ID: 948466290

View in Genome Browser
Species Human (GRCh38)
Location 2:238153306-238153328
Sequence CCTTCTCCCAAGACGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948466290_948466303 18 Left 948466290 2:238153306-238153328 CCCCACCCCGTCTTGGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 161
Right 948466303 2:238153347-238153369 TCCAGGGAGCTGCTGAGAGAGGG 0: 1
1: 1
2: 8
3: 34
4: 430
948466290_948466308 29 Left 948466290 2:238153306-238153328 CCCCACCCCGTCTTGGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 161
Right 948466308 2:238153358-238153380 GCTGAGAGAGGGCCTTGGCGGGG 0: 1
1: 0
2: 1
3: 21
4: 250
948466290_948466302 17 Left 948466290 2:238153306-238153328 CCCCACCCCGTCTTGGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 161
Right 948466302 2:238153346-238153368 CTCCAGGGAGCTGCTGAGAGAGG 0: 1
1: 0
2: 4
3: 37
4: 413
948466290_948466300 1 Left 948466290 2:238153306-238153328 CCCCACCCCGTCTTGGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 161
Right 948466300 2:238153330-238153352 AAAGGGCAGACGCAGACTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 167
948466290_948466305 24 Left 948466290 2:238153306-238153328 CCCCACCCCGTCTTGGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 161
Right 948466305 2:238153353-238153375 GAGCTGCTGAGAGAGGGCCTTGG 0: 1
1: 0
2: 2
3: 48
4: 426
948466290_948466309 30 Left 948466290 2:238153306-238153328 CCCCACCCCGTCTTGGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 161
Right 948466309 2:238153359-238153381 CTGAGAGAGGGCCTTGGCGGGGG 0: 1
1: 0
2: 2
3: 16
4: 212
948466290_948466307 28 Left 948466290 2:238153306-238153328 CCCCACCCCGTCTTGGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 161
Right 948466307 2:238153357-238153379 TGCTGAGAGAGGGCCTTGGCGGG 0: 1
1: 0
2: 1
3: 38
4: 397
948466290_948466301 2 Left 948466290 2:238153306-238153328 CCCCACCCCGTCTTGGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 161
Right 948466301 2:238153331-238153353 AAGGGCAGACGCAGACTCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 196
948466290_948466306 27 Left 948466290 2:238153306-238153328 CCCCACCCCGTCTTGGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 161
Right 948466306 2:238153356-238153378 CTGCTGAGAGAGGGCCTTGGCGG 0: 1
1: 0
2: 3
3: 46
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948466290 Original CRISPR CCTTCTCCCAAGACGGGGTG GGG (reversed) Intergenic
902467003 1:16624544-16624566 CCTTCTGCCAGGACTGGGTTAGG - Intergenic
902507595 1:16948232-16948254 CCTTCTGCCAGGACTGGGTTAGG + Intronic
903258499 1:22118444-22118466 CCTTCTCACAAGCCTGGGCGGGG + Exonic
904198623 1:28804563-28804585 CCTTATCCCCTGATGGGGTGGGG + Intergenic
904331075 1:29758137-29758159 CCTTCCCACAAGAGAGGGTGTGG - Intergenic
904408674 1:30311764-30311786 CCTTCTCCCCAGCAGTGGTGGGG - Intergenic
904679236 1:32217161-32217183 CCATCTCCCCAGAGTGGGTGAGG - Intronic
905447216 1:38035068-38035090 CCTACGCCCCACACGGGGTGAGG - Intergenic
906947968 1:50311559-50311581 CCTTCTCACAGGACTGGCTGAGG - Intergenic
909701940 1:78534960-78534982 GCTTCTCCCAAGTCAGGCTGTGG + Intronic
912537776 1:110388473-110388495 CCTTCTACCGATAAGGGGTGGGG - Intronic
915900989 1:159846701-159846723 GATACTCCCAAGACAGGGTGAGG + Intronic
916418950 1:164618338-164618360 CCTTCTCCCAGGCTGGGGTAAGG + Intronic
919809255 1:201398834-201398856 CCCCCTCCCAAGAGGGGCTGTGG + Intronic
920563110 1:206953197-206953219 GCTTCTCCCTAGCCAGGGTGTGG - Intergenic
922799543 1:228358936-228358958 CCATCTCCCAAAATGGGATGGGG - Intronic
923566180 1:235077560-235077582 CATTCTCCCAAGTCCGGGTGAGG + Intergenic
1063081435 10:2771116-2771138 CCTTCTCCCAAGCCTCGGTTTGG - Intergenic
1066381502 10:34905753-34905775 CCTTCTGCCAAGCTTGGGTGTGG + Intergenic
1066459134 10:35597886-35597908 CCTTTGCCCAAGACTGGGTTGGG - Intergenic
1070655274 10:78266994-78267016 CCTAGTCCCAGGGCGGGGTGGGG + Intergenic
1071479570 10:86054829-86054851 GCTTCTCCCATTAGGGGGTGGGG + Intronic
1072220927 10:93326969-93326991 ACTTCTCCCATGAAGAGGTGGGG + Intronic
1072438568 10:95435055-95435077 CCTTCTCCCAAGAGGCCCTGTGG - Intronic
1072462163 10:95629677-95629699 CCTTCTCCAAAGACAGTGAGGGG + Intronic
1073028957 10:100509384-100509406 CCTTCCCCGAAGACAGGATGTGG + Exonic
1073175550 10:101554516-101554538 CCTTCTGCAAATACTGGGTGTGG - Exonic
1073850441 10:107611206-107611228 CCTTTTCCCAAGACTTGGGGAGG + Intergenic
1074852855 10:117452811-117452833 GCTTCTCCCACAACTGGGTGTGG + Intergenic
1075518862 10:123132099-123132121 CCTTATCCATGGACGGGGTGGGG - Intergenic
1077525007 11:3058857-3058879 CCTTCTCCCAGGAAGGCATGTGG - Intergenic
1084376020 11:68778219-68778241 CCCTCTCCCAAGACTAGGTTAGG - Intronic
1090012916 11:123061542-123061564 CCATCTACCCAGACGGCGTGGGG + Intronic
1090662010 11:128889653-128889675 CCTTTTGCCATTACGGGGTGGGG - Intergenic
1091414690 12:271185-271207 TCTTCTCCCATGCCGGGCTGTGG + Intergenic
1091650053 12:2303036-2303058 CCTTCTCCCAGGACGGAGGCGGG + Intronic
1101969948 12:109305956-109305978 CCTTCTCCAAAAACAGGGCGGGG - Intronic
1102059738 12:109923522-109923544 CCTCCTCCCAAGGCGAGGAGAGG + Intronic
1104037274 12:125106270-125106292 CCTTTTCCCAAGATGGCTTGTGG + Intronic
1105616908 13:22027349-22027371 CTGTCACCCAAGACGGAGTGCGG - Intergenic
1110276713 13:73649164-73649186 ACTTCTTCCAAGACATGGTGGGG - Intergenic
1112423585 13:99276128-99276150 CCATCTGCCAAGATGGGGAGAGG + Intronic
1113292776 13:108924455-108924477 CATTCTGACAACACGGGGTGAGG - Intronic
1116560178 14:46368575-46368597 CCTTCCCCAAGGAAGGGGTGAGG - Intergenic
1119029473 14:71180584-71180606 CCTCCTCACAGGACGGTGTGAGG + Intergenic
1119294629 14:73522916-73522938 CCTTCTCTCAGGAGGTGGTGTGG - Exonic
1119480144 14:74953832-74953854 CTTTCTCCCAAGCCCAGGTGTGG - Intronic
1123151425 14:106185358-106185380 GATTCTCCCAAGGAGGGGTGTGG + Intergenic
1123195293 14:106610219-106610241 GATTCTCCCAAGGAGGGGTGTGG + Intergenic
1123399827 15:19973241-19973263 GATTCTCCCAAGGAGGGGTGTGG + Intergenic
1124177766 15:27442157-27442179 CCCTCTGCCAAGGCTGGGTGTGG - Intronic
1124200837 15:27677366-27677388 CCTCCTACCTAGACGGGGAGGGG + Intergenic
1127625798 15:60779028-60779050 CCTCCTCCCAACACTGTGTGAGG + Intronic
1127900686 15:63338808-63338830 CCTTCTCCCAAGGTGAGGAGAGG - Exonic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1131679911 15:94710498-94710520 CTTTCTCCCAGGCCGGAGTGCGG + Intergenic
1132549682 16:549208-549230 CCTTCTCCAAGGCCGGGGTGGGG + Intronic
1133034480 16:3027264-3027286 CCTTCTACCAGGACCTGGTGAGG + Exonic
1134203249 16:12216271-12216293 GCTTCTCCCAAGACTGTTTGTGG - Intronic
1135992238 16:27225088-27225110 CTTTCTTCCAAGAAGGGCTGTGG + Exonic
1137854188 16:51777267-51777289 AGTTCTCCCCAGATGGGGTGTGG - Intergenic
1137872400 16:51962935-51962957 CCTCCACCCAAGACGCTGTGGGG - Intergenic
1139754710 16:69132796-69132818 CCTTGTCCCGAGGCGGGGTGGGG + Intronic
1139914865 16:70421685-70421707 CCTTGTCTCAAGGAGGGGTGGGG - Intronic
1140411522 16:74743795-74743817 GCTTCTGCCAAGGAGGGGTGTGG - Intronic
1140750349 16:78017919-78017941 CCTTCCCCAAAGACAAGGTGGGG + Intergenic
1141857768 16:86695876-86695898 CCTTGACCCAAGACAGGGGGAGG + Intergenic
1142003856 16:87679865-87679887 CCTCCTCCCAAGACCAGCTGGGG - Intronic
1143495954 17:7312704-7312726 CCCTCACCCACGATGGGGTGGGG + Exonic
1143582252 17:7834262-7834284 CCTTCTCCCAGGCCGGGGCTGGG - Intergenic
1147448967 17:40491942-40491964 CCTGTTCCAAAGATGGGGTGCGG + Intronic
1148674154 17:49435303-49435325 CCCTGTCCCTAGATGGGGTGGGG - Intronic
1149512586 17:57256136-57256158 TCTTCTCCCAGGTCCGGGTGAGG + Intronic
1149532017 17:57402965-57402987 CCCTCTCCCTAGGCAGGGTGGGG - Intronic
1150278977 17:63917983-63918005 CCTTCTCCCCAGGCGGGGATGGG - Intronic
1150808603 17:68338386-68338408 CCTCCTTCCAAGACTGGCTGTGG + Intronic
1150957563 17:69877273-69877295 CCTTCTGCCATGATGGTGTGAGG - Intergenic
1152344132 17:79741495-79741517 CCTTCTCCCAGGGCTGGGAGGGG - Intronic
1153051767 18:907512-907534 TCTTCTCCCAGGACTGGGGGTGG - Intronic
1155079323 18:22392097-22392119 CCTGCTCCCATGGCTGGGTGGGG + Intergenic
1157279388 18:46335634-46335656 TCCTCTACCAAGTCGGGGTGGGG + Intronic
1164936630 19:32219964-32219986 CCTTTTCCTAAGAAGGGGTAGGG + Intergenic
1165764884 19:38344123-38344145 CCCTTTCCCAAGACGGGGGCTGG + Intronic
1165780976 19:38434162-38434184 CCTGCTTCCAAGATGGTGTGAGG - Intronic
1166645682 19:44530023-44530045 CCTTCTCCCAAGACCACGTCAGG - Intergenic
925849821 2:8069243-8069265 CCTTCTCCCAGGCTGGAGTGCGG - Intergenic
927186889 2:20488387-20488409 ACTTCTCCCAAGTTGGGCTGAGG - Intergenic
927728195 2:25444653-25444675 ACTTCTCCCTAGATGGGGAGCGG - Intronic
930198993 2:48534775-48534797 CTGTCTCCTAAGAGGGGGTGAGG + Intronic
932494596 2:72140157-72140179 CCTTCTCCCAAGGCAGGGAGGGG - Intronic
