ID: 948462601

View in Genome Browser
Species Human (GRCh38)
Location 2:238137593-238137615
Sequence GCATCTCAGGACCAGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948462590_948462601 30 Left 948462590 2:238137540-238137562 CCTTGCAGACTTGGCAGTAATTT 0: 1
1: 0
2: 0
3: 11
4: 201
Right 948462601 2:238137593-238137615 GCATCTCAGGACCAGGAGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 208
948462595_948462601 -7 Left 948462595 2:238137577-238137599 CCTCCATAGGCTGTGTGCATCTC 0: 1
1: 0
2: 1
3: 8
4: 152
Right 948462601 2:238137593-238137615 GCATCTCAGGACCAGGAGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 208
948462593_948462601 -5 Left 948462593 2:238137575-238137597 CCCCTCCATAGGCTGTGTGCATC 0: 1
1: 0
2: 1
3: 10
4: 162
Right 948462601 2:238137593-238137615 GCATCTCAGGACCAGGAGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 208
948462596_948462601 -10 Left 948462596 2:238137580-238137602 CCATAGGCTGTGTGCATCTCAGG 0: 1
1: 0
2: 1
3: 20
4: 213
Right 948462601 2:238137593-238137615 GCATCTCAGGACCAGGAGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 208
948462594_948462601 -6 Left 948462594 2:238137576-238137598 CCCTCCATAGGCTGTGTGCATCT 0: 1
1: 0
2: 2
3: 12
4: 150
Right 948462601 2:238137593-238137615 GCATCTCAGGACCAGGAGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948462601 Original CRISPR GCATCTCAGGACCAGGAGTG GGG Intergenic
900631797 1:3640417-3640439 GCATCTCAGCATCAGCAGGGCGG + Intronic
900631860 1:3640713-3640735 GCATCTCAGCATCAGCAGGGCGG + Intronic
900631868 1:3640750-3640772 GCATCTCAGCATCAGCAGGGCGG + Intronic
902052876 1:13578075-13578097 GCATCTCAGGACAAGGAATAAGG - Intergenic
902611402 1:17599644-17599666 GCTTCTCTGGACCAGGAAGGTGG - Intronic
903121766 1:21220838-21220860 GGATCTCAGGATCAGGTGGGGGG - Intronic
904090406 1:27941084-27941106 GCATGTCAGGACCATGGATGGGG - Intronic
904774788 1:32900144-32900166 GCATCCCAGGACCAAGACTTTGG + Intronic
905020293 1:34806190-34806212 ACATCCCTGGACCTGGAGTGGGG + Intronic
905020483 1:34807701-34807723 ACATCACTGGACCTGGAGTGGGG + Intronic
905658446 1:39701510-39701532 GCATCTCAGGGCCAGGATGAAGG - Intronic
905662624 1:39739003-39739025 GCATCTCTGAACCAGGAGGACGG + Intronic
906946987 1:50303051-50303073 GCAGCTCTGGGCCAGGAGTCAGG - Intergenic
907368017 1:53978776-53978798 GCATTTCAGGCCCAGGAGTATGG + Intergenic
909293437 1:73913218-73913240 GTAAATCAGTACCAGGAGTGGGG - Intergenic
910211697 1:84800269-84800291 GAAGGTCAGAACCAGGAGTGGGG + Intergenic
913246524 1:116875096-116875118 TCATTTCAGTACCAAGAGTGGGG - Intergenic
913609012 1:120492673-120492695 GCATCGCTGGACCAGGCCTGGGG - Intergenic
913986432 1:143569994-143570016 GCCTCTCTGGACCAGGCCTGGGG + Intergenic
914204816 1:145517778-145517800 GCATCGCTGGACCAGGCCTGGGG + Intergenic
914582179 1:149029165-149029187 GCATCGCTGGACCAGGCCTGGGG + Intronic
916064224 1:161123171-161123193 ACATCTGAGGACCCGAAGTGGGG + Exonic
916405878 1:164497442-164497464 GCTTCTCAGCACCAGCAGTGAGG - Intergenic
922080057 1:222287230-222287252 GAATCTCAGGGCCAGAAGAGTGG + Intergenic
922774915 1:228210245-228210267 GAATCACAGGACCAGGAGGAGGG + Intronic
924625559 1:245694421-245694443 GGCTCTCAGGAGCAGGAGTTTGG + Intronic
1062956625 10:1544409-1544431 GCTTCTCAGGAGCAGGCTTGGGG + Intronic
1063439894 10:6064205-6064227 CCATCTCAGAACCAAGAGTTGGG - Intergenic
1070337722 10:75469999-75470021 GCATCCAAGAACCAGAAGTGTGG - Intronic
1071532387 10:86400332-86400354 GCAGCTCAGGAGCGGGAGGGCGG + Intergenic
1073806514 10:107104481-107104503 TCACCTCAGGATCTGGAGTGTGG + Intronic
1075581824 10:123624546-123624568 GCCCCTGAGGACCAGCAGTGGGG - Intergenic
1075653176 10:124143388-124143410 ACATCTCTGAACCAGGAGTTAGG - Intergenic
1075816081 10:125265661-125265683 GCATTTCAGCAACAGGACTGTGG + Intergenic
1075936124 10:126342949-126342971 ACATTTCAGGACCAGCAGAGAGG - Intronic
1076032091 10:127168132-127168154 GCATCTCAGGACCTGCAGAGTGG + Intronic
1076449566 10:130547362-130547384 GGGTCTCAGGGCCAGCAGTGGGG - Intergenic
1076558588 10:131346361-131346383 ACATCTCTGGACCAGCATTGTGG - Intergenic
1076579325 10:131496147-131496169 GCATCTCAGGACTGGGTGGGAGG + Intergenic
1076741511 10:132488109-132488131 GCTTCTCAGGGACAGGAGTGTGG - Intergenic
1077191701 11:1258442-1258464 GAATGTCAAGACAAGGAGTGGGG - Intronic
1077348506 11:2076633-2076655 GCATCTAAAGACCTGGAGGGTGG - Intergenic
1078595178 11:12680349-12680371 GCATCTCAGCAGAAGGAGTCAGG - Intronic
1079839802 11:25382611-25382633 GGATCCCAGGACCAGGCTTGTGG + Intergenic
1083895109 11:65616045-65616067 GCAATTCTGGGCCAGGAGTGGGG + Exonic
1084543735 11:69803279-69803301 GGATCTCAGGCCCTGGAGTCAGG - Intergenic
1085418780 11:76337809-76337831 GCAGCTCAGAATCAGGACTGGGG - Intergenic
1086364678 11:86096759-86096781 GGATCTCAGAACCAGGAATTTGG - Intergenic
1086610021 11:88744460-88744482 GCAACTGAAGCCCAGGAGTGGGG + Intronic
1087234792 11:95705915-95705937 GCATCCTAGGACCAGGGGTCTGG - Intergenic
1089384364 11:118058359-118058381 TCACCCCAGGGCCAGGAGTGTGG + Intergenic
1089533167 11:119145018-119145040 GCAGCCCAGGACCAGGAAGGAGG - Intergenic
1093339230 12:17950499-17950521 GCAGCTCAGGCCCAGGAGGCTGG - Intergenic
1096252177 12:50040446-50040468 GCACCTCCAGAGCAGGAGTGAGG - Intergenic
1098381976 12:69879253-69879275 GCATCGCAGGAGCAGCTGTGGGG - Intronic
1100122384 12:91383656-91383678 TCATCTGAGGACCAGGGCTGTGG - Intergenic
1103317505 12:120068339-120068361 TCTTCTAAGGACCTGGAGTGGGG + Intronic
1106462028 13:29979411-29979433 GCTTCTCAGGACCATGACTTTGG - Intergenic
1106677998 13:31982060-31982082 GCAGCTCTGGACCAGCAGTGGGG - Intergenic
1108551794 13:51553564-51553586 GCAGCTCAGGAGCAGAAATGGGG + Intergenic
1112563036 13:100530628-100530650 GAAAATCAGCACCAGGAGTGAGG - Exonic
1113884412 13:113650989-113651011 GAATCTCAGGAGCCGCAGTGTGG + Intronic
1113910148 13:113837845-113837867 GCATCTGAGGGCCAGGACTCAGG - Intronic
1115166362 14:30452686-30452708 GCATCCCAGGAACATGGGTGGGG - Intergenic
1120603480 14:86542085-86542107 ACATCTCAGGGCAAGGAGTGTGG + Intergenic
1121362318 14:93272925-93272947 GTATCCCATGAGCAGGAGTGAGG - Intronic
1122727977 14:103771993-103772015 GGATATGAGAACCAGGAGTGGGG - Intronic
1124457071 15:29853238-29853260 GCATCTGGGGACCAGTAGAGGGG + Intronic
1126557533 15:50005518-50005540 TCATATCTGGCCCAGGAGTGAGG + Intronic
1128748467 15:70131693-70131715 GTGTCTCAGGGCCAGGAGAGGGG + Intergenic
1128769079 15:70268492-70268514 GGGTCTCAGGACAAGGAGAGTGG - Intergenic
1129296891 15:74604631-74604653 GGAGCTCAGGCCCAGGGGTGTGG - Intronic
1130343709 15:83022295-83022317 GCAACTCAGGACAATGAGTTGGG - Intronic
1130554791 15:84915113-84915135 GCATCTCAGTCCCAGGAGTGTGG + Intronic
1132463861 16:68643-68665 GCATCCCAGGACCAGCTGGGGGG + Intronic
1133201290 16:4206264-4206286 GCATTGCAGAACCAGGACTGAGG - Intronic
1133650830 16:7813159-7813181 GTAACTCAGTACCAAGAGTGGGG - Intergenic
1136187951 16:28599185-28599207 GCAGCCCAGGACAGGGAGTGGGG + Intergenic
1136190423 16:28612179-28612201 GCAGCCCAGGACAGGGAGTGGGG + Intronic
1139392069 16:66611495-66611517 GCAGCCCAGGAACCGGAGTGAGG + Intronic
1139596355 16:67960525-67960547 AAATCTCACGACCAGGTGTGAGG + Intronic
1140124040 16:72105699-72105721 ACATCCCAGGGCCAGGAGCGAGG - Intronic
1140402606 16:74683846-74683868 GCAGCTCAGGCCCATGAATGGGG - Intronic
1140831326 16:78754226-78754248 GAATCTCAGGAAGAGAAGTGAGG - Intronic
1141323822 16:83036978-83037000 GCATCTGAAGACCAGGAGGAGGG + Intronic
1141733771 16:85839283-85839305 GCATCTCAGGTGCACGTGTGGGG + Intergenic
1141879952 16:86851198-86851220 CCATCTCAGGACCAAAAGAGAGG + Intergenic
1142977807 17:3656054-3656076 GCATGGCAGGGCCAGGGGTGAGG - Intronic
1143348812 17:6271537-6271559 CCATGTCAGGATCAGGTGTGAGG + Intergenic
1143491035 17:7285301-7285323 CCAGCTCCGGACCAGGACTGGGG + Intronic
1143760781 17:9102419-9102441 CTATCACAGGACCAGGATTGGGG + Intronic
1143874884 17:9984224-9984246 GCATCAGAGGACCAGAAGGGTGG - Intronic
1145242674 17:21248911-21248933 GGTTCTCAGGCCCAGGAGGGAGG - Intronic
1145809506 17:27756102-27756124 GCATCTCAGGGGCAGGAGAAGGG - Intergenic
1146958604 17:36952972-36952994 GCTGCTGAGGAACAGGAGTGTGG + Exonic
1148794128 17:50189107-50189129 CCATCACAGGACTTGGAGTGGGG - Intronic
1149626985 17:58086550-58086572 TAAACTCAGGACCAGGAGTCAGG + Intronic
1150703864 17:67470409-67470431 GCTTGTTAGGAACAGGAGTGGGG - Intronic
1152293454 17:79453712-79453734 GCATCTCTGGGACAGGACTGGGG + Intronic
1152711431 17:81872047-81872069 GCTCCTCAGGACCAGGAGGCAGG + Intergenic
1153018597 18:606550-606572 GCTTCTCCTGACCAGGGGTGAGG - Intronic
1154405240 18:14084605-14084627 GAAGCTCAGGACCAGGAGAAGGG - Intronic
1155918249 18:31577258-31577280 GCAACTAATAACCAGGAGTGAGG - Intergenic
1156747870 18:40414680-40414702 GCATCTCAGAACAGGGAGTGTGG + Intergenic
1158307344 18:56120408-56120430 GCATCTGAGGTCCAGGATTCTGG + Intergenic
1160360186 18:78268473-78268495 GCATCTCAGGCCCTGGACTGTGG + Intergenic
1160856335 19:1219487-1219509 GAATATCAGGACAAGCAGTGTGG - Intronic
1160868262 19:1265695-1265717 GAATCTCAGGCCCGGGGGTGGGG + Intronic
1160901396 19:1430390-1430412 GCATCTCCGGAGCAGGCGGGAGG - Intronic
1162066226 19:8126845-8126867 GCAGCTCAGGACCTGGTGGGGGG - Intronic
1162847228 19:13402322-13402344 GCATCTCAGGCCAAAGAATGTGG + Intronic
1165350837 19:35274489-35274511 GCATCTCAGGAAGGGGTGTGTGG + Intronic
1165402918 19:35613234-35613256 CCATCTCATGACCAGACGTGGGG - Intronic
1166120429 19:40683124-40683146 GCATGTCTAGACCAGGAATGGGG - Intronic
1166582715 19:43916402-43916424 GCATCACTGGGCCAGGCGTGGGG - Intronic
1167051666 19:47082816-47082838 GTCTCTCAGAACCAGGAGTCTGG - Intronic
1167426948 19:49434338-49434360 TCCTCTCAGACCCAGGAGTGCGG + Intronic
925385675 2:3460021-3460043 GCATCAGAGAACCAGGAGGGTGG - Intronic
925428522 2:3771269-3771291 GCATGTCAGGACCCGGCGAGTGG - Intronic
925887314 2:8404029-8404051 GCATGTCAGGGCCAGCAGGGAGG - Intergenic
926250381 2:11152557-11152579 GCAGCTGTGGCCCAGGAGTGGGG + Intergenic
926311160 2:11677276-11677298 GCCTCTGAGGAGCTGGAGTGGGG + Intergenic
926742648 2:16125472-16125494 GCATCTGAGGACCTGGTTTGAGG + Intergenic
929785545 2:44988258-44988280 ACATGGCAGGATCAGGAGTGAGG + Intergenic
930063649 2:47311129-47311151 GCATGGCAGGACCAGGAGGTGGG + Intergenic
931450676 2:62365277-62365299 GTATCTCAGGCCCAGCTGTGGGG - Intergenic
935638702 2:105270478-105270500 GTCTCTAAGGACCAGAAGTGAGG + Intronic
937763785 2:125635570-125635592 TCATCTCAGTACCAGGTGTACGG + Intergenic
942106652 2:172640367-172640389 GCTTTTCAGGACCAGGAAGGAGG - Intergenic
942460253 2:176163466-176163488 GCAGCCCAGGGCCAAGAGTGTGG + Intronic
947499976 2:230664668-230664690 CCACCTCAGGATCAGAAGTGGGG + Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
948462601 2:238137593-238137615 GCATCTCAGGACCAGGAGTGGGG + Intergenic
1170432331 20:16287864-16287886 GCACCTGTGGACCAGAAGTGAGG + Intronic
1170447315 20:16441611-16441633 GCATCTCAGGAGCAGGATCCAGG + Intronic
1171442881 20:25179830-25179852 GCATCTCTGCTCCAGGAGGGTGG - Intergenic
1173836610 20:46130178-46130200 GGAGCTCAGGACCCAGAGTGAGG - Intergenic
1175234577 20:57501277-57501299 GCAGCGCAGGACCAGGTGGGTGG + Intronic
1179494351 21:41762300-41762322 AGATCTGAGGCCCAGGAGTGGGG + Intronic
1179842530 21:44086731-44086753 GCATCTCAGGGCCCGCAATGGGG - Intronic
1180802396 22:18637974-18637996 GCCCCTGAGGACCAGGAGTCAGG - Intergenic
1180853632 22:19033529-19033551 GCCCCTGAGGACCAGGAGTCAGG - Intergenic
1181219328 22:21357287-21357309 GCCCCTGAGGACCAGGAGTCAGG + Intergenic
1182029189 22:27144114-27144136 GCATCTCAAGACCCTCAGTGGGG - Intergenic
1184175953 22:42788807-42788829 GTATGTCAGTACCAGGAGGGAGG + Intergenic
1184283457 22:43452412-43452434 GCAGCTGAGGAGCAGCAGTGGGG - Intronic
950028366 3:9835575-9835597 GCATCTCCGATCCAGGGGTGGGG + Intronic
950318447 3:12026590-12026612 GCCTCTCAGGTAGAGGAGTGAGG + Intronic
954652182 3:52171951-52171973 GCAGATGAGGACCAGGAGTAGGG + Intergenic
960871048 3:122250176-122250198 GAATCACAGGACCAGGAGACTGG + Intronic
960936035 3:122903267-122903289 GCAGCTCAGGATGAGGAGAGAGG + Intergenic
960997355 3:123348906-123348928 GAATCTCAGGACCATGTGGGAGG - Intronic
963939317 3:151084707-151084729 ACAGGTCAGGATCAGGAGTGAGG + Intergenic
964470823 3:157053874-157053896 GTACCTCAGGTCCAGGAGTTGGG + Intergenic
969583685 4:8080039-8080061 GCAGCTCAGGGCCAGGAGCTGGG - Intronic
970116308 4:12700063-12700085 GCATCTTGGGAACAGCAGTGAGG + Intergenic
971093365 4:23370976-23370998 CCCTCTCAGGACCATGAGTGGGG - Intergenic
979375844 4:119945623-119945645 CCACCTCAGGATCAGGAGAGTGG - Intergenic
980182578 4:129419690-129419712 GAATATCAGGGCCAGGAGTTTGG - Intergenic
981918338 4:150059202-150059224 GCATCTCAGGACATGGCTTGGGG + Intergenic
982423678 4:155229830-155229852 GCATCTCAGGGCCTGGAGTGAGG - Intergenic
986257267 5:6110768-6110790 GCATCTCAGCACCACGAGTCTGG + Intergenic
991161139 5:63504661-63504683 GAATCTCAGAACCTGAAGTGTGG - Intergenic
994117693 5:96079248-96079270 GGAGCTCAGGACAAAGAGTGTGG - Intergenic
996354071 5:122577424-122577446 GCATCTCAGGGTCAGGAGGTGGG + Intergenic
997840383 5:137234228-137234250 GATTCTCAGGACCAGCAGGGAGG + Intronic
997964823 5:138348606-138348628 GCATGTCAGGAGCATCAGTGAGG + Exonic
1001108709 5:168877450-168877472 GCAGGACAAGACCAGGAGTGTGG + Intronic
1001711523 5:173782450-173782472 GGATCTCAGGGCAAGGAGGGAGG - Intergenic
1003255049 6:4467621-4467643 GCATCTCAGGGTCAGGGCTGGGG + Intergenic
1004159501 6:13201051-13201073 GGTCCTCAGGACCAGGACTGGGG - Intronic
1005177939 6:23069595-23069617 GAATCTCAGAACCAGCACTGGGG + Intergenic
1006167132 6:32071539-32071561 GCAGATGAGGACCAGGAGAGTGG - Intronic
1006438483 6:34039362-34039384 GGATCCCAGGACAAGGAGAGTGG + Intronic
1006726846 6:36205385-36205407 TCATCTCTGGAGCAGCAGTGTGG - Intronic
1006902287 6:37510991-37511013 GCATGCCAGGGCCAGGAGTAGGG - Intergenic
1008466976 6:51842242-51842264 GCATCTCTGCTCCATGAGTGGGG + Intronic
1009858090 6:69290029-69290051 ACACCTCAGGACCAGAATTGTGG + Intronic
1015129714 6:129795501-129795523 GCAGCACAGGGGCAGGAGTGTGG - Intergenic
1015866911 6:137736398-137736420 GGATCTCAGGACCTGGAGAGTGG + Intergenic
1016833356 6:148454187-148454209 ACATCACAGGCCCAGGACTGAGG + Intronic
1018469646 6:164084068-164084090 CCATCCAAGGACTAGGAGTGGGG + Intergenic
1018720287 6:166566785-166566807 GCCTGTCAGGTGCAGGAGTGGGG - Intronic
1019080687 6:169427510-169427532 TCATCTCAGATCCAGGAGAGAGG + Intergenic
1019867423 7:3725293-3725315 GGATCTCAGGACTTTGAGTGAGG + Intronic
1022270360 7:28801205-28801227 ACATCTGAGGAACAGGACTGGGG + Intronic
1022684767 7:32586442-32586464 GGGTCACAGGACCAGGGGTGAGG - Exonic
1024109942 7:46134607-46134629 GCGTCTCAGAACCCAGAGTGTGG + Intergenic
1024533548 7:50411722-50411744 TCATCCCAGGACCAGGAGCCAGG + Intergenic
1025605751 7:63038852-63038874 GTCTCTCTGGACCTGGAGTGTGG - Intergenic
1027690063 7:81333745-81333767 GGATCTCGGGAGCAGGCGTGAGG + Intergenic
1028772385 7:94640951-94640973 GCATTTCAGGTCCAGAAGTTAGG - Intronic
1031947723 7:127858620-127858642 GCATCACAGGAGCAGGAGAGTGG - Intronic
1034958945 7:155352315-155352337 GCATCGCAGCACCAGGAACGTGG + Intergenic
1035298521 7:157881401-157881423 GCATCTGAAGCCCAGGAGAGAGG + Intronic
1036621278 8:10425664-10425686 GCAGCTCAGGGCCGGGAGCGAGG + Intronic
1036632753 8:10526664-10526686 TGATCTCAGGACCAAGAATGTGG + Intronic
1038007825 8:23448536-23448558 TCATCTCAGAACCAGGAATCAGG + Intronic
1038425745 8:27462839-27462861 CCATCTAAGGACCATGACTGAGG + Intronic
1040565646 8:48564602-48564624 GCATCTCAGGCCCAGTGGTAAGG + Intergenic
1040647955 8:49421222-49421244 GTAACCCAGGACCAGGTGTGAGG - Intergenic
1040710052 8:50177011-50177033 GCCTCTCAGGACTAAAAGTGTGG + Intronic
1040970011 8:53125555-53125577 CCATCCCAGAACCAGTAGTGAGG - Intergenic
1042313902 8:67405468-67405490 GCATCTCAGGACCATTAGCAGGG - Intergenic
1044073075 8:87786031-87786053 GTAAATCAGTACCAGGAGTGGGG - Intergenic
1048448705 8:134512488-134512510 GTATCTCAGGTCCTGGAGCGCGG + Exonic
1052833694 9:33235079-33235101 AGAGCTCCGGACCAGGAGTGAGG - Intronic
1056512195 9:87316658-87316680 GCCTCTGAGGACCAGTGGTGTGG - Intergenic
1058359948 9:104133308-104133330 GCAGCTCAGGACCAAGAGAGAGG - Intronic
1058931526 9:109723932-109723954 GTATGTCAGGACCAGAAGTTTGG + Intronic
1059338748 9:113585426-113585448 GCATTTCAAGAGAAGGAGTGGGG - Intronic
1060202009 9:121656867-121656889 GAATCTCAGGACCTGGAGGTGGG - Intronic
1061783363 9:133008470-133008492 GCATCGCAGGGCCAGGAATTTGG + Intergenic
1061931167 9:133833893-133833915 GCATCCCAGGACCCGGCTTGGGG + Intronic
1188317375 X:28691164-28691186 GCATATCAGGGGCAGGGGTGGGG - Intronic
1191736072 X:64389265-64389287 GCATGTCAGTATCAGAAGTGGGG + Intronic
1195465667 X:105176471-105176493 GCTTCTCGGGGCCAGGACTGGGG - Intronic
1196309179 X:114141625-114141647 GCATCTCTTGAGAAGGAGTGTGG + Intergenic
1197774878 X:130112072-130112094 TCATCTCAGGCGCAGGACTGGGG + Intergenic
1198683767 X:139206523-139206545 GGCTTTCAAGACCAGGAGTGTGG + Intronic
1198807035 X:140503409-140503431 GGAACTCAGGAGGAGGAGTGGGG + Exonic
1200003995 X:153075552-153075574 CCAACCCAGGACAAGGAGTGGGG + Intergenic
1201584966 Y:15549948-15549970 GCATCTGAGGAACAGCAGGGAGG + Intergenic
1201761588 Y:17545384-17545406 ACATCTCAGAACCTGGAATGTGG - Intergenic
1201839964 Y:18360606-18360628 ACATCTCAGAACCTGGAATGTGG + Intergenic