079309002 11:19347950-19347972 CAGGAGAAAGAGGAGAAGCAAGG - Intergenic
1079399033 11:20091016-20091038 CAGGTGAGAGCCCAGGAGCATGG + Exonic
1080091315 11:28352618-28352640 CAGGGTAAGGAGCAGGAATAAGG - Intergenic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1080306370 11:30840688-30840710 AAGGGGAAGGAGCCAGAGCAGGG + Intronic
1080506446 11:32918687-32918709 GAGGGGCAAGAGCAGAGGCAAGG + Intronic
1080862956 11:36166104-36166126 CAGCGGAAAGAGCAGGAACCAGG - Intronic
1081087454 11:38819427-38819449 AAGGGGAAAGAGCTGTAGCAAGG - Intergenic
1081305645 11:41508755-41508777 CAGGGAGAAGAGCACGAGAAAGG + Intergenic
1081462105 11:43281426-43281448 CAAGGGATAGAGCAGGAGGCAGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081905403 11:46666221-46666243 AACGGGAAACAGCAGGAGCTCGG + Intronic
1082243511 11:49893572-49893594 CAGGAGGAGGAGGAGGAGCACGG - Intergenic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1082892424 11:58154177-58154199 GAGGGGAAGGAGGAGGAGAAGGG + Intronic
1083424412 11:62575683-62575705 GAGGGGAAAGAGGAGCAGCAGGG - Exonic
1083887495 11:65580050-65580072 CAGGGGAGAGACCAGGAGAAGGG - Intronic
1084014200 11:66369139-66369161 CAGGGCAAAGAGCAGCAGTATGG + Exonic
1084155784 11:67311765-67311787 CAGGAGCAGGAGCAGGGGCAGGG + Exonic
1084155790 11:67311777-67311799 CAGGGGCAGGGGCAGGGGCAGGG + Exonic
1084182658 11:67454508-67454530 GGGTGGAAGGAGCAGGAGCAGGG + Intronic
1084212924 11:67632129-67632151 CAGGGCAAAGAGCACAGGCAGGG - Intronic
1084554174 11:69865864-69865886 CAGGAGAAATGGCAGGAGTAGGG + Intergenic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1084616640 11:70240794-70240816 CAGGGCTAAAAGCAGCAGCAAGG - Intergenic
1084739745 11:71131938-71131960 CAGCTGCAAGAGGAGGAGCAGGG + Intronic
1084937998 11:72597468-72597490 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1084972693 11:72780476-72780498 GAAGGGAAAGAGCAAGAGCAGGG + Intronic
1085172075 11:74457882-74457904 CAGGCAAGAGAGCAGGTGCAGGG - Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086365843 11:86109743-86109765 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086365846 11:86109749-86109771 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086365849 11:86109755-86109777 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086597567 11:88592111-88592133 CAGGGGAAAGAGCACTGGCTTGG + Intronic
1086917486 11:92547614-92547636 AAGGGGAGAGGGCAGAAGCAGGG - Intronic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1089165824 11:116475698-116475720 AAGGGGTAAGAGCAGAAGCAGGG + Intergenic
1089386026 11:118068613-118068635 CTGGGGAATGAGCTGGGGCAAGG + Intergenic
1089559588 11:119337109-119337131 CAGGGGAAAGAGCAGAAATCCGG - Exonic
1089692499 11:120195612-120195634 AAGGGGCAGGAGCAGGGGCAGGG - Intergenic
1090098749 11:123771572-123771594 CATGGGAATGAGAAGGAGAAAGG - Intergenic
1090429582 11:126634841-126634863 TAGTGGAAAGAGCACCAGCAAGG - Intronic
1090464997 11:126925732-126925754 CAGAGAGAAGTGCAGGAGCAGGG - Intronic
1091116176 11:133015821-133015843 AGGAGGAAACAGCAGGAGCAAGG - Intronic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1091374293 12:15912-15934 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1091900616 12:4141183-4141205 CAGGTGAAAGAGCAGGAAACGGG + Intergenic
1091948153 12:4567823-4567845 CAGGCCTAAAAGCAGGAGCAGGG - Intronic
1092180458 12:6443273-6443295 AGGGGGTCAGAGCAGGAGCAGGG - Intergenic
1092312332 12:7371067-7371089 CAGGCAAAAGAGCATGTGCAGGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092540246 12:9416169-9416191 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1092713508 12:11363758-11363780 AAGAGAAATGAGCAGGAGCAAGG + Intronic
1092717219 12:11402974-11402996 AAGAGAAATGAGCAGGAGCAAGG + Intronic
1093130418 12:15385278-15385300 CAGAGGAAAAGGCAAGAGCAGGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1094069799 12:26400781-26400803 CAGGGGAGAGAGCGTGAACAAGG + Intronic
1094383174 12:29865755-29865777 CAGAGAAAAGAGCAGATGCAAGG + Intergenic
1094555751 12:31497918-31497940 CAGGGGCAAGGGCAGGGGGAGGG + Intronic
1094796528 12:33979617-33979639 TCGAGGAAAGAGCAGGAGCTGGG + Intergenic
1095401361 12:41818084-41818106 CCAGGGCAGGAGCAGGAGCAAGG - Intergenic
1096113599 12:49042442-49042464 CAAGGGAATGGGGAGGAGCAGGG + Intronic
1096228369 12:49883492-49883514 CAGGGGAAGGGGCAGGAGCTTGG + Intronic
1096402604 12:51319620-51319642 AAGGAGAAAGAGCAAGAGCAAGG + Intronic
1096466770 12:51850993-51851015 CAGGGGCAAGACCAGCAGCTTGG + Intergenic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096678948 12:53242151-53242173 CGGGGGCAAGAGCAGGTGCAGGG - Intergenic
1096787387 12:54025058-54025080 AAGGGGCCAGAGCAGTAGCAAGG + Intronic
1096799792 12:54102544-54102566 CAGGTGACAGAGGAGGACCAAGG - Intergenic
1096837194 12:54358436-54358458 AATGGGAAAGACCAGGAGGAAGG - Intergenic
1096868999 12:54581878-54581900 GAGGGGAAAGAGTTGGAGCCTGG - Intronic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1097426633 12:59453787-59453809 CAGGAGAAAGAGCAGGAATAAGG + Intergenic
1097607577 12:61774663-61774685 CGGGGGAAAGAGTGGGAGGATGG + Intronic
1098036905 12:66312704-66312726 CAGGAGAGAGTGCAAGAGCACGG + Intronic
1098081508 12:66790887-66790909 AAGGGGAAGGAGCGGGAGGAAGG + Intronic
1098303235 12:69075819-69075841 CAGGGGGAAGAGGAGGATAATGG + Intergenic
1098407349 12:70140505-70140527 CAAGGGAAAGAGAAAGGGCAAGG - Intergenic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098840470 12:75471530-75471552 AAGGGCAAAGAGAAGCAGCATGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100343188 12:93701238-93701260 CAGGAGGAAGAGGAGGAGAAGGG - Intronic
1100804521 12:98267579-98267601 GAGGGAAAAGAGCAAGAGAAAGG + Intergenic
1100950258 12:99840471-99840493 AAGGGGAAAGGGTAGAAGCAAGG + Intronic
1100961653 12:99968850-99968872 CAGGGGCAAGAGAGAGAGCAGGG - Intronic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101489500 12:105198095-105198117 AAGTGGAAAGAGCAGCAGAAGGG + Intronic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1102430992 12:112882677-112882699 CTGGGGAGTGAGGAGGAGCAGGG - Intronic
1103037339 12:117667198-117667220 CAGGGGAAAGAGCAGGAACTGGG + Intronic
1103468487 12:121161114-121161136 CTGGGGACAGAGCCGAAGCATGG - Intronic
1103568295 12:121828094-121828116 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1103568299 12:121828100-121828122 CAGGGCCAGGGGCAGGAGCAGGG - Intronic
1103912923 12:124362147-124362169 CCGGGGCAAGAGCAGGAGCCCGG - Exonic
1104113796 12:125729349-125729371 CAGCTGATAAAGCAGGAGCAGGG + Intergenic
1104165849 12:126229107-126229129 CAGAGGGAAGAACAGGTGCAAGG + Intergenic
1104483972 12:129133504-129133526 AAGGGGGAAGAGCAGGATAAAGG - Intronic
1104846123 12:131847870-131847892 CAGGGGACAGAGGGGGAGCAGGG - Intronic
1105617360 13:22030808-22030830 TAGGGGAAAGAGCAGAAACTGGG - Intergenic
1105759760 13:23503216-23503238 CTGGGGCAAGGGCAGGAACATGG - Intergenic
1106019359 13:25899898-25899920 CAGGGGAAAGAGTGGAGGCAGGG + Intronic
1106041896 13:26101488-26101510 CACAGAAAAGAGGAGGAGCAAGG + Intergenic
1106299927 13:28454088-28454110 CTGGGGAAAGAGCAGTAAGAGGG - Intronic
1107230987 13:38110213-38110235 GAGGGTAAAGAGCGGGAGAAGGG + Intergenic
1107449044 13:40492206-40492228 CAAGAGCAAGAGCAAGAGCAAGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108007591 13:45966929-45966951 AAGGGTAAAGAACAGAAGCATGG + Intronic
1108185751 13:47886944-47886966 CAAGAGAGAGAGCATGAGCAGGG + Intergenic
1108257904 13:48628352-48628374 CAGGAGAGAGAGCATGTGCAGGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108581714 13:51833686-51833708 CAGGGGAATGAACTGGAGTATGG + Intergenic
1108814548 13:54273898-54273920 AAGGGGAAAGAGGAGAAGAAAGG - Intergenic
1108874523 13:55028477-55028499 TAAGGGAAAGAGAAAGAGCAAGG + Intergenic
1109617766 13:64859152-64859174 CAGGGGAAAGAGTGGGAGTAGGG - Intergenic
1109718905 13:66252317-66252339 GAAGGGAAAGAGAAGAAGCAGGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110718707 13:78737532-78737554 CAGGGAAACCAGCAGGATCACGG + Intergenic
1110810090 13:79803090-79803112 GAGGGGAAAGAGAACCAGCAGGG + Intergenic
1111315640 13:86555296-86555318 CAGGGAAGAGAGCAGGATCAAGG + Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1111820090 13:93203134-93203156 CAGGGGAAAGAATGGGAGTAGGG - Intergenic
1112842894 13:103601407-103601429 CCCGGAAAAGAGCAGGAGCAAGG + Intergenic
1113289925 13:108894103-108894125 CAGGAGAGAGAGCATGCGCAGGG + Intronic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1113988686 13:114340973-114340995 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1114407538 14:22470771-22470793 CAGGGACAAGAGCAGAAGCAAGG - Intergenic
1114563734 14:23612549-23612571 GAGGGGAAAGTGCAGTAGGATGG + Intergenic
1114901924 14:27072279-27072301 GAGGGGAGAGGGCAGGAGGAGGG + Intergenic
1116268047 14:42721148-42721170 GAGAGGAGTGAGCAGGAGCATGG + Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117327769 14:54684727-54684749 CTGGGGATGGAGCAGCAGCAAGG + Intronic
1117647812 14:57870738-57870760 CAATGGACAGAGCAGGGGCAGGG - Intronic
1117763840 14:59059702-59059724 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1119045480 14:71314991-71315013 CAGAGGAAAGAGCAAATGCAAGG + Intergenic
1119123144 14:72098332-72098354 CAGGGGACAGAGAAAAAGCAAGG - Intronic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119296578 14:73537915-73537937 CAGTGGAAAGCGCAGGAACAGGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119782802 14:77289057-77289079 CAGGTGAACAAGCAGGAGAAAGG + Intronic
1119894599 14:78209254-78209276 CAGGTGAAACAGGAAGAGCATGG + Intergenic
1119970262 14:78962395-78962417 CAGGGGAAAGAGAAGTAACTGGG - Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1120923170 14:89773204-89773226 AAGGGGAAAGAGCACGTGGAGGG + Intergenic
1121019556 14:90570954-90570976 CGGTGGAAAGATCGGGAGCACGG - Intronic
1121231975 14:92364961-92364983 CAGTGGAAAGGGCAGGGGCAAGG - Intronic
1121263271 14:92581900-92581922 AAGGGGAAACATCAGGGGCAGGG + Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121777260 14:96598892-96598914 CAGGGGAAAGTGGAGCAGCAGGG - Intergenic
1121951244 14:98172511-98172533 CAGGGCAAAGCGCAGCAGCTGGG - Intergenic
1122024882 14:98868436-98868458 GAGGGGAAATGGCAGGTGCAAGG + Intergenic
1122278471 14:100607681-100607703 CAGGCCAAAGTGCAGGACCATGG - Intergenic
1122323099 14:100867194-100867216 CTGGGGACTGTGCAGGAGCAGGG - Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122505778 14:102230847-102230869 TTGGGGAAAGATCAGGAGAAGGG + Intronic