935090708 2:99892537-99892559 CTGTCTCCCAGGATGGGGTGGGG + Intronic
935263579 2:101375692-101375714 CCCTACCCCAGGACGGGGTGGGG + Intronic
938128486 2:128691128-128691150 TCTTCTCCTAAGACGGCATGGGG + Intergenic
942220211 2:173761784-173761806 CCATCTCCCAGGCCGGAGTGCGG - Intergenic
942674734 2:178414752-178414774 CCTCTTCCTAAGACTGGGTGTGG + Intergenic
942850938 2:180484954-180484976 CCTTCACCCAGGACCAGGTGGGG + Intergenic
947105191 2:226661657-226661679 CCTTCTCCCAAGACACAATGTGG + Intergenic
948466290 2:238153306-238153328 CCTTCTCCCAAGACGGGGTGGGG - Intergenic
949078286 2:242075397-242075419 CCTTCTCCCAGGAGGAGGTGAGG - Intergenic
1169265039 20:4162257-4162279 CCAACTCCCAGGGCGGGGTGAGG + Intronic
1171810919 20:29743711-29743733 GCTTCCCCCTGGACGGGGTGAGG - Intergenic
1172905344 20:38364942-38364964 CTTTCTCCCATGGCTGGGTGTGG + Intronic
1173546322 20:43901010-43901032 CCATCTCCCAAGACTAAGTGAGG + Intergenic
1173550917 20:43932728-43932750 CCTTCACCCAACCCAGGGTGCGG - Intronic
1180342184 22:11628196-11628218 ACTTCCCCCTCGACGGGGTGAGG + Intergenic
1180623615 22:17179183-17179205 CCTTCTTCCAAGGCCAGGTGAGG + Exonic
1181553813 22:23656089-23656111 CCAGCTCAAAAGACGGGGTGGGG - Intergenic
1182054598 22:27340126-27340148 CCTTCTCCCATGCTGGGGTCAGG - Intergenic
1184189045 22:42882751-42882773 CCCACCACCAAGACGGGGTGGGG + Intronic
1185234641 22:49704868-49704890 CCCTCTCCCAGGACCGGGAGTGG - Intergenic
1185394222 22:50578492-50578514 CCTACTCCCAAATCGGGGTCGGG + Intronic
949865533 3:8543964-8543986 CAGTCTCCTAAGACGGGGTCAGG + Intronic
949914826 3:8951923-8951945 CGTCCTCCCATGAGGGGGTGAGG + Intronic
952032083 3:29155376-29155398 CCTTCTACCCAAAGGGGGTGGGG - Intergenic
953134267 3:40169222-40169244 CCATCTCCCATGGCAGGGTGGGG - Intronic
953154722 3:40359312-40359334 CCTTCTCACAATCCAGGGTGGGG - Intergenic
953611413 3:44450520-44450542 CCTTCTCCCAGGACGAGTGGGGG - Exonic
953704172 3:45218879-45218901 CCTTGTCCCATCCCGGGGTGTGG + Intergenic
955546869 3:60040574-60040596 CCTTCTCCCAAGCCTGGTTCTGG + Intronic
961035791 3:123640647-123640669 CCTTCTCCCATGTCGGAGGGTGG - Intronic
962900130 3:139754605-139754627 CCTCTCCCCAAGAAGGGGTGAGG - Intergenic
968056017 3:195692406-195692428 CCTTGTCCCAAGACAGGAGGGGG + Intergenic
969289547 4:6229937-6229959 ACCTCTCCCAAGCCGGGGTCTGG + Intergenic
980700870 4:136428518-136428540 CCATCTCCCCAGAGGGGTTGAGG - Intergenic
984029990 4:174591885-174591907 CATTCTACTAAGAAGGGGTGGGG - Intergenic
985521580 5:376253-376275 CTTTGTCCCAAGACTGGGTGGGG + Intronic
994565179 5:101435982-101436004 CCTTCTCCTGAGACTGTGTGCGG - Intergenic
997253347 5:132408532-132408554 CCTTCTCCCTAGATGGGGCCTGG - Intergenic
999880828 5:155861961-155861983 CCTTCTCCTAAGAGAGGATGGGG - Intergenic
1006628300 6:35413122-35413144 CCTGGTCCCAAGAAGGGGTGTGG - Intronic
1006739401 6:36296679-36296701 CTTTCTCCCAACAAGGGGGGTGG + Intronic
1006948014 6:37798427-37798449 CCGTGTCCCAGGACGGGGTCAGG - Intergenic
1008580235 6:52900297-52900319 CATTCTCCCAAGCCAGAGTGAGG + Intronic
1014450780 6:121578981-121579003 GCTTCTCCCAAGGCAGGGTCAGG - Intergenic
1016872971 6:148837299-148837321 CTTTGTCCCAGGAAGGGGTGAGG - Intronic
1019437590 7:1030016-1030038 CCTTCTCTGAAAGCGGGGTGCGG - Intronic
1022533934 7:31084265-31084287 CCTGCTCCCCAGAGGTGGTGAGG + Intronic
1023830796 7:44038039-44038061 TCTTCTCCCAGGAAGGGCTGAGG - Intergenic
1023909212 7:44541695-44541717 CCTGGTCCCAAGAGGGGGTAGGG - Intergenic
1023931498 7:44709099-44709121 CCTTCTCCCCTGAGGGGATGGGG + Intergenic
1026829627 7:73602950-73602972 ACTTCTCTCAAGGCAGGGTGGGG - Intronic
1028758275 7:94463524-94463546 TTTTCTCCCAAGACTGGGTGTGG - Intergenic
1029366415 7:100119351-100119373 CCTGCTCCCACGAGGGGGCGGGG - Intronic
1029741134 7:102492355-102492377 TCTTCTCCCAGGAAGGGCTGAGG - Intronic
1029759126 7:102591525-102591547 TCTTCTCCCAGGAAGGGCTGAGG - Intronic
1030156442 7:106460380-106460402 GTTTCTCCCAAGACAGAGTGGGG - Intergenic
1032018710 7:128394963-128394985 ACTTCTTCTCAGACGGGGTGCGG - Exonic
1032839642 7:135703884-135703906 CCTTCTTCCCAAACTGGGTGAGG + Intronic
1032844198 7:135738746-135738768 CCTGCTCCCCAGAGGGGCTGTGG - Intronic
1037556172 8:20024831-20024853 TATTCACCCAAGACTGGGTGCGG - Intergenic
1038522086 8:28242524-28242546 TCTTCCCCCAAGACAGGGTCTGG - Intergenic
1038685945 8:29718684-29718706 GCATCTCCCAAGATGGGGTTGGG + Intergenic
1045023659 8:98065091-98065113 CCTTCTACCAAGGCTGGGGGCGG + Intronic
1045290321 8:100827326-100827348 GCTTCTCCAAAGACGGAGTTTGG + Intergenic
1046726078 8:117675352-117675374 TCTTCTCCCTAGACGGTGTTTGG - Intergenic
1049683282 8:143929278-143929300 CCTTCTGCAAAGACAGGGAGTGG + Exonic
1051174630 9:14349493-14349515 GCTGCTCCCAAAACGGAGTGGGG - Intronic
1054775624 9:69121560-69121582 ACTTCACCCAAGCCGGAGTGCGG - Intronic
1055894285 9:81157682-81157704 CCTTCCCACAAGATGGGGAGTGG - Intergenic
1056623548 9:88235388-88235410 CCTTCTCCCAAGACAGTGTCTGG + Intergenic
1058120021 9:101127850-101127872 TCTTTTCCCAGGAAGGGGTGGGG + Intronic
1058485771 9:105442205-105442227 CCTTCTCCCAGGAAGAAGTGGGG + Intergenic
1059451399 9:114373272-114373294 CCTCCTCCGAAGACGGGGTGGGG + Intronic
1059942536 9:119371501-119371523 CAATCTCCCAAGATGGGTTGTGG + Intergenic
1060997383 9:127882864-127882886 CCCCCTCCCAAGGAGGGGTGGGG + Intergenic
1062370185 9:136234791-136234813 CTTGCTCCCAAGCTGGGGTGTGG - Intronic
1189280399 X:39816881-39816903 CCCTCTCCCAGAACGAGGTGAGG - Intergenic
1189686211 X:43565895-43565917 CCTTCTCCCAAGTTGGGGCAGGG - Intergenic
1197768288 X:130072948-130072970 CCTTCTCCCAAGGGGTGGTGTGG - Intronic
1199188209 X:144940342-144940364 CAGGCTCCCAAGACAGGGTGGGG + Intergenic
1200120006 X:153785756-153785778 CCTTCTCCCTAGACTTGGCGTGG - Exonic
1200384372 X:155874912-155874934 CCTCCTCCCAAGATGGGGACAGG - Intergenic
1201076893 Y:10195930-10195952 GCTTCCCCCTCGACGGGGTGAGG + Intergenic