ID: 948465310

View in Genome Browser
Species Human (GRCh38)
Location 2:238149242-238149264
Sequence CACAGAGGGCCCACTGCGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948465294_948465310 29 Left 948465294 2:238149190-238149212 CCCAGGACTCCTGACATCAGAGA 0: 1
1: 0
2: 2
3: 29
4: 231
Right 948465310 2:238149242-238149264 CACAGAGGGCCCACTGCGAAGGG 0: 1
1: 0
2: 1
3: 10
4: 98
948465296_948465310 20 Left 948465296 2:238149199-238149221 CCTGACATCAGAGAGCCAGCCTG 0: 1
1: 1
2: 1
3: 24
4: 255
Right 948465310 2:238149242-238149264 CACAGAGGGCCCACTGCGAAGGG 0: 1
1: 0
2: 1
3: 10
4: 98
948465305_948465310 1 Left 948465305 2:238149218-238149240 CCTGGGAAGTGAGGGATGGGGTG 0: 1
1: 0
2: 4
3: 63
4: 1164
Right 948465310 2:238149242-238149264 CACAGAGGGCCCACTGCGAAGGG 0: 1
1: 0
2: 1
3: 10
4: 98
948465295_948465310 28 Left 948465295 2:238149191-238149213 CCAGGACTCCTGACATCAGAGAG 0: 1
1: 0
2: 1
3: 22
4: 198
Right 948465310 2:238149242-238149264 CACAGAGGGCCCACTGCGAAGGG 0: 1
1: 0
2: 1
3: 10
4: 98
948465301_948465310 5 Left 948465301 2:238149214-238149236 CCAGCCTGGGAAGTGAGGGATGG 0: 1
1: 0
2: 6
3: 63
4: 907
Right 948465310 2:238149242-238149264 CACAGAGGGCCCACTGCGAAGGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948465310 Original CRISPR CACAGAGGGCCCACTGCGAA GGG Intronic
906545989 1:46619835-46619857 CTCAGAGTTCCCACTGCGAGGGG - Intergenic
907650065 1:56286474-56286496 CATAGAGGGACCACTGCAATGGG + Intergenic
912971147 1:114284671-114284693 CACAGAGGAGCCCCTGGGAATGG - Intergenic
913220242 1:116654330-116654352 CTCAGAGGGCTCACGGAGAAGGG + Intronic
915037826 1:152943499-152943521 CACAAAGGGCCCACAGTTAAGGG + Intergenic
915586958 1:156849122-156849144 CTCAGAGGTCTCACTGGGAATGG - Intronic
923854274 1:237828967-237828989 CTCAAAGGTCCCACTGTGAATGG - Intronic
924455852 1:244218376-244218398 CACAAAGCGCCCACTGTGAGAGG + Intergenic
1065818839 10:29506803-29506825 GACAGAGGGCCTACAGGGAAGGG + Intronic
1067452182 10:46388605-46388627 CACATGGTGCCCACTGGGAAGGG - Intronic
1067585055 10:47471150-47471172 CACATGGTGCCCACTGGGAAGGG + Intronic
1067802162 10:49366369-49366391 CACAGTGGGCCCCCTGGAAAAGG + Exonic
1068590273 10:58846025-58846047 GAAAGAGGGCCCACTGGGCAGGG + Intergenic
1070602068 10:77872968-77872990 CACAGAGTGCCCAGGGCTAAGGG + Intronic
1072253265 10:93598687-93598709 CAGAGAGGACCCAATGAGAAGGG - Intronic
1074632649 10:115275247-115275269 CCCAGTGGGCCCACTGTGAGAGG + Intronic
1075440416 10:122475732-122475754 CACAGAGGGGCCTGTGCGACTGG - Intronic
1076549615 10:131269937-131269959 CACAGAGAGCCCACGGAGCACGG + Intronic
1077149259 11:1061877-1061899 CACACAGGAGCCACTGTGAAGGG - Intergenic
1078011084 11:7573710-7573732 CACAGTGGGCCCGCTGAGAAGGG - Intronic
1081524540 11:43917002-43917024 CACAGAGGGTACACTGTGTAAGG + Intronic
1083977234 11:66133011-66133033 TACAGAGGGCCGACTGTAAATGG + Intronic
1086520963 11:87667254-87667276 CTCAGGGGGCACACTGTGAACGG + Intergenic
1088766810 11:112990034-112990056 CCCACAGGCCCCACTGCAAAAGG - Intronic
1091218254 11:133916672-133916694 CACAGTGGGGACACTGGGAAAGG + Intronic
1091657128 12:2353919-2353941 CACAGAAGGCCCACTGCTGATGG - Intronic
1091860350 12:3776022-3776044 CACGGAGGGCCCACAGAGACAGG + Intergenic
1098115347 12:67170337-67170359 CACACAGGGCTCATTGCAAATGG + Intergenic
1103747444 12:123135066-123135088 CACAGAGTGGGCACTGCGAAAGG - Intronic
1113632257 13:111896426-111896448 AGCTGAGGGCCCACTGGGAACGG - Intergenic
1114458819 14:22874000-22874022 GACAGAGGCCCCTCTGCAAACGG + Intronic
1119771481 14:77222705-77222727 CAGAGAAGGGCCACTGCGGAAGG - Intronic
1127451816 15:59123981-59124003 GAGAGAGGGCCCACTTCAAATGG + Intronic
1127894853 15:63288439-63288461 AACAAAGGGTCTACTGCGAATGG - Intronic
1130693249 15:86104576-86104598 CACAGAGGTCCTACTGGGAGTGG + Intergenic
1130906185 15:88242255-88242277 CACAGAGGCCCCACGCGGAAAGG - Intronic
1131559068 15:93423893-93423915 GTCAGAAGGCCCACTGGGAAAGG + Intergenic
1132713767 16:1280447-1280469 CACAAAGGCCCCACTGCCCACGG - Intergenic
1134085679 16:11356007-11356029 CACAGGGGGCCCAATTCAAAAGG - Intergenic
1135010155 16:18869182-18869204 CCCATATGGCCCACTGCCAAAGG + Exonic
1135316998 16:21456338-21456360 CCCATATGGCCCACTGCCAAAGG + Intergenic
1135369921 16:21888579-21888601 CCCATATGGCCCACTGCCAAAGG + Intergenic
1135441893 16:22482543-22482565 CCCATATGGCCCACTGCCAAAGG - Intronic
1136038788 16:27561532-27561554 ATCAGAGGGTCCACTGCTAAGGG - Intronic
1136313817 16:29436508-29436530 CCCATATGGCCCACTGCCAAAGG + Intergenic
1136327257 16:29538273-29538295 CCCATACGGCCCACTGCCAAAGG + Intergenic
1136441945 16:30278259-30278281 CCCATACGGCCCACTGCCAAAGG + Intergenic
1138847821 16:60588229-60588251 CACAGAGGGCCCATTGGAGAAGG + Intergenic
1139841097 16:69881312-69881334 CACAGAGGGACCACTCAGAGAGG - Intronic
1141398140 16:83722903-83722925 CACTGAGGTCCCACTGAGGAAGG + Intronic
1142149668 16:88507078-88507100 CACGGAGGGCCCACTACCCAAGG + Intronic
1142619388 17:1155024-1155046 CAGAGAGGGCCCAGTGTGACTGG - Intronic
1143134517 17:4704079-4704101 CGCAGAGGGCCCACTCAGAACGG + Exonic
1143336473 17:6175285-6175307 CAGAGAGGGCCCGCTGGGAGTGG - Intergenic
1147191399 17:38740128-38740150 CACAGAGGGCCTACCTCGCAGGG - Intronic
1147820746 17:43240344-43240366 CGCAGAGCGCCCTCTGTGAAAGG - Intergenic
1147899122 17:43772409-43772431 CACACAGAGCCTACTGGGAAAGG + Intronic
1151837286 17:76590582-76590604 CACAGAGGGCCTACTTCTCATGG + Intergenic
1157549818 18:48573781-48573803 CAGTGATGGCACACTGCGAATGG - Intronic
1161115930 19:2496298-2496320 CACAGAGGGGACACTGGGATGGG + Intergenic
1163450080 19:17371928-17371950 CACCCAGGGCCAACTGCAAAAGG - Intronic
1164531912 19:29055303-29055325 CACAGAGGGTGCTCTGGGAAGGG + Intergenic
925748740 2:7068112-7068134 AATAGAGGGACCACTGCAAAGGG - Intronic
932218410 2:69982155-69982177 CACAGAGTGTCCACTTCAAAGGG - Intergenic
937362948 2:121241649-121241671 CCCAGAGATCCCACTGAGAATGG + Intronic
937909918 2:127070506-127070528 ACCAGAGGGCCCTCTGAGAAGGG + Intronic
940353166 2:152711418-152711440 TACAGAGGGTCGACTGCAAATGG + Intronic
947638602 2:231693486-231693508 GACTGAGGGCCCCCTGGGAAGGG + Intergenic
948440436 2:237983787-237983809 CACAGAGGGTCCAAGGGGAAAGG - Intronic
948465310 2:238149242-238149264 CACAGAGGGCCCACTGCGAAGGG + Intronic
948465323 2:238149286-238149308 CACAGAGGGCCCACAGTGAAGGG + Intronic
948465351 2:238149374-238149396 CACAGAGGGCCCACAATGAAGGG + Intronic
1168790390 20:572234-572256 CTCAGAGGGCCCAGTGCAAAGGG - Intergenic
1176078445 20:63259821-63259843 CCCAGAGCTCCCACTGGGAAAGG - Intronic
1178225197 21:30708625-30708647 CACAGAGGTCCCACTGAGGATGG - Intergenic
1180022251 21:45135866-45135888 CACAGAGGACCCACCGGGGAGGG - Intronic
1180821542 22:18832349-18832371 CTCAGAGGGCTCACGGAGAAGGG + Intergenic
1180842837 22:18967292-18967314 CCAAGACGGGCCACTGCGAAAGG + Intergenic
1181191436 22:21143696-21143718 CTCAGAGGGCTCACGGAGAAGGG - Intergenic
1181207762 22:21266814-21266836 CTCAGAGGGCTCACGGAGAAGGG + Intergenic
1203219158 22_KI270731v1_random:28602-28624 CTCAGAGGGCTCACGGAGAAGGG - Intergenic
1203271667 22_KI270734v1_random:58225-58247 CTCAGAGGGCTCACGGAGAAGGG + Intergenic
949503157 3:4701382-4701404 CTCAAAGGGCCCAATGAGAACGG - Intronic
958568345 3:95845780-95845802 CACAAAGAGCCCAAGGCGAAGGG - Intergenic
961680352 3:128595856-128595878 CTCAGTGGGACCACTGGGAAGGG + Intergenic
962133736 3:132710475-132710497 CACAGAGGGGCGACTGTGACTGG - Intronic
975400667 4:73934724-73934746 CACAGAGGACCAACTACAAATGG + Intergenic
981742345 4:148015950-148015972 CACAGAGGACACACTGTGAATGG + Intronic
991970274 5:72134332-72134354 CAAGGAGGGCCCAGTGAGAAGGG + Intronic
1002712799 5:181205182-181205204 CGCCGAGGGCCCACTGGGAGAGG + Intronic
1007318288 6:41007716-41007738 CTCAGAGGGGCCTCTGAGAAGGG - Intergenic
1007673525 6:43576155-43576177 GACAGCGCGCCCGCTGCGAAGGG - Exonic
1012205695 6:96457924-96457946 CACAGAGGGCCCACTGATGCGGG + Intergenic
1017657684 6:156645660-156645682 CACAAAGGGCCCAACGAGAATGG - Intergenic
1020361021 7:7326780-7326802 CACAAAGAGCCCACTCCCAAGGG - Intergenic
1022200622 7:28113441-28113463 CACAGTCTGCCCACTACGAAAGG + Intronic
1031170380 7:118285867-118285889 CACAGAGTACCTCCTGCGAAGGG - Intergenic
1036684929 8:10903286-10903308 CTCAGAGGGCCATCAGCGAAGGG + Intronic
1040855812 8:51947055-51947077 CACAGAGGGCCCAGTTTGTAGGG - Intergenic
1047760328 8:127949701-127949723 CAGTGAGGGCCCAGTGAGAAAGG - Intergenic
1049286267 8:141776958-141776980 GACAGAGCCCCCACTGCGAGTGG + Intergenic
1049545405 8:143228494-143228516 CACCCAGGGCCCACTGGGAAAGG - Intergenic
1053278172 9:36798852-36798874 CACAGATGGCTCACTCAGAAGGG - Intergenic
1056057785 9:82845508-82845530 TAAAGAGGGCCCAATGGGAAAGG - Intergenic
1057269675 9:93643811-93643833 TACAGAGGGCCCACGGTGGAGGG - Intronic
1060138731 9:121184740-121184762 GACAAAGTGCCCACTGTGAAGGG + Intronic
1061413213 9:130432101-130432123 CCCAGAGTGCCCACTGCCCACGG - Intronic
1187111071 X:16301103-16301125 CACAGAAGGCTCACAGCTAATGG + Intergenic
1194429596 X:93784967-93784989 CACAGAGGCCACACTACGGAGGG + Intergenic
1198017067 X:132622040-132622062 CACAGAGGGCCCTCGGGGAATGG - Intergenic