1122672044 14:103379842-103379864 GAGGGGAAAGAGGAGGGGCCGGG - Intergenic
1122831110 14:104396353-104396375 CAGGGGTCAGAGCAGGGCCAAGG - Intergenic
1123053711 14:105559750-105559772 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123053714 14:105559756-105559778 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123053717 14:105559762-105559784 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123053723 14:105559774-105559796 CAGGGGCACGGGCAGGGGCAGGG - Intergenic
1123053729 14:105559786-105559808 CAGGGGCACGGGCAGGGGCACGG - Intergenic
1123078296 14:105680173-105680195 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078299 14:105680179-105680201 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078302 14:105680185-105680207 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078308 14:105680197-105680219 CAGGGGCACGGGCAGGGGCAGGG - Intergenic
1123078314 14:105680209-105680231 CAGGGGCAGGGGCAGGGGCACGG - Intergenic
1123189252 14:106552049-106552071 CAGGAGAGAGAGAAAGAGCAAGG - Intergenic
1202930218 14_KI270725v1_random:28582-28604 CAAGGGCAAGGGCAGGGGCAGGG - Intergenic
1123422158 15:20142918-20142940 CAAGGGCAAGGGCAGGGGCAGGG + Intergenic
1123425475 15:20167536-20167558 CAGGGGCCAGAGCAGCAGCGAGG - Intergenic
1123442917 15:20303699-20303721 CAAGGGCAAGGGCAGGTGCAGGG - Intergenic
1123448482 15:20345847-20345869 CAGGAGCAGGAGCAGGATCAGGG + Intergenic
1123450910 15:20358328-20358350 GAGGGGACAGAGCTGGAGCCAGG - Intergenic
1123485828 15:20737520-20737542 CAGGGGATGAGGCAGGAGCATGG + Intergenic
1123498053 15:20850180-20850202 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123531386 15:21149458-21149480 CAAGGGCAAGGGCAGGGGCAGGG + Intergenic
1123534697 15:21174054-21174076 CAGGGGCCAGAGCAGCAGCGAGG - Intergenic
1123555284 15:21423808-21423830 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123591529 15:21861139-21861161 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1123711185 15:22988960-22988982 CAAGGGAAGGAGCAGGATCCGGG - Intronic
1123736377 15:23188189-23188211 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1123802397 15:23834831-23834853 CAGGCAAAAGAGCATGTGCAGGG + Intergenic
1123988387 15:25665198-25665220 CAGGGCAAAGACAAGGACCAAGG + Intergenic
1124121640 15:26893682-26893704 CAGGGGAAACAGGAGGATCTGGG + Intronic
1124190147 15:27567647-27567669 CCGGGGAAAGGGCGGGAGGAGGG - Intergenic
1124287083 15:28411166-28411188 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124295618 15:28500463-28500485 AAGGGGAAAGCGAAGGAGAAAGG + Intergenic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125158247 15:36614216-36614238 CAGAGGGAGGAGCAGCAGCAGGG - Intronic
1125228478 15:37424544-37424566 CAGGGGAAAGGGCAGGAGAGGGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125514339 15:40309355-40309377 CGGGGGATGGAGCCGGAGCAGGG + Intergenic
1126408745 15:48350004-48350026 CGGGGGGAAGAGTGGGAGCAGGG + Intergenic
1126694027 15:51310813-51310835 CAGAGGAAAGAGGGGGAGAAAGG + Intronic
1126872997 15:53009764-53009786 TAGGGGAAAGAGCAGAAACATGG + Intergenic
1127278922 15:57472230-57472252 CAGAGGAAATAGCATGTGCAAGG + Intronic
1127315499 15:57790678-57790700 CAGGGTCAAGAGCAGGGGAATGG - Intergenic
1127650957 15:61006600-61006622 CAGAGGAAGGAGCAACAGCATGG - Intronic
1127699128 15:61479990-61480012 CAGAGGAAATAGCAAGTGCAAGG + Intergenic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1127918723 15:63476521-63476543 CAGCTGGAAGACCAGGAGCAGGG + Intergenic
1128313369 15:66645305-66645327 CAGGGGATAGAGCACAAGCACGG + Intronic
1128358344 15:66943685-66943707 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1128737462 15:70061304-70061326 CAGGGAAAGGAGCAAGGGCAGGG + Intronic
1128779730 15:70351494-70351516 CAGTGGCAAGAGGAGAAGCAGGG - Intergenic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1128982775 15:72198775-72198797 GATGGGAAAGAGCAGGGACAAGG - Intergenic
1129388404 15:75208208-75208230 CAGGGGATGGAGCTGGAGCAGGG - Exonic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1130137938 15:81197288-81197310 CAGGGGCAGGAGCAGAAGCCAGG + Intronic
1130220215 15:82013068-82013090 CTGGGGAAAGAAGAGGAGCCAGG - Intergenic
1130271687 15:82454170-82454192 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130305230 15:82709061-82709083 CAGGGGCAATGCCAGGAGCAGGG + Intronic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130464035 15:84181557-84181579 CAATGGAAAGAGCAGGAGAAGGG + Intronic
1130474836 15:84255487-84255509 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130482252 15:84369543-84369565 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130488649 15:84413276-84413298 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130500232 15:84491984-84492006 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130507787 15:84562463-84562485 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130586331 15:85186189-85186211 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130681593 15:86001647-86001669 AAAGGGAAAGAGAAAGAGCAGGG - Intergenic
1131112988 15:89776895-89776917 CAGGGGCAAGGGCAGGGGCAGGG + Exonic
1131112993 15:89776907-89776929 CAGGGGCAGGGGCAGGGGCAAGG + Exonic
1131112998 15:89776919-89776941 CAGGGGCAAGGGCAGGGGCAAGG + Exonic
1131113002 15:89776931-89776953 CAGGGGCAAGGACAGGGGCAAGG + Exonic
1131113006 15:89776943-89776965 CAGGGGCAAGGACAGGGGCAAGG + Exonic
1131117863 15:89805578-89805600 CGGGGGTGGGAGCAGGAGCAGGG - Intronic
1131296482 15:91153808-91153830 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1131352973 15:91718355-91718377 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1131463974 15:92639758-92639780 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131569206 15:93516599-93516621 CAGCGGGGACAGCAGGAGCAGGG - Intergenic
1131947077 15:97635278-97635300 CAGGGGAAAGAGCATCTGAAAGG - Intergenic
1132428119 15:101737776-101737798 CAATGGAAAGAGCAGGAGAAGGG - Intronic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1202963630 15_KI270727v1_random:151017-151039 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132550831 16:553245-553267 CAGGGGCAGGAGCAGGAGTGGGG - Intronic
1132607923 16:801182-801204 CAGGGGATCGGGCTGGAGCAGGG - Intergenic
1132989868 16:2787065-2787087 GAGGGGAGTGAGGAGGAGCAGGG - Intronic
1133107314 16:3520892-3520914 AGGGAGAAAGAGCAGAAGCATGG - Intronic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1134219644 16:12343715-12343737 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1134244900 16:12532748-12532770 CTGGGGACAGGGCAGGAGCCTGG + Intronic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135420769 16:22304255-22304277 CAGTGGGAAGGGCAGGGGCAAGG + Intronic
1135784051 16:25332068-25332090 CAGGCAAAAGAGCTTGAGCAGGG - Intergenic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136618722 16:31413824-31413846 CTGGAGAATGAGCAGGAGCCAGG - Intronic
1136722421 16:32336758-32336780 AAGGGGAAAGGGCAAGGGCAAGG + Intergenic
1136729340 16:32393556-32393578 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
1136840735 16:33542730-33542752 AAGGGGAAAGGGCAAGGGCAAGG + Intergenic
1136862681 16:33712757-33712779 CAAGGGCAAGGGCAGAAGCAGGG - Intergenic
1136896979 16:34001356-34001378 CAAGGGCAAGGGCAGGGGCAGGG + Intergenic
1137273814 16:46920251-46920273 AAGGGGAAAGAGCAGGAGTTTGG + Intronic
1137399651 16:48142958-48142980 CAGGGAGTAGAGCAGGAGCATGG + Intronic
1137697937 16:50474874-50474896 CAGGCAAAAGAGCATGTGCAGGG - Intergenic
1137769509 16:51004705-51004727 CTGGGGACAGTCCAGGAGCAGGG - Intergenic
1137871043 16:51950613-51950635 GAGGGAAAAGAGCATGAGAAGGG + Intergenic
1138096876 16:54218789-54218811 CTGGGGAAATAGCAGGGGCCAGG + Intergenic
1138199987 16:55081517-55081539 CAGGAGCAAGAGCAAGAGAAAGG + Intergenic
1138299262 16:55912612-55912634 GAGGAGGAAGAGAAGGAGCAGGG + Intronic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138332472 16:56226134-56226156 GAGGGGCAAGAGAGGGAGCAGGG + Intronic
1138429768 16:56961250-56961272 CGGGGGAAAGGGGCGGAGCAGGG - Intergenic
1138446931 16:57070440-57070462 CAGGGGACAGAGCAGGAGAGGGG + Intronic
1138552394 16:57754814-57754836 GGGGGGATGGAGCAGGAGCATGG - Intronic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1139490982 16:67285901-67285923 CAGAGGAAAGAGCAAGTACAAGG + Intronic
1139910075 16:70392231-70392253 CAAGGGAAAGGGAAGGAACATGG + Intronic
1140775838 16:78248275-78248297 CAGGAGCAAGAGAGGGAGCAAGG + Intronic
1141244868 16:82296487-82296509 CAGGGGAAAGTGTGGGAGGAGGG - Intergenic
1142031704 16:87841709-87841731 CCGGGGCAGGGGCAGGAGCAGGG + Intronic
1202997056 16_KI270728v1_random:123965-123987 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1203004010 16_KI270728v1_random:181006-181028 AAGGGGAAAGGGCAAGGGCAAGG - Intergenic
1203023743 16_KI270728v1_random:436307-436329 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1203076051 16_KI270728v1_random:1122274-1122296 CAAGGGCAAGGGCAGGGGCAGGG - Intergenic
1203124157 16_KI270728v1_random:1560899-1560921 CAAGGGCAAGGGCAGAAGCAGGG - Intergenic
1203135618 16_KI270728v1_random:1717413-1717435 AAGGGGAAAGGGCAAGGGCAAGG - Intergenic
1203150900 16_KI270728v1_random:1843027-1843049 AAGGGGAAAGGGCAAGGGCAAGG + Intergenic
1142582046 17:949013-949035 CAGGGGGGAGAGGAGGAGCCCGG - Intronic
1142599055 17:1044180-1044202 CAGGGGCAAGAGCCGGTGGAGGG + Intronic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142676972 17:1519686-1519708 CAAAGGGAAGAGGAGGAGCAGGG + Exonic
1142759460 17:2034614-2034636 GAGGGGAGAGAGGGGGAGCAGGG - Intronic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1143222830 17:5276795-5276817 TAGGGGAAGGACCAGAAGCAAGG - Intergenic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143444353 17:6998640-6998662 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1143624620 17:8102630-8102652 GAGGGGGAAGAACAGGACCAAGG - Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144874796 17:18391836-18391858 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1145062891 17:19743695-19743717 CAGGGGAGAGAGCCGGTGAAGGG + Intronic
1145157429 17:20552585-20552607 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145799841 17:27675932-27675954 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145858306 17:28183984-28184006 CAGGGGACAGAGCAGGTAAATGG - Intronic
1146159363 17:30551666-30551688 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1146329063 17:31912458-31912480 CAGGGCAAAGTGCAGGAAAAAGG + Intergenic
1146407781 17:32554187-32554209 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1146407784 17:32554193-32554215 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146786242 17:35724460-35724482 CAGGGGAAAGGAAAGGAGTAAGG - Intronic
1146845216 17:36178148-36178170 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146873432 17:36389991-36390013 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146880791 17:36441079-36441101 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1146890855 17:36505668-36505690 GAGGGGAAAGAGGAGGAGATTGG - Intronic
1147065958 17:37922882-37922904 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1147219330 17:38919334-38919356 CAGGGGCAACAACAGGAGAATGG + Exonic
1147538138 17:41334188-41334210 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1147566517 17:41539540-41539562 CAGAAGAAAGGGCTGGAGCATGG + Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147818613 17:43228442-43228464 CAGCAGAAAGAACAGGTGCATGG - Intergenic
1147831896 17:43303144-43303166 CAGCAGAAAGAACAGGTGCATGG - Intergenic
1147847002 17:43411582-43411604 AAGGAGAAAGAGCAAGAGAAGGG - Intergenic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148367507 17:47067429-47067451 CAGGGGCTTGGGCAGGAGCAAGG - Intergenic
1148431164 17:47644891-47644913 AAGGGGAAAGAGCAGATGCAGGG - Intergenic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148617973 17:49014351-49014373 CAGGGGAAAGCGCAGCAGAGCGG - Intronic
1148664017 17:49361672-49361694 GGGGCGAAAGAGCAGGAGCGGGG + Intronic
1148733601 17:49852057-49852079 CAGGAGATAAAGCAGGGGCAGGG + Intergenic
1149190625 17:54057201-54057223 TAGGGCACAGAGCAAGAGCACGG + Intergenic
1149502693 17:57166505-57166527 CTGGGGAAAGAGGAGGAGTGGGG + Intergenic
1149546289 17:57506214-57506236 AAAGAGAAAGAGCCGGAGCAGGG - Intronic
1149848355 17:60020638-60020660 CAGGGGGCAGAAGAGGAGCATGG + Intergenic
1149861814 17:60125886-60125908 CAGGGGGCAGAAGAGGAGCATGG - Intergenic
1150086702 17:62277205-62277227 CAGGGGGCAGAAGAGGAGCATGG + Intronic
1150272107 17:63873305-63873327 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150275655 17:63896201-63896223 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150277787 17:63910890-63910912 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150832093 17:68531967-68531989 CCTGGGAAAGGGCAGGAGAAGGG - Exonic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151757588 17:76083471-76083493 GTGGGGAAAAAGCAGGAGCCAGG + Exonic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152008498 17:77696852-77696874 GAGGGGAAGGAGGAGGAGAAGGG - Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152103453 17:78315842-78315864 CAGGAGGAGGAGGAGGAGCAGGG - Intergenic
1152211593 17:79005326-79005348 CCTGGGAAAGGGCAGCAGCAGGG - Intronic
1152283995 17:79402025-79402047 CCTGAGAAAGAGCAGAAGCAGGG + Intronic
1152344282 17:79742022-79742044 GAAGGGGAGGAGCAGGAGCAGGG - Exonic
1152429513 17:80240400-80240422 TAGGGGAAGGCACAGGAGCATGG - Intronic
1152521136 17:80857728-80857750 CAAGGGAACGGGCAGCAGCAGGG - Intronic
1152572002 17:81125022-81125044 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1152854827 17:82658722-82658744 CAGGAGAAAGGCGAGGAGCATGG + Intronic
1152881922 17:82822504-82822526 CAGCGGAAAGAGCAGAAGAGTGG + Intronic
1152942063 17:83178009-83178031 TAGTGGAATGAGCAGGAGCCGGG - Intergenic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1154051732 18:10966766-10966788 CGGGGGAAAGGGCAGGAGGTGGG - Intronic
1154299512 18:13180925-13180947 GAGGGGAAAGAGGAGGGGTATGG - Intergenic
1154412881 18:14150816-14150838 CAGGGGCCAGAGCAGGTGCCTGG + Intergenic
1154456054 18:14526609-14526631 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1155297921 18:24402240-24402262 CAGCTGAAGGAGCAAGAGCAGGG + Intergenic
1155527893 18:26735833-26735855 CAGGCAAGAGAGTAGGAGCAGGG - Intergenic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155753170 18:29454940-29454962 CAGGTGAGAGAGCATGTGCAGGG + Intergenic
1156406048 18:36783615-36783637 CAGGGGGAAGAACAGGGGCCAGG + Intronic
1156469234 18:37367152-37367174 CAGGAGGAAGAGGAGGAGCTAGG + Intronic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157027458 18:43862775-43862797 CAGGGGATAGCCCAGGAGCCAGG + Intergenic
1157326657 18:46674006-46674028 GAAGGGGAAGACCAGGAGCATGG - Intronic
1157400393 18:47382280-47382302 CCGGGGTAGGAGCAGGGGCAAGG - Intergenic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1157773969 18:50375576-50375598 CAGGGGAAAGAGGATAAGCCTGG - Intronic
1157886168 18:51369050-51369072 GAGGGGACAGAGGATGAGCAGGG - Intergenic
1158173222 18:54622618-54622640 CAGGCAAGAGAGCAGGTGCAGGG + Intergenic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1159937854 18:74382872-74382894 GTGGGGAAAGAGGAGCAGCAAGG - Intergenic
1160312050 18:77803243-77803265 CAGGGGAAAGATGAGGAACGTGG - Intergenic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1161058310 19:2201413-2201435 CAGGGAAGACAGCAGGAGCGAGG - Intronic
1161170156 19:2808462-2808484 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1161170159 19:2808468-2808490 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1161404052 19:4081965-4081987 AAGAGGAGAGAGGAGGAGCAGGG - Intergenic
1162180891 19:8867927-8867949 CAGGTGAATGGGCAGGAGGATGG + Intronic
1162552270 19:11364464-11364486 CAGGGGTAGGGGCAGGGGCAAGG - Exonic
1162846637 19:13397817-13397839 AAGGGAAAAGAGCATGAGAAGGG - Intronic
1163018722 19:14471792-14471814 CAGGGGCAGGGGCAGGGGCAGGG - Exonic
1163440871 19:17322052-17322074 CAGGGGCCAGAGTGGGAGCAGGG + Exonic
1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG + Intronic
1164011847 19:21210507-21210529 CAGGGGAATGAGGAGCAGCTGGG - Intergenic
1164145955 19:22512715-22512737 CAGGGGAAAGCAGAGAAGCAGGG + Intronic
1164169189 19:22709366-22709388 CAGGGGAATGAGGAGGGGCTGGG + Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164712559 19:30367880-30367902 CATGGGAAGGTGCAGGAGGAAGG - Intronic
1164796802 19:31040131-31040153 CAGGGGAAAAGCCAGGATCAAGG + Intergenic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165145371 19:33726936-33726958 GAGGGGAAGGTGCAGGAGCTGGG - Intronic
1165364675 19:35358199-35358221 CAGGGGAGAAAGCAGAAACATGG + Intergenic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165723395 19:38095634-38095656 CTGGGGACAGGGCAGGGGCAGGG + Intronic
1165763683 19:38336946-38336968 CAGGGCCAGGAGCAAGAGCAGGG + Intronic
1165763707 19:38337042-38337064 CAGGGCCAGGAGCAAGAGCAGGG + Intronic
1165783960 19:38450149-38450171 CAGGGGACAGAGCCAGAGCAGGG + Intronic
1165792910 19:38502756-38502778 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792913 19:38502762-38502784 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792916 19:38502768-38502790 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792919 19:38502774-38502796 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792922 19:38502780-38502802 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792925 19:38502786-38502808 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792930 19:38502798-38502820 CAGGGGCAGGGGGAGGAGCAGGG + Intronic
1165792933 19:38502804-38502826 CAGGGGGAGGAGCAGGGGCAGGG + Intronic
1166243023 19:41506913-41506935 CAGAGGGAGGAGCAGCAGCAGGG - Intergenic
1166516889 19:43453905-43453927 CACGAGCTAGAGCAGGAGCAGGG + Intergenic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1166979408 19:46623887-46623909 CATGGCAAAGAGGATGAGCATGG + Exonic
1167019354 19:46861992-46862014 CAGGGGAATGAGCTGGGGCACGG - Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167199252 19:48052833-48052855 CAGGGGACAGACCATGAACAGGG - Intronic
1167259880 19:48452433-48452455 CAGAGGGAAGAGCAGGGGCGGGG + Intronic
1167713249 19:51125092-51125114 GAGGGGTAGGAGAAGGAGCAGGG - Exonic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1167978746 19:53254914-53254936 AAGGGGCAAGGGCAGGGGCAGGG + Intergenic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168028061 19:53658019-53658041 CAGGGGAAAGGGCTGGAGCCAGG - Intergenic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168578632 19:57534969-57534991 GAGGTGAACTAGCAGGAGCATGG + Intronic
1168651879 19:58097258-58097280 GAGAGGAAGGAGCAAGAGCAGGG + Intronic
1168686729 19:58353411-58353433 CAAGAGAAAGACCACGAGCATGG + Exonic
1168703004 19:58452637-58452659 CAGGGGAAAGATCAAGAGTCTGG + Intronic
1168705495 19:58468155-58468177 CAGGGGAAAGATCAAGAGTCTGG + Intronic
924959103 2:17867-17889 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
924988165 2:289036-289058 CAGGGGGAAGAGGAGGAGACGGG - Intergenic
925069519 2:955955-955977 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
925069542 2:956033-956055 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
925069548 2:956045-956067 CAGGGGTAGGGGCAGGGGCAGGG - Intronic
925069638 2:956268-956290 CAGGGGGAGGTGCAGGGGCAGGG - Intronic
925246075 2:2384311-2384333 CAGGGAAAGGAGCATCAGCAGGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925753607 2:7111489-7111511 CAAGGGAGAGAGCATGTGCAGGG - Intergenic
925797912 2:7566802-7566824 CAGAGGGAAGAGCATGTGCAAGG - Intergenic
925812336 2:7712732-7712754 TAGGGGAAAGAGCAGGACACAGG + Intergenic
926305785 2:11636717-11636739 CAGGGGCAAGGGCAGGGGTAAGG + Intronic
926305789 2:11636729-11636751 CAGGGGTAAGGGCATGGGCATGG + Intronic
926305800 2:11636753-11636775 CAGGGGCAAGGGCAGGGGCAGGG + Intronic
926305805 2:11636765-11636787 CAGGGGCAGGGGCAGGGGCACGG + Intronic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926700468 2:15800044-15800066 CAGGGGAGAGGGCAGGTGCCTGG + Intergenic
926716787 2:15930798-15930820 GAGGGAAAAGACCAAGAGCATGG - Intergenic
927001736 2:18802594-18802616 CAGGGGAAAGAAAAGGATAATGG + Intergenic
927215464 2:20666074-20666096 CAGGGGAACGCGCAGGAGAGGGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927586845 2:24315762-24315784 CAGGAGAGAGAGAAGCAGCAAGG - Intronic
927701914 2:25274501-25274523 CAGAGGAAACAGCACCAGCAAGG - Intronic
927766116 2:25809887-25809909 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
928217584 2:29375124-29375146 CATGAGAAACAGCAGCAGCAAGG + Intronic
928320971 2:30282554-30282576 CAGGTGACAGAGATGGAGCAAGG + Intronic
929332672 2:40702604-40702626 CAGGGGAAAGGACGGAAGCAGGG + Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929533586 2:42767157-42767179 CAGAGGAATGGGCAGGAGCGGGG + Exonic
929620217 2:43347126-43347148 CATGGGAAAGTGGAAGAGCATGG + Intronic
929783973 2:44975949-44975971 CAGGAGAAAGAGCAGAAGCCGGG + Intergenic
930021517 2:47004659-47004681 GAGGGGAATGAGCAGGAGAAGGG + Intronic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930260577 2:49141432-49141454 CACGTGGCAGAGCAGGAGCAAGG + Intronic
931201000 2:60097262-60097284 AAGGGGCAAGATCTGGAGCAGGG - Intergenic
931565636 2:63613320-63613342 AAGGAAGAAGAGCAGGAGCAGGG + Intronic
931812008 2:65863251-65863273 CATGGGACAGAGCAGGAAAACGG - Intergenic
932057476 2:68461224-68461246 CAGGGGAAAGAACAATTGCAGGG - Exonic
932406159 2:71513653-71513675 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
932406395 2:71515588-71515610 AGGAGGAAAGAGCAGGAGGAAGG - Intronic
932544067 2:72688534-72688556 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
934185639 2:89671467-89671489 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
934316804 2:91929113-91929135 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
934461115 2:94214142-94214164 CAAGGGCAAGGGCAGGGGCAGGG - Intergenic
934523242 2:95032985-95033007 CAGCGGGAAGAGAAGGTGCAGGG + Intronic
934772405 2:96915479-96915501 TGGGGGTAAGAGCAGGAGCTTGG + Intronic
934774412 2:96928000-96928022 GAGGGAAAGGGGCAGGAGCACGG + Intronic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935091803 2:99901739-99901761 CTGGAGAAAGAGCAGATGCAGGG - Intronic
936082804 2:109446490-109446512 CTGGAGCTAGAGCAGGAGCAGGG + Intronic
936248489 2:110848974-110848996 CATGGGAAATAGCAAAAGCAAGG - Intronic
936568520 2:113597617-113597639 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
936684202 2:114808751-114808773 GAGAGGAAAGAGCAGGTACAAGG - Intronic
937013200 2:118580343-118580365 GAAGAGAGAGAGCAGGAGCAAGG - Intergenic
937241296 2:120464252-120464274 AAAGGGAAAGAGCAGGAAAAGGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937506614 2:122544583-122544605 CAGTGGAAAAAACATGAGCAAGG - Intergenic
937995230 2:127689508-127689530 GAAGGAAAAGAGAAGGAGCAGGG + Intergenic
938129974 2:128706886-128706908 CAGAGGTAAGAGAATGAGCAGGG + Intergenic
938286242 2:130120167-130120189 CAGGGGGAGCAGCAAGAGCAAGG - Exonic
938475534 2:131608234-131608256 CAGCAGCAAGAGCAGGAGCAAGG - Intergenic
938700122 2:133869945-133869967 CAAGGGAAAGGGTGGGAGCAGGG + Intergenic
938711930 2:133982434-133982456 CCAGGGAGAGAGCAGGTGCAGGG - Intergenic
938984648 2:136562502-136562524 TGGGGGCAAGATCAGGAGCAAGG - Intergenic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939320399 2:140612871-140612893 CGGAGGAAGGAGCAGAAGCATGG + Intronic
939849275 2:147284549-147284571 CAGGTGGCAGAGCAGGAGAATGG - Intergenic
939854851 2:147345867-147345889 CAAGGGAAAGAACAAGTGCAGGG - Intergenic
939994737 2:148909295-148909317 CAGCGGGAAGAGCAGCGGCAGGG - Intronic
940617434 2:156067123-156067145 CAGGGGAGAGGAAAGGAGCAGGG + Intergenic
940775015 2:157876091-157876113 CGGGGGAAAGAGCCGGGGGAGGG + Intergenic
940971510 2:159901607-159901629 CAGTGGAAAAAGCAGGAGTTAGG + Intronic
941071206 2:160956495-160956517 CAGGGGGTGGAGCAGGGGCAGGG - Intergenic
941105819 2:161351585-161351607 CAGGGGAAAGAGGAGGGTAAGGG - Intronic
941394791 2:164961210-164961232 CAGGAGGCAAAGCAGGAGCAAGG + Intergenic
941422555 2:165300894-165300916 AAGGGGAAAGAGTGGAAGCAAGG + Intronic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
942132270 2:172892108-172892130 AAGGGGAGAGGGTAGGAGCAGGG + Intronic
942253694 2:174070480-174070502 CAGGGGACAGTGGAGCAGCATGG - Intergenic
942489412 2:176474765-176474787 GAGGGGCAAGAGTAGAAGCAGGG + Intergenic
943051266 2:182916074-182916096 GAGAGGGAGGAGCAGGAGCAGGG - Intronic
943257839 2:185618951-185618973 CATGGGCCAGTGCAGGAGCATGG - Intergenic
944128156 2:196317579-196317601 CAGGGGAAGCTGCAGGAGCGGGG - Intronic
945134570 2:206613535-206613557 GATGGGGAAGAACAGGAGCATGG - Intronic
945264941 2:207881778-207881800 CACTGGAAAGAGTAGGAGAAAGG - Intronic
945646908 2:212507832-212507854 CAGTTGAAAAAGCAGCAGCAGGG + Intronic
946192533 2:218015166-218015188 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
946359107 2:219208365-219208387 AAGGGGAAAAAGGGGGAGCAGGG - Intronic
946371859 2:219285964-219285986 CTGGGGAGAGAGCAGGGGCGGGG - Exonic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946416866 2:219544117-219544139 AAGGGGAAGGCGCAGGAGCCGGG - Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946451118 2:219780309-219780331 CAGGGCAAATATCAGGAGAAAGG + Intergenic
946535608 2:220624736-220624758 AAGGTGAAAGATCAGAAGCAGGG + Intergenic
946737598 2:222770075-222770097 CAGGGAGAAGGGCTGGAGCAGGG - Intergenic
946806122 2:223472962-223472984 CAGGCAAAAGAGCATGCGCAGGG + Intergenic
947488398 2:230573127-230573149 CAGAGGGAGGAGCAGCAGCAGGG + Intergenic
947506405 2:230711578-230711600 CAGAGGGAATAGCAGGACCAAGG - Intergenic
947854369 2:233313234-233313256 CAGGTGAAAGTGCAGCAGAAGGG + Intronic
948170199 2:235895313-235895335 CTGGGGCAAGAGCAGGGGCACGG - Intronic
948220959 2:236269525-236269547 CTGGGCACAGAGCAGGAGCCAGG - Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948636384 2:239340469-239340491 CATGGGACAGAGGAGGACCATGG + Intronic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
948859698 2:240746841-240746863 CAGGCGAAGGAGCAGGCGAAGGG + Intronic
949008748 2:241666768-241666790 CAGGGGAATGAGAAGTACCAGGG - Exonic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1168821654 20:777418-777440 CTGGGGAAAGAAGAGGAGCCTGG - Intergenic
1168976482 20:1969803-1969825 CAGAGAGAAGAGCAAGAGCAAGG - Intergenic
1169074119 20:2751028-2751050 AAGGGGAAGGAGGAGGAGAAGGG + Intronic
1169457354 20:5763602-5763624 TAGGGGAAAGAGGAAGAGTATGG - Intronic
1169735486 20:8833294-8833316 CAGGCAAAAGAGCATGTGCAGGG + Intronic
1169933537 20:10858692-10858714 CAGTGGAAACTGCAAGAGCAGGG + Intergenic
1169961976 20:11170512-11170534 CGGGGGAAAGAAAATGAGCAAGG - Intergenic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170192456 20:13657781-13657803 CAGTAGCTAGAGCAGGAGCAAGG + Intergenic
1170264031 20:14444992-14445014 GAGGGGCAAGAGTAGAAGCAAGG - Intronic
1170356318 20:15495939-15495961 AAGAGGAAAGAGCATGAGCAAGG + Intronic
1170532683 20:17310074-17310096 CAGGAGCAAGAGAAAGAGCAAGG + Intronic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1171074672 20:22110545-22110567 CAGGGGAAAGAGCAGGCAAGGGG - Intergenic
1171079530 20:22164551-22164573 AAGGGGAAAGAGCAAAAGAAAGG + Intergenic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171151431 20:22829501-22829523 GAGGGGAGAGAGCGGGAGGAGGG - Intergenic
1171225690 20:23440293-23440315 CAGGGCAATCAGCAGCAGCAGGG - Exonic
1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG + Intergenic
1171243252 20:23588043-23588065 CAGGGTCAAGAGAAGGACCAAGG - Intergenic
1171249115 20:23635373-23635395 CATGTGAAAGAGCAGGAGGCAGG + Intronic
1171250652 20:23643895-23643917 AAGATGAAAGAGGAGGAGCAGGG - Intergenic
1171796647 20:29571803-29571825 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1172171255 20:32934735-32934757 CAGGCAAGAGAGCATGAGCAGGG - Intronic
1172379434 20:34475697-34475719 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1172379437 20:34475703-34475725 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1172623838 20:36336332-36336354 CAGAGGAAACAGCAAGCGCAAGG - Intronic
1172739946 20:37158451-37158473 GCAGGGAAAGAGCAGGATCAAGG - Intronic
1172893842 20:38285683-38285705 CAGGAGGAAGAGAAAGAGCAGGG - Intronic
1173269644 20:41521028-41521050 TAGGGGAGAGAACAGTAGCAGGG + Intronic
1173282893 20:41645149-41645171 CAGGCAAAAGAGCACGTGCAGGG - Intergenic
1173438358 20:43053343-43053365 GAGGGGAAAGCCCAGGGGCAAGG - Intronic
1173636927 20:44567734-44567756 CAGGATTAAGAACAGGAGCAGGG + Intronic
1173649288 20:44652673-44652695 CAGGTGAAAGGGAAGGAGCCGGG + Intergenic
1173896475 20:46554874-46554896 CAGGGCAGGGAGGAGGAGCATGG - Intergenic
1174048079 20:47747993-47748015 CAGGGACAAGAGCGGAAGCAGGG - Intronic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1174173621 20:48631821-48631843 GAGGGGTGAGAGCAGGAGCCAGG - Intronic
1174183031 20:48686942-48686964 CCTGGGAAGGAGCAGGAGCCCGG - Intronic
1174216519 20:48920743-48920765 GAGGGGAAAGAGTAGGAGAAAGG - Intergenic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1175051655 20:56161135-56161157 CAGAGGAAAGAGCAAGTGCAAGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175466010 20:59191703-59191725 CAGGGGCGAGAGCAGGTGCCAGG + Exonic
1175482828 20:59323479-59323501 CTGGGGACATAGCAGGAACAAGG + Intronic
1175531014 20:59674364-59674386 AAGGGGAAGGAACAGGAGAAGGG - Intronic
1175531033 20:59674430-59674452 AAGGGGAAGGAACAGGAGAAGGG - Intronic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175730048 20:61348257-61348279 CAGGCAAAAGAGCATGTGCAGGG + Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175819547 20:61901228-61901250 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1175819550 20:61901234-61901256 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1175851564 20:62096808-62096830 CGGGGGAAAGAGGAGGGGCCAGG + Intergenic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176086243 20:63296839-63296861 CGGGGGGAAGAGCAGGGGCTGGG - Intronic
1176195781 20:63835899-63835921 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195795 20:63835937-63835959 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195809 20:63835975-63835997 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195823 20:63836013-63836035 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195847 20:63836078-63836100 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195863 20:63836122-63836144 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1176195876 20:63836160-63836182 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195890 20:63836198-63836220 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195932 20:63836312-63836334 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1176195950 20:63836362-63836384 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195982 20:63836453-63836475 CAGGGGAGCGGGCAGGGGCAGGG + Intergenic
1176246737 20:64101018-64101040 AGGGGAAATGAGCAGGAGCAGGG - Intergenic
1176261189 20:64181622-64181644 CAGCGGTTAGAGCAGGAACAAGG - Intronic
1176379198 21:6103361-6103383 CAGGGGCAGGGGCAGCAGCAGGG + Intergenic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379215 21:6103403-6103425 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1176379218 21:6103415-6103437 CAGGGGCAGGGGCAGCAGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176592231 21:8657164-8657186 CAAGGGCAAGGGCAGGGGCAGGG - Intergenic
1176818108 21:13626731-13626753 CAGCAGCAAGAGCAGGAGCGAGG - Intronic
1176860128 21:14007438-14007460 CAGGGGCCAGAGCAGGTGCCTGG - Intergenic
1177262515 21:18749290-18749312 AATGGGAAAGAGCAGCAGGAAGG + Intergenic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178909113 21:36660011-36660033 CAGGGGAGTGAGCTGGTGCATGG - Intergenic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744255 21:43434822-43434844 CAGGGGCAGGGGCAGCAGCAGGG - Intergenic
1179744258 21:43434834-43434856 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744275 21:43434876-43434898 CAGGGGCAGGGGCAGCAGCAGGG - Intergenic
1179896054 21:44364361-44364383 CTGGGGCAAGAGCAGGAGGCTGG + Intronic
1180002552 21:45001936-45001958 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1180042332 21:45287199-45287221 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1180099144 21:45576236-45576258 CAGGGGAATGAGCTGGGCCAGGG - Intergenic
1180118287 21:45726277-45726299 CATGGGGGAGAGCAGGGGCAAGG + Intronic
1180228906 21:46414596-46414618 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180228924 21:46414665-46414687 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180275082 22:10634293-10634315 CAAGGGCAAGGGCAGGGGCAGGG - Intergenic
1180543135 22:16471460-16471482 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1180883867 22:19225781-19225803 CACGGGAAAAAGTAGGAGCAAGG + Intronic
1180938290 22:19640292-19640314 CAGGGGCAAGGGGAGGAGAATGG - Intergenic
1181014487 22:20061375-20061397 ATGGGGAAGGAGCTGGAGCATGG + Intronic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181355127 22:22292584-22292606 CAAGGGCAAGGGCAGGGGCAGGG + Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1182626182 22:31648221-31648243 CAGGGGACGCAGCAGGAACATGG + Intronic
1182692764 22:32175574-32175596 TAGGAGAAAGGGCAGGAGCCAGG - Intergenic
1182754559 22:32668376-32668398 GAGGGGAAAGAGAAGGGGAAAGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183018095 22:35006438-35006460 CAGGGCTAAAAGCAGGAGCCAGG + Intergenic
1183162343 22:36123338-36123360 GAGGGGAATGAGGAGGAGCCGGG + Intergenic
1183292729 22:37012610-37012632 TATGGGACAGGGCAGGAGCAGGG + Intronic
1183529834 22:38347392-38347414 CAGGGGCATGAGCAGGAGCCTGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183722089 22:39568567-39568589 GAGAGGGAAGAGCGGGAGCAGGG + Intergenic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184207506 22:43014681-43014703 GAGAGGGAAGTGCAGGAGCAGGG - Intronic
1184333471 22:43840224-43840246 GAGGGGTAAGGCCAGGAGCAGGG + Intronic
1184413429 22:44338617-44338639 CAGTTGGGAGAGCAGGAGCAGGG - Intergenic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184478827 22:44735771-44735793 GAGGGGACAGAGCTGGGGCAAGG + Intronic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1185143543 22:49117170-49117192 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185143546 22:49117176-49117198 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185143549 22:49117182-49117204 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1185342756 22:50299076-50299098 CAGGGGCCAGAGGAGGTGCATGG + Intronic
949276859 3:2294107-2294129 AAGAGCAAAGAGCAGAAGCAAGG + Intronic
949323686 3:2840362-2840384 GAGGAGAAAGAGGAGGAGAAGGG - Intronic
949421824 3:3873832-3873854 TAGGGTCAAGGGCAGGAGCAAGG - Intronic
949494532 3:4619555-4619577 AAGGGGAAAGGGCAGGGGAAGGG - Intronic
949702589 3:6776301-6776323 CAGGGGGTAGAGGGGGAGCAGGG - Intronic
949973721 3:9434821-9434843 TAGGGGAATGAGCAGGGGGAAGG + Exonic
950005606 3:9689206-9689228 CAGTAGAGACAGCAGGAGCACGG - Intronic
950173124 3:10852944-10852966 GAGTGGAATGAGCAGGAGCTGGG + Intronic
950542207 3:13619382-13619404 CAGGGAAAAAAGCAGGGGAAGGG - Intronic
950863830 3:16173566-16173588 GGGGGCAAAAAGCAGGAGCAGGG - Intergenic
950905163 3:16531113-16531135 TGGGGGAAAGAGTAGGACCAGGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
951843954 3:27065396-27065418 CATGGGAAAGAGAAATAGCATGG - Intergenic
952295813 3:32061003-32061025 CGAGGGACAGAGCAGGAGCAGGG - Intronic
952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG + Intronic
953105114 3:39870101-39870123 CAAGGGCAAGGGCAGGGGCAGGG + Intronic
953470682 3:43163510-43163532 CAGGAAACAGTGCAGGAGCAGGG + Intergenic
953479157 3:43234528-43234550 CTGGGGAAAGAGGAGGAGTGAGG - Intergenic
954152028 3:48662563-48662585 GAGGAGAAGGAGCAGGAGTATGG + Exonic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955698380 3:61659043-61659065 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
955906695 3:63815017-63815039 CAGGGGCAAGAGAGAGAGCAGGG + Intergenic
956240845 3:67128470-67128492 CAGGGGAAAGGGTAGGAGAGGGG + Intergenic
956409016 3:68959517-68959539 CAGGGGGAAGGGCAGGAGGGGGG - Intergenic
956652082 3:71513500-71513522 GTGGGGTAAGAGAAGGAGCAGGG - Intronic
957137418 3:76307164-76307186 CTGAGGAAATAGCATGAGCATGG - Intronic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
957376767 3:79368684-79368706 GAGAGGAAGGAGCAGCAGCAGGG - Intronic
957382945 3:79457702-79457724 CAGGTGAAAGAGCATGTGCAGGG - Intronic
957387675 3:79518418-79518440 AAGGGGAAAGAAAAGAAGCACGG - Intronic
958736545 3:98016031-98016053 CAGGAGAGAGAGCATGTGCAGGG + Intronic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
959490722 3:106985309-106985331 CAGGAGGAAGACCAGGAGCTGGG - Intergenic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960236030 3:115283189-115283211 TAGTGGATAGAGCAGGAGAAGGG - Intergenic
960405786 3:117257755-117257777 AAGGGGGAAGAGGAGGAGAACGG + Intergenic
961002161 3:123381260-123381282 CAGGGGTCAGGGCAGGAGCTTGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961405173 3:126673181-126673203 TGGGGGCAAGACCAGGAGCAGGG - Intergenic
961454424 3:127017115-127017137 CAGGGGTAGGGGCAGGGGCAGGG - Intronic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
961738706 3:129018668-129018690 CAGGGGACTGGGCAGGGGCAGGG + Intronic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
963317111 3:143771710-143771732 GAGGGACAACAGCAGGAGCACGG - Intronic
963338126 3:144000927-144000949 CAGGGTGAGGAGCAGTAGCAAGG + Intronic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
963602192 3:147388350-147388372 GAGGGGAAAGAAAAGGAGAAAGG - Exonic
964342162 3:155719162-155719184 CAGGGGAAAGGGTAGAAGGAGGG - Intronic
964420407 3:156496415-156496437 CAGGCAAAAGAGCATGTGCAGGG - Intronic
964602989 3:158523769-158523791 GAGAGGAATGAGCAGGAGCATGG + Intronic
964816836 3:160726895-160726917 CAGAGGGAATAGCAGGTGCAAGG - Intergenic
965485448 3:169272931-169272953 TGCGGGAAAGAGCTGGAGCAAGG + Intronic
965689737 3:171342941-171342963 CAGGCAAGAGAGCAGGTGCAGGG - Intronic
966681581 3:182647030-182647052 TAGGGATAAGAGCAGAAGCAGGG - Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
966866573 3:184261622-184261644 CAGGGGAAAGAGGCGGGGCCGGG + Intronic
966925026 3:184639165-184639187 CAGTGGACAGAGGAGAAGCAGGG + Intronic
967010740 3:185431028-185431050 CAGGAGACAGAGAAGGGGCAAGG + Intronic
967178851 3:186885581-186885603 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
967178854 3:186885587-186885609 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
967390748 3:188951573-188951595 GAGGTGACTGAGCAGGAGCATGG + Intronic
967658624 3:192078304-192078326 CATGGGTGAGAGCAGGAGCTGGG - Intergenic
968085772 3:195873269-195873291 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968298640 3:197596522-197596544 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
968374587 4:28315-28337 CACAGGAAAGAGCAGGATCCTGG + Intergenic
968516638 4:1018309-1018331 CTAGGGAAGGAGGAGGAGCAGGG - Intronic
968665003 4:1816172-1816194 CAGGGACGAGAGCATGAGCAGGG + Intronic
968954340 4:3710611-3710633 CCCGGGACAGGGCAGGAGCAGGG - Intergenic
969067151 4:4495039-4495061 CAGAGGAAAGAGGTTGAGCATGG + Intronic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969198262 4:5580619-5580641 CAGAGGGAAGAGCAGGTCCAAGG - Intronic
969511369 4:7619929-7619951 CTGGGGACAGGGCAGGGGCAGGG - Intronic
969543279 4:7807423-7807445 CAGAGGAAACAGCTGTAGCACGG - Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969710645 4:8841072-8841094 CTGGGGAAAGGGCAGAGGCAAGG + Intergenic
969912942 4:10461754-10461776 CTTGGGACATAGCAGGAGCATGG + Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
970352401 4:15216040-15216062 CAGGAGCAAGAGAGGGAGCAGGG - Intergenic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
971115212 4:23638285-23638307 CAGGGGAAAGAGTGGGAGTAAGG - Intergenic
971133851 4:23844966-23844988 CAGGGAAAAGAGTAAGAGTAAGG + Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
971900580 4:32652902-32652924 TAGGGGGAAGAGTGGGAGCAGGG - Intergenic
972092244 4:35301659-35301681 CAGACAAAAGAGCAGCAGCAGGG - Intergenic
972127619 4:35789218-35789240 CAGGGGAGAGAGGAGGGGAAGGG + Intergenic
972170570 4:36340929-36340951 GAGAGGAAAGAGGAGAAGCAGGG + Intronic
972309536 4:37867140-37867162 CAGTGGAAAGATGGGGAGCAAGG - Intergenic
972578669 4:40375599-40375621 GAGGGGAAAGAGGATGAGTATGG - Intergenic
973343700 4:49031648-49031670 CAGGGGCAAGAGTGGGAGCCAGG + Intronic
973918689 4:55662724-55662746 CTGGGTGAAGAGCAGGACCAGGG - Intergenic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974651264 4:64756227-64756249 ATGTGGCAAGAGCAGGAGCAAGG - Intergenic
974847664 4:67370435-67370457 AAGGGGAGAGAGTAGAAGCAAGG - Intergenic
974886784 4:67828997-67829019 GAGAGGAATGAGCATGAGCATGG - Intronic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975280128 4:72552538-72552560 TAAGGGGAAGAGCAGAAGCAAGG - Intronic
975664036 4:76716304-76716326 GAGCAGAAAGAGCAGTAGCAGGG + Intronic
976114496 4:81712512-81712534 CAGAGGAAAGAGCAAGCTCAAGG + Intronic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
976842810 4:89451541-89451563 ATGGGGAAAGAGTAGGGGCAGGG + Intergenic
976916354 4:90379928-90379950 CAGGGGCAAGAGGAAGAGAAGGG + Intronic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977475327 4:97500076-97500098 GAGGGGCAAGAACAGAAGCAAGG + Intronic
977645385 4:99405894-99405916 CAGGGGAAAGGGTGGGAGAAGGG + Intergenic
977722350 4:100254396-100254418 AAAGGGAAGGAGCATGAGCAGGG + Intergenic
977789320 4:101079800-101079822 CAGGGAAAAGAAGAAGAGCAAGG - Intronic
977948643 4:102943738-102943760 TAGGGGGAAGAGTAGGAGGAGGG + Intronic
977980721 4:103318264-103318286 AAGGAGAAGGAGGAGGAGCAGGG - Intergenic
978083564 4:104622672-104622694 CAGGGAAAAGAGCCCGAGCATGG + Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
979125893 4:116970996-116971018 CAGGCAAAAGAGCATGTGCAGGG + Intergenic
979150275 4:117304485-117304507 CAGGTGAAAGAGAAGGTGAAAGG + Intergenic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
979700321 4:123659334-123659356 AAGGGGAAAGGTCAGGGGCATGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980774966 4:137425827-137425849 CAGGTGAAAGAACTGGAGAAGGG - Intergenic
981961269 4:150542183-150542205 CAGAGGATAGGGGAGGAGCAAGG - Intronic
981989881 4:150905363-150905385 AAAGAGAGAGAGCAGGAGCAGGG + Intronic
982243815 4:153328649-153328671 CTGGGGAAACAGCAGGATCCAGG + Exonic
982256652 4:153457703-153457725 AAGGGGCAAGAGTAGAAGCAAGG + Intergenic
982431357 4:155325271-155325293 CAGGGGAAAGTGCTTCAGCAAGG - Intergenic
982495944 4:156092204-156092226 CAGGCAAGAGAGCATGAGCAGGG + Intergenic
982578362 4:157146426-157146448 CTCGGGCAAGAGCAGAAGCAAGG + Intronic
983967580 4:173831819-173831841 CAGGTCACAGAGCAAGAGCAGGG + Intergenic
983968233 4:173840536-173840558 AGGGAGAAAGAGCAGAAGCAGGG + Intergenic
984383329 4:179023597-179023619 CAGGAGAAAGAGCAGAACAAAGG - Intergenic
984565435 4:181324481-181324503 CAGTGGAAATTGCAGGGGCAGGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
985329993 4:188821521-188821543 CAGAGGGAAGAGCAAGAGCACGG + Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985468496 5:20869-20891 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
985522906 5:387225-387247 CAGAGGAGAGAGCAGGAGACAGG - Intronic
985780694 5:1869393-1869415 CAGGGGCCTGGGCAGGAGCAGGG + Intergenic
985790856 5:1926297-1926319 CAGGGGAAGGGGCAGGCACAGGG - Intergenic
985790860 5:1926309-1926331 AAGGGGCAAGAGCAGGGGAAGGG - Intergenic
985790863 5:1926315-1926337 CAAGGGAAGGGGCAAGAGCAGGG - Intergenic
985790890 5:1926387-1926409 CAGGGGAAGGGGAAGGCGCAGGG - Intergenic
985790916 5:1926459-1926481 CAGGGGAAGGGGCAGGCGTAGGG - Intergenic
985790972 5:1926623-1926645 CAGGGGCAGGGGCAGGTGCAGGG - Intergenic
985842780 5:2321149-2321171 CAGGCAAAAGAGCATGTGCAGGG - Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986308856 5:6536334-6536356 CAGGGAAAACAGCAGGTCCAGGG - Intergenic
986367191 5:7044202-7044224 CAAGGGAAAGAGCAATTGCAGGG - Intergenic
986548186 5:8922900-8922922 CAAGAGCAAGAGCAAGAGCAAGG - Intergenic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987071739 5:14343411-14343433 CAGGGGTTAGAGATGGAGCAGGG - Intronic
987436442 5:17900287-17900309 CAGGGGAAAGAGTGGGAGTGGGG - Intergenic
987611984 5:20216868-20216890 AAGCAGAAAGAGCAAGAGCAAGG + Intronic
988099760 5:26660997-26661019 GAGGGAAGAGAGCAAGAGCAGGG + Intergenic
988496664 5:31751308-31751330 TGGGGGTTAGAGCAGGAGCAAGG + Intronic
988873539 5:35417977-35417999 CAGAGGGAAGAGGAGGAGAATGG - Intergenic
989020754 5:37004426-37004448 CAGGGGACAGAGCAAGACCCTGG - Intronic
989088771 5:37706538-37706560 CAGGCAAGAGAGCAGGTGCAGGG - Intronic
989098894 5:37806553-37806575 CAGGGGCAAAAGCAGAAGCATGG - Intergenic
989558804 5:42827746-42827768 CAGATGAAAGAGCACGTGCAAGG + Intronic
989645104 5:43622385-43622407 TATGGGAAAGGGCAGGAGAAAGG - Intronic
990005148 5:50937268-50937290 AAGGTGAGAGAGCAGGAGAAAGG + Intergenic
990742532 5:58926708-58926730 CAGGGGAAAGAGGAAGGGCAGGG + Intergenic
990756710 5:59079883-59079905 AAGGGGAATGGGCAGGGGCAGGG + Intronic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991917253 5:71617206-71617228 GAGGGGAAAGAGGACCAGCATGG - Intronic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG + Intergenic
992529306 5:77639419-77639441 CAAGCGGAAGAGCAGGAGCCGGG - Exonic
992881501 5:81114735-81114757 CAGAGGAAAGAACAAGTGCAAGG - Intronic
992912295 5:81407927-81407949 CAGGAGAATGAGCATTAGCAGGG + Intergenic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993176648 5:84494879-84494901 CAGGAGAGAGAGCAAGAGCAAGG + Intergenic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995482412 5:112606321-112606343 GAGGTGAAAAAGCAGGAACAAGG + Intergenic
995544081 5:113212868-113212890 CAGCTTAAAGAGCTGGAGCAAGG - Intronic
995862095 5:116651728-116651750 CAGGGAGAAGAGCAGGCGCTTGG - Intergenic
996678831 5:126208024-126208046 CAAGGGAAAGGGCAGGAGGCAGG + Intergenic
997456027 5:134018231-134018253 ATGTGGCAAGAGCAGGAGCAAGG + Intergenic
997496370 5:134330339-134330361 GAGAGGAATGAGCTGGAGCATGG + Intronic
997523546 5:134538426-134538448 CAGTGGAATGAGAAGCAGCAGGG + Intronic
997590669 5:135070224-135070246 CAGTCCAAAGACCAGGAGCAGGG - Intronic
997786110 5:136715500-136715522 GAGGGGAAGGGGCAGGAGCAGGG - Intergenic
997791830 5:136768976-136768998 CAAGGGACAGGGCAGGGGCAGGG + Intergenic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998514580 5:142741296-142741318 CAGAGGGAAAAGCAGCAGCATGG - Intergenic
998697230 5:144653834-144653856 CAGGCAAAAGAGCTGGTGCAGGG + Intergenic
998760731 5:145429138-145429160 CAGAGGTCAGAGCAGAAGCAAGG + Intergenic
999019220 5:148144635-148144657 AAAGGGGAAGAGAAGGAGCAGGG - Intergenic
999204463 5:149837973-149837995 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
999241748 5:150131937-150131959 GAGGGGAAGGAGCAGGGACATGG + Intronic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
999681004 5:154060016-154060038 CAGAGGAAAGAGCAATGGCAAGG + Intronic
1000151307 5:158503895-158503917 CAGGGGAGAGAGCTGGAGGTAGG + Intergenic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1000713994 5:164617595-164617617 CAGGAGAAATAGCAGGAAAAGGG + Intergenic
1000766798 5:165301634-165301656 CAGGCAAAAGAGCATGTGCAGGG - Intergenic
1001138611 5:169123980-169124002 GAGAGGAATGAGCAGGAGCATGG - Intronic
1001156688 5:169278607-169278629 CAGAGGAAGTAGCAGAAGCAGGG - Intronic
1001265254 5:170269408-170269430 CAGGGAAAAGGGTAGGAGCAAGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001468482 5:171990142-171990164 AAGGGGAAAGAGGAAGAGAAGGG + Intronic
1002000682 5:176194860-176194882 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1002000687 5:176194872-176194894 CAGGGGCAGGGGCAGGAGCGGGG + Intergenic
1002107269 5:176886260-176886282 GAGAGGTCAGAGCAGGAGCAGGG + Intronic
1002253655 5:177944115-177944137 CAGGGGCAGGGGCAGGAGCGGGG - Intergenic
1002811908 6:639261-639283 CAGTGGCAAGGGCAGGAGAAGGG - Intronic
1002960628 6:1911529-1911551 TAGGGGAAAGAACAGGCACAAGG - Intronic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003717282 6:8661477-8661499 CAGTGGAATGAGCAGGGTCAGGG + Intergenic
1004035465 6:11918882-11918904 CACTGGAATGATCAGGAGCAGGG + Intergenic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004721030 6:18267209-18267231 GAGGGGAAAGTGCAGGAGGTGGG + Intergenic
1004962762 6:20810241-20810263 CTGGGGCAAGAGAAGGGGCAAGG - Intronic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005615260 6:27566585-27566607 GAGGGACAAGAGCAGGAGCCTGG + Intergenic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005763267 6:28987029-28987051 CAGGAGAAAGAGCAGGGGGGCGG + Intergenic
1005792700 6:29322408-29322430 CAGGGGAAAGGGTGGGAGCAGGG - Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006021754 6:31121522-31121544 CAGGGGCCAGAGCAGGAGGGAGG - Intronic
1006334833 6:33415046-33415068 AAGGGGAAAGTGGAGGAGCTGGG + Exonic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1006846756 6:37067550-37067572 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1007077725 6:39078533-39078555 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1007077728 6:39078539-39078561 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007501701 6:42303440-42303462 CAGGGGAAAGATAGAGAGCAAGG + Intronic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1007864710 6:44955721-44955743 CAGGGGAAAGGGTAGGAGGGGGG + Intronic
1008035254 6:46738434-46738456 AAGGGGTAGGAGCAGGAGTAAGG + Intergenic
1008377780 6:50810769-50810791 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1008377783 6:50810775-50810797 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1008377786 6:50810781-50810803 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1008867294 6:56228104-56228126 CAGGAAACAGAGCAGGAACATGG + Intronic
1009769011 6:68121134-68121156 CAGGGAAGAGAGCATGTGCAGGG + Intergenic
1009825967 6:68866317-68866339 CAGGAGAAAGAAAGGGAGCAAGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010244534 6:73651053-73651075 CAGGGAAAAGAAAAGGAGCGGGG + Intronic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1010835959 6:80587532-80587554 CAGGCAAAAGAGCACGAGCAAGG - Intergenic
1011203194 6:84861011-84861033 CAGGGGAAAAAGCTGGGTCAAGG + Intergenic
1011216239 6:85008862-85008884 CAGGAGAAAGAGAGAGAGCATGG - Intergenic
1011398737 6:86937464-86937486 GAGGAGCAGGAGCAGGAGCATGG - Exonic
1011914609 6:92488216-92488238 CAGGGGATAGAGCATCAGCCAGG - Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012204631 6:96445304-96445326 TAGGGGAAAGGGTAGGAGGAAGG + Intergenic
1012258416 6:97060548-97060570 CCGGTGAAAGAGGAGGAGAATGG - Intronic
1012437918 6:99234776-99234798 CAGCTGAAGGAGCAGGAGAAGGG - Intergenic
1013204372 6:107933674-107933696 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1013204375 6:107933680-107933702 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1013460508 6:110370861-110370883 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1013799979 6:113931578-113931600 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014092763 6:117423155-117423177 TAGGGGAAAGAGTGGGAGCAGGG + Intronic
1014104835 6:117549883-117549905 CAGTGGAAAGAGAAAGAGCTTGG + Intronic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015199809 6:130566537-130566559 GAGGAGAAAGAGCAAGAGCAAGG + Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1016085036 6:139902951-139902973 CAGGAGAAAGAGTACAAGCAGGG - Intergenic
1016154269 6:140784175-140784197 CAGGGGGTGGAGAAGGAGCATGG + Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016531715 6:145065689-145065711 CAGGGAAAAGAGGAGGAGTTTGG + Intergenic
1016581242 6:145631062-145631084 CCAGGGTAAGAGCAGCAGCATGG - Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016877798 6:148881122-148881144 CAAGGTATAGAGCAGCAGCATGG + Intronic
1016920518 6:149288796-149288818 GAGGGGCAAGAGCAGAAGCAGGG - Intronic
1017073190 6:150594673-150594695 AAGGGGGAAGAGAAAGAGCAGGG + Intergenic
1018152623 6:160954607-160954629 GAAGGGAAAGAGGAGGAGAAGGG - Intergenic
1018276664 6:162139511-162139533 CAGGGTAAAGAGAATCAGCATGG + Intronic
1018554038 6:165032647-165032669 CTGGGGAAACATCAGGGGCAAGG - Intergenic
1018618457 6:165709160-165709182 GTGGGGAGAGTGCAGGAGCATGG - Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018792336 6:167158007-167158029 TTGGGGAAAGAGGATGAGCAGGG + Exonic
1019110019 6:169702221-169702243 CAGGGGCAGGGGCAGGGGCAGGG - Exonic
1019154969 6:170032578-170032600 GAGGCAACAGAGCAGGAGCAGGG + Intergenic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019401620 7:857266-857288 CAGGTGTGAGAGCTGGAGCACGG + Intronic
1019880607 7:3857279-3857301 AAGGGGAAGGAGGAGGAGAAAGG + Intronic
1019924000 7:4180451-4180473 CAGGGCATAGAGCTGGAGCCGGG - Intronic
1021128342 7:16880497-16880519 GAGGGGAAAGAGGAGGGGAAAGG - Intronic
1021132687 7:16930153-16930175 AAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1021280430 7:18710095-18710117 CAGGCAAAAGAGCATGTGCAGGG + Intronic
1021313246 7:19117433-19117455 CGGAGGAGAGAGCAGGAGGACGG + Exonic
1021440033 7:20667673-20667695 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440036 7:20667679-20667701 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440039 7:20667685-20667707 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440042 7:20667691-20667713 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440045 7:20667697-20667719 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440048 7:20667703-20667725 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440051 7:20667709-20667731 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021479461 7:21100096-21100118 CAGGGGAAAGAGTAGGATTGTGG - Intergenic
1021600974 7:22362829-22362851 CAGGGGATAGAGGAGTAGCAGGG + Intergenic
1021601050 7:22363738-22363760 CAGGGAATAGAGGAGTAGCAGGG + Intergenic
1021795020 7:24245779-24245801 GAGGGGCAAGAGGAGAAGCAGGG + Intergenic
1021819348 7:24480709-24480731 CAGAGGCAAGGGCAGGAGCTGGG - Intergenic
1021924218 7:25519295-25519317 CAGGGAAAAGAGGGAGAGCAGGG + Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022346933 7:29525976-29525998 GAGAGGCAAGAGCAGAAGCAAGG - Intergenic
1022629802 7:32074623-32074645 TACGGAAAGGAGCAGGAGCATGG + Intronic
1023158758 7:37277536-37277558 AAGAGGGAAGAGCAGGAGTAAGG + Intronic
1023717190 7:43056326-43056348 CAGGGGAAGCATCTGGAGCATGG - Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023765607 7:43507883-43507905 GAGAGGAAAGAGCAGGACCCAGG - Intronic
1023931547 7:44709290-44709312 CAGGGGAAGGACCCAGAGCAGGG - Intergenic
1024063672 7:45716350-45716372 GAGAGGAAAGCACAGGAGCAGGG - Exonic
1024565551 7:50676995-50677017 CAGGGGAGAGGGCAGGGGCTGGG + Intronic
1024875718 7:54020714-54020736 CGGGGGAAAGAGTGGGAGGAGGG - Intergenic
1024966331 7:55025280-55025302 CAGAGGATGAAGCAGGAGCAAGG + Intronic
1025110717 7:56213848-56213870 CATGGGAAAGAGCAGATGCTAGG + Intergenic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1025769921 7:64495073-64495095 CAGGGGAAGGAGGAGGGGCGGGG - Intergenic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1026592413 7:71708333-71708355 CAGGGAAGAGAGCATGTGCAGGG + Intronic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1026996403 7:74619659-74619681 CAGGGGAGAGAACAGGTGCGGGG - Intergenic
1027159400 7:75791408-75791430 GAGGGAAGAGAGCAGGAGCCAGG - Intergenic
1027333461 7:77123279-77123301 CGGTGGAAAGAGCAGGGACAAGG + Intronic
1027838921 7:83281837-83281859 CAGAGGAAAGATCTGGAGAAAGG - Intergenic
1028203666 7:87992226-87992248 CAGAGGAAAGAGATGGAACAAGG + Intronic
1028570045 7:92277038-92277060 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1029306934 7:99626452-99626474 CTGGGGTAAGAGCAGGAACCAGG + Intronic
1029308780 7:99641862-99641884 CAGAGGAAAGAGTAGAAGCAGGG - Intergenic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029479078 7:100802190-100802212 CTGGGGCAGGAGCTGGAGCAGGG - Intergenic
1029569535 7:101360466-101360488 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569538 7:101360472-101360494 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569541 7:101360478-101360500 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569544 7:101360484-101360506 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029611155 7:101627327-101627349 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1029611158 7:101627333-101627355 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1029782334 7:102748032-102748054 CGGTGGAAAGAGCAGGGACAAGG - Intergenic
1030128520 7:106177821-106177843 CAAGGGAAAGAGACAGAGCAGGG - Intergenic
1030153529 7:106429050-106429072 CAGGGCAAGAAGCAGGAGTATGG - Intergenic
1030320750 7:108164573-108164595 GAGGAGCAGGAGCAGGAGCAGGG + Intronic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1030845231 7:114400972-114400994 AAGAGGAAATAGCAGGAGTAAGG + Intronic
1030856408 7:114563035-114563057 CAGGGAAGAGAGCATGTGCAGGG + Intronic
1031053789 7:116972128-116972150 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
1031101036 7:117479909-117479931 CGGGGGAAAGAGCAAAAGGAAGG + Intronic
1031179058 7:118392051-118392073 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179061 7:118392057-118392079 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179064 7:118392063-118392085 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179067 7:118392069-118392091 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179070 7:118392075-118392097 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179072 7:118392081-118392103 CAGGGGCAGGGGCAGGGGCAAGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031329290 7:120443997-120444019 CTAAGGAAACAGCAGGAGCAAGG - Intronic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031878651 7:127170836-127170858 CAGGGGAAAGGGTGGGAGAAGGG + Intronic
1031997944 7:128245233-128245255 CAGGGGAAAGAGGGGAAGCAGGG - Intronic
1032019640 7:128400216-128400238 CAGGTGAGAGAGAAGGAGCCAGG + Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032323618 7:130906125-130906147 CTGGGGAAAGAGCAGGCCCTAGG - Intergenic
1032418648 7:131759490-131759512 CTGGAGAAAGAGCAGGGGAAAGG - Intergenic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1032511013 7:132472528-132472550 CAGGGGCAATGGCAGGAGCCAGG + Intronic
1032615383 7:133463537-133463559 AATGGAAGAGAGCAGGAGCAAGG + Intronic
1032640452 7:133760561-133760583 CAAGAGAAAGAGCAGGTGCCAGG - Intronic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1033229320 7:139584159-139584181 GAGGGGAGAGGGCAGGAACAGGG + Intronic
1033400726 7:141021532-141021554 CAGGGGGAAGGGCAGGAGTGGGG - Intergenic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033598024 7:142870398-142870420 CAGGGGAAAGGTCTGGAGCTTGG + Exonic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1033961083 7:146913900-146913922 CAGGGGAAAGGGTAGGAGGGTGG - Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034358530 7:150473650-150473672 CAGGGGCTAAGGCAGGAGCAGGG - Intronic
1034542439 7:151767181-151767203 CAGGAGAAAGAACAGACGCATGG + Intronic
1034702873 7:153111437-153111459 CAGGGGACAGAGGAGGCGCAGGG + Intergenic
1034906819 7:154956370-154956392 GGAGGGAAAGAGGAGGAGCAGGG + Intronic
1035289005 7:157825241-157825263 AAGGGGGAAGAAGAGGAGCAGGG - Intronic
1036163081 8:6406866-6406888 CGGGGGAGAGAGCAGGAGCAGGG - Intronic
1036277366 8:7367216-7367238 CAGGTAGAAGAGCATGAGCAGGG + Intronic
1036343964 8:7943119-7943141 CAGGTAGAAGAGCATGAGCAGGG - Intronic
1036621103 8:10424905-10424927 CGGGGGACAGCGAAGGAGCAGGG + Intronic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036709145 8:11067223-11067245 CAGGGGCAAGGGCAAGAGCCTGG + Intronic
1036839306 8:12103886-12103908 CAGGTAGAAGAGCATGAGCAGGG - Intergenic
1036861095 8:12350129-12350151 CAGGTAGAAGAGCATGAGCAGGG - Intergenic
1037432934 8:18832774-18832796 CAGGCAAAAGAGCAGGTGCAGGG + Intronic
1037546572 8:19929668-19929690 AAGGGGAAAGGGAAAGAGCATGG - Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1038240807 8:25806603-25806625 CAGGAGAGAGAGCACGTGCAGGG - Intergenic
1038296015 8:26291596-26291618 CCGGAGAAAGAGCACGAGCGGGG + Intronic
1038378896 8:27073652-27073674 CAGTGGAAAGAGCAGGAACTTGG + Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1039338856 8:36624390-36624412 TATGGGAAAGAACAGAAGCAGGG + Intergenic
1039418600 8:37417357-37417379 CAAAGGAAAGATCAGGAGCTTGG - Intergenic
1039899276 8:41739880-41739902 CTGGGAGAAGAGTAGGAGCATGG - Intronic
1039988597 8:42468601-42468623 CAGAGGAAAGAGATGAAGCATGG + Intronic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1040886046 8:52265197-52265219 AAGGAGATAGAGCAGGAGCCTGG + Intronic
1041153734 8:54962541-54962563 CAGCAGAAATAGCAGAAGCAAGG + Intergenic
1041278823 8:56190935-56190957 CAGAGGAAATAGCACGTGCAAGG + Intronic
1041926804 8:63245446-63245468 CAGGGGAAAGGGTAGGAGAGGGG - Intergenic
1041968770 8:63712533-63712555 CAGGCAAAAGAGCATGTGCATGG - Intergenic
1042470141 8:69178131-69178153 CCGGGGCAAGAGCTGGAGAATGG + Intergenic
1042505783 8:69558344-69558366 CAGTTGAAACAGCAGGGGCAGGG - Intronic
1042522842 8:69732633-69732655 CAGCAGAAAGACCATGAGCAGGG + Intronic
1042522984 8:69733980-69734002 CAGCAGAAAGACCATGAGCAGGG + Intronic
1042980950 8:74527384-74527406 CGGGGGAAAGGGTAGGAGCGGGG - Intergenic
1043368765 8:79566161-79566183 CAGTGGAAAGAACAAGAGCAAGG - Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043768042 8:84162491-84162513 CAGAGGGAAGAGCAGCGGCAGGG - Intergenic
1043835279 8:85038230-85038252 CATGGGCAAGAGCCTGAGCAAGG + Intergenic
1044152548 8:88799783-88799805 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1044728553 8:95212532-95212554 CAGGGGAAGGAGCAGGTGAGGGG + Intergenic
1045488280 8:102651275-102651297 AAGGGGAAAACCCAGGAGCAGGG + Exonic
1045522391 8:102914600-102914622 CCTGGGGAAGAGAAGGAGCATGG - Intronic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045871425 8:106931945-106931967 CAGGAGAGAGAGCATGTGCAGGG + Intergenic
1046146707 8:110170847-110170869 CAGGCAAAAGAGCATGTGCAGGG - Intergenic
1046805280 8:118473245-118473267 CAGGGGACAGAGCAAGACCCAGG - Intronic
1047635468 8:126756868-126756890 CAGAGGAAACAGCACGTGCAGGG - Intergenic
1047915745 8:129582174-129582196 CAGGGGAAGGAGCCGTGGCATGG + Intergenic
1048115531 8:131517644-131517666 GAGAGGAAAGAACAGGAGAAAGG - Intergenic
1048265720 8:132983936-132983958 CAGTGGGATGTGCAGGAGCAAGG - Intronic
1048513707 8:135085968-135085990 CCGTGGAAAGGGCAAGAGCATGG - Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048975757 8:139672244-139672266 CAGAGGCAGGAGCAGGACCAGGG + Intronic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049359616 8:142206098-142206120 CAGCGGAAGGGGCAGGGGCAGGG + Intergenic
1049359622 8:142206110-142206132 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1049433039 8:142574095-142574117 CATGGGAAACACCAAGAGCACGG - Intergenic
1049478773 8:142810208-142810230 CAGGTGAAGGAACAGGGGCACGG + Intergenic
1049757574 8:144317614-144317636 CTGGGGAGTGACCAGGAGCATGG - Intronic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050812147 9:9761854-9761876 AAGAGGAAAGAGGTGGAGCATGG - Intronic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051059971 9:13034464-13034486 GAGGGGAAACAGCAGAAGAATGG - Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1051487348 9:17623147-17623169 AAGGGGAAAGAACAGAACCAGGG - Intronic
1051593980 9:18805667-18805689 CAGGGGCAGGGGCAGGAGAAAGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052226364 9:26093120-26093142 GAAGAGAGAGAGCAGGAGCAGGG - Intergenic
1052502984 9:29316826-29316848 CAGGGACAAGAGATGGAGCAGGG + Intergenic
1052518307 9:29511301-29511323 CAAGAGAGAGAGCAGGTGCAGGG + Intergenic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1053150129 9:35737943-35737965 GAGGGGCAAGGGCAGGAACATGG + Intronic
1053215769 9:36269251-36269273 AAGGGGCAAGAGGAGGAGTAGGG - Intronic
1053365086 9:37517206-37517228 CAGGGGGAAGGGTGGGAGCAGGG + Intronic
1053368844 9:37543565-37543587 CAGAGAAAAGGGCAGAAGCAAGG + Intronic
1053691599 9:40589802-40589824 CAAGGGCAAGGGCAGGGGCAGGG - Intergenic
1053789373 9:41675618-41675640 CAGGTGACAGAGGAGGACCAAGG - Intergenic
1054155769 9:61639144-61639166 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1054177654 9:61886971-61886993 CAGGTGACAGAGGAGGACCAAGG - Intergenic
1054273203 9:63047683-63047705 CAAGGGCAAGGGCAGGGGCAGGG + Intergenic
1054302855 9:63390768-63390790 CAAGGGCAAGGGCAGGGGCAGGG - Intergenic
1054401636 9:64717284-64717306 CAAGGGCAAGGGCAGGGGCAGGG - Intergenic
1054435239 9:65201593-65201615 CAAGGGCAAGGGCAGGGGCAGGG - Intergenic
1054451213 9:65404429-65404451 CAGGGGAAGAAGCTGGGGCAGGG - Intergenic
1054475538 9:65570145-65570167 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1054495151 9:65820088-65820110 CAAGGGCAAGGGCAGGGGCAGGG + Intergenic
1054659877 9:67693837-67693859 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055271168 9:74560479-74560501 CAGGGAAAATGGCATGAGCAGGG + Intronic
1055583564 9:77732833-77732855 CAGGTGAGAGAGCTGGATCAGGG + Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055993836 9:82135977-82135999 CAGGGAAGAGAGCATGTGCAGGG + Intergenic
1056146103 9:83730895-83730917 AAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056955293 9:91076234-91076256 CAAGGAAAAGAGCAGAATCAAGG + Intergenic
1057076142 9:92139113-92139135 AAGGAGACAGAGAAGGAGCAGGG - Intergenic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057282762 9:93724816-93724838 CACAGGGAAGAGCATGAGCAAGG + Intergenic
1057572711 9:96216535-96216557 CAGGGAAAAGAAGAAGAGCACGG + Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057854668 9:98593422-98593444 CAGGGACAATGGCAGGAGCAGGG + Intronic
1058283079 9:103142684-103142706 TAGGTGAAAGAGCAAGACCAAGG - Intergenic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058637324 9:107049285-107049307 CAGTGGACAGTGCAGGAGGAGGG - Intergenic
1059570286 9:115426949-115426971 CAGGGAAGAGAGCATGTGCAAGG - Intergenic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059708419 9:116845085-116845107 CAGTGGAGAGAGCAGGGGCCTGG - Intronic
1059730289 9:117050450-117050472 CAGGGGAGGAAGCAGGAGTAGGG - Intronic
1059788450 9:117612962-117612984 GAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1060406727 9:123376502-123376524 CATGAGGCAGAGCAGGAGCAGGG - Intronic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1060718311 9:125955319-125955341 CCTGGGGAGGAGCAGGAGCAAGG - Intronic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060802111 9:126551412-126551434 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1060802114 9:126551418-126551440 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061618463 9:131795206-131795228 CTGAGGAAATAGCAGGTGCAAGG - Intergenic
1062013512 9:134279908-134279930 CAGGTGAAGGAGCAGGGCCAGGG - Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062205730 9:135335849-135335871 CAGGGGCCAGAGCAGGTGCAGGG + Intergenic
1062270739 9:135707235-135707257 TGGGGGAATGAGCAGGGGCATGG + Intronic
1062316452 9:135969527-135969549 CATGGGAAATGGCAGCAGCAGGG - Intergenic
1062347588 9:136122522-136122544 CAGGGTACAGGGCAGGAGCCTGG + Intergenic
1062537522 9:137027513-137027535 CAGTGGCGAGAGCATGAGCAAGG + Exonic
1203768183 EBV:37235-37257 CCGGGGACAGAGCAGGGGGAGGG + Intergenic
1203768189 EBV:37247-37269 CAGGGGGAGGGGCAGGGGCAGGG + Intergenic
1203768195 EBV:37259-37281 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1203768197 EBV:37265-37287 CAGGGGCAGGGGCAGGGGCAAGG + Intergenic
1203779992 EBV:95963-95985 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203779998 EBV:95981-96003 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780016 EBV:96026-96048 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780022 EBV:96044-96066 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780036 EBV:96080-96102 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780042 EBV:96098-96120 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780052 EBV:96125-96147 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780066 EBV:96161-96183 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780072 EBV:96179-96201 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780082 EBV:96206-96228 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780096 EBV:96242-96264 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780120 EBV:96308-96330 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780176 EBV:96461-96483 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780186 EBV:96488-96510 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780223 EBV:96587-96609 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203529251 Un_GL000213v1:122773-122795 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1203574632 Un_KI270744v1:165835-165857 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1203622284 Un_KI270749v1:136011-136033 CAAGGGCAAGGGCAGGGGCAGGG - Intergenic
1185754624 X:2643431-2643453 AAAGGGAAAGAGGAGGAGAAGGG + Intergenic
1185820126 X:3194897-3194919 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186594270 X:10964183-10964205 CAGGGGAATGAGGAGCACCAAGG - Intergenic
1186614129 X:11169047-11169069 CAGGGGACAGAGAAGTGGCATGG + Intronic
1187253739 X:17622718-17622740 CAGGGCACAGAGCAGGATCCTGG + Intronic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188113373 X:26217044-26217066 CAGGAGAATGAGTAGGAGAACGG - Intronic
1188916176 X:35913827-35913849 CAGGGAGAAGGGCAGAAGCAGGG - Intergenic
1190137339 X:47808749-47808771 CATGGGTAAGAGCAGTGGCATGG + Intergenic
1190446242 X:50527354-50527376 CAAGTGAAACAGCAGGAGCTAGG - Intergenic
1190894965 X:54608500-54608522 CGGGGGAAAGAGTAGGAGGGGGG - Intergenic
1191083128 X:56535127-56535149 CAGGCTAAAGTGCAGTAGCATGG - Intergenic
1191099598 X:56711461-56711483 CAGGTGAAAGAGTGGGAGCAGGG + Intergenic
1191901377 X:66044093-66044115 CAGTGGAAAGAGCATGGGAATGG + Intergenic
1192179879 X:68909797-68909819 TAGAGGACAGAGCAGGAGCTGGG - Intergenic
1192205370 X:69092396-69092418 GAGGGGCAAGAGTAGAAGCAGGG + Intergenic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1192244380 X:69360590-69360612 GAGGGGCAAGAGAAGAAGCAGGG + Intergenic
1192432091 X:71119264-71119286 AAGGTGAAAGGGCAGGAGGAGGG - Intronic
1192669525 X:73125223-73125245 GAGGTGAAAGAGGAGGAGTATGG - Intergenic
1192781944 X:74303570-74303592 CAGGGGACAGAGCAAGATCATGG + Intergenic
1193255863 X:79348451-79348473 CAGGGGAAAGGGTGGGAGTAGGG + Intergenic
1193979817 X:88168716-88168738 CAGAGGAAAAAGCAGAAGCCTGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1195823462 X:108971486-108971508 TGGGGGAAAGAGCATGAGCGGGG + Intergenic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1197545774 X:127822189-127822211 CAGGGGAAAGGGAGGGAGTAGGG + Intergenic
1197714426 X:129696141-129696163 CAGGACAAAGGCCAGGAGCAAGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197815547 X:130494367-130494389 CAGAGGAGAGATCAGAAGCAGGG + Intergenic
1198054114 X:132976894-132976916 CATGGTATAGAGTAGGAGCAAGG + Intergenic
1198212818 X:134531004-134531026 CAGGGGGATGACCTGGAGCAGGG - Intergenic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1199332869 X:146582375-146582397 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1199350377 X:146793964-146793986 CAGGCAAAAGAGCAGGGGCAGGG - Intergenic
1199365036 X:146971326-146971348 AGGGGGACAGAGCAGGGGCAAGG - Intergenic
1199382333 X:147184445-147184467 AGGGGGACAGAGCAGGGGCAAGG + Intergenic
1199458844 X:148060367-148060389 CAGGCAAAAGAGCTTGAGCAGGG + Intergenic
1199683019 X:150240426-150240448 TGGGGGACACAGCAGGAGCAAGG + Intergenic
1199862791 X:151816871-151816893 TAGGAGAAAGAGCAGGAGAAAGG - Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199950075 X:152699860-152699882 CTGAGGTAACAGCAGGAGCAGGG - Intronic
1199959599 X:152768601-152768623 CTGAGGTAACAGCAGGAGCAGGG + Intronic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200001742 X:153065649-153065671 GGGCAGAAAGAGCAGGAGCAGGG + Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200401800 X:156024251-156024273 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1200818979 Y:7562746-7562768 CAGGGGAAAGGGTGGGAGCGGGG + Intergenic
1200819323 Y:7566085-7566107 GAAGGGAAAGAGGAGGAGAAGGG + Intergenic
1200834295 Y:7717961-7717983 CAGGGGAAAGAGAAGAAGTCTGG - Intergenic
1201184011 Y:11380298-11380320 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1201474385 Y:14364718-14364740 AAGGAGGAAGAGAAGGAGCATGG + Intergenic
1201690072 Y:16753327-16753349 CAGCCCAAAGAGCAGAAGCAGGG - Intergenic
1201977824 Y:19871551-19871573 CAGGGGACAGAGCAAAAGAAAGG - Intergenic
1202371177 Y:24197080-24197102 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202376150 Y:24239389-24239411 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202494630 Y:25430729-25430751 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1202499607 Y:25473037-25473059 CAATGGAAAGAGCAGGAGAAGGG + Intergenic