ID: 948466552

View in Genome Browser
Species Human (GRCh38)
Location 2:238154702-238154724
Sequence GGTGAATGACACGGCCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948466552_948466566 27 Left 948466552 2:238154702-238154724 CCTCCGGGGCCGTGTCATTCACC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 948466566 2:238154752-238154774 CAGCTGATCGGTCTGAAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 106
948466552_948466565 15 Left 948466552 2:238154702-238154724 CCTCCGGGGCCGTGTCATTCACC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 948466565 2:238154740-238154762 CCGGCGTGGTATCAGCTGATCGG 0: 1
1: 0
2: 0
3: 4
4: 23
948466552_948466555 -4 Left 948466552 2:238154702-238154724 CCTCCGGGGCCGTGTCATTCACC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 948466555 2:238154721-238154743 CACCGTCCCTCCCCAGTGCCCGG 0: 1
1: 0
2: 0
3: 35
4: 403
948466552_948466557 1 Left 948466552 2:238154702-238154724 CCTCCGGGGCCGTGTCATTCACC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 948466557 2:238154726-238154748 TCCCTCCCCAGTGCCCGGCGTGG 0: 1
1: 0
2: 1
3: 24
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948466552 Original CRISPR GGTGAATGACACGGCCCCGG AGG (reversed) Intergenic
908388292 1:63663005-63663027 GGTGAGTCACACGGACCTGGAGG - Intergenic
915475588 1:156150940-156150962 TGAAAATGACACGGCCCCTGTGG + Intronic
1064030990 10:11882747-11882769 GGTAAATGACAAGGCCAGGGAGG + Intergenic
1067944568 10:50682001-50682023 AGTGAATGACAGAGGCCCGGTGG + Intergenic
1069459407 10:68580408-68580430 GGTGAATGACTTGAGCCCGGAGG - Intronic
1069714971 10:70514790-70514812 GGTTAAGGACACGGGGCCGGAGG + Intronic
1070866072 10:79708872-79708894 AGTGAATGACAGAGGCCCGGTGG + Intronic
1070879865 10:79847003-79847025 AGTGAATGACAGAGGCCCGGTGG + Intronic
1071632975 10:87231093-87231115 AGTGAATGACAGAGGCCCGGTGG + Intronic
1071646424 10:87363311-87363333 AGTGAATGACAGAGGCCCGGTGG + Intronic
1071871104 10:89795618-89795640 GGCATATGACACGGCCCCAGGGG - Intergenic
1073266377 10:102230709-102230731 AGGGCAGGACACGGCCCCGGAGG + Exonic
1083622912 11:64057731-64057753 GGTGCCTGACATGGCCCAGGAGG + Intronic
1084089211 11:66869287-66869309 GGTGGATGACACAGCCTTGGCGG - Intronic
1086003164 11:82003755-82003777 GGTGAATGACACAGCTATGGAGG - Intergenic
1088165246 11:106927280-106927302 GGAGAATGGCACGAACCCGGGGG + Intronic
1089028835 11:115301301-115301323 TGTGTATGACACAGCCCGGGAGG + Intronic
1094836171 12:34323133-34323155 GGTGAGTGACACGACCACAGGGG - Intergenic
1104926310 12:132315820-132315842 TGTGAGTGACACGGCCTCAGGGG + Intronic
1106705543 13:32275295-32275317 GGAGAATGGCATGACCCCGGGGG + Intronic
1107447330 13:40480720-40480742 GGTTAAAGGCAGGGCCCCGGAGG - Intergenic
1108484315 13:50909601-50909623 GGTGAGTCCCCCGGCCCCGGGGG + Intergenic
1118604344 14:67491948-67491970 GGGGAAGGACAGGGCCCCGTGGG - Intronic
1119234630 14:73009235-73009257 GGTGAATAACAGAGCCCCAGAGG - Intronic
1122114806 14:99522331-99522353 GCTCAAAGGCACGGCCCCGGAGG + Intronic
1123030166 14:105447823-105447845 GGAGATTGACACAACCCCGGGGG - Intronic
1124237598 15:28003680-28003702 TGTCAATGACACGGCCCTCGGGG + Intronic
1124373536 15:29116535-29116557 GGAGAATGACATGAACCCGGGGG + Intronic
1125170174 15:36757799-36757821 GGTGAATGACTCAGGCCTGGTGG - Intronic
1127845452 15:62866521-62866543 GGGGAAGGACACGTCCCCCGGGG + Intergenic
1128343999 15:66842469-66842491 GGTGGATGACACAGGCCCGGCGG + Intergenic
1134127601 16:11627102-11627124 TGTGCATGACACAGCCCCTGGGG - Intronic
1136223780 16:28845418-28845440 GGAGATTGACAATGCCCCGGAGG - Exonic
1139930226 16:70520350-70520372 GGAGAATGACATGAACCCGGGGG + Intronic
1142629619 17:1216323-1216345 GGCAAATGACACAGCCCCTGTGG - Intronic
1148114810 17:45169389-45169411 GATGAATGACAGGGACCCGGAGG + Exonic
1152872775 17:82766855-82766877 GGGGAATGACACAGGCCCTGTGG - Intronic
1152895200 17:82906964-82906986 GGGGAATGACACAGGCCCTGTGG - Intronic
1153237191 18:2999512-2999534 GGAGAATGGCATGGCCCGGGAGG + Intronic
1161004921 19:1930273-1930295 GCGGAATGACACAGCCCCTGGGG - Intergenic
1161778873 19:6278813-6278835 GGTGAAAGAGACAGCCCCGCCGG + Intronic
1162765681 19:12918164-12918186 GGTGAATGAGAGGGACCCAGGGG + Intronic
1163302308 19:16455749-16455771 GGTGATTGACAAGTCCCCGGGGG - Intronic
1167258374 19:48443929-48443951 GAGGTATGACGCGGCCCCGGGGG + Exonic
927575537 2:24199192-24199214 GGGGAATGACACAGCCGCAGGGG - Intronic
927650461 2:24910085-24910107 GGTGAATGAAACAGCGCAGGTGG + Intronic
935218644 2:100993527-100993549 GGTGGGTGCCACGGCCCAGGGGG + Exonic
936370281 2:111897981-111898003 GGTGCGCGACACGGCCCTGGCGG - Intergenic
944194247 2:197035826-197035848 GGAGATTGACACGGCCTGGGTGG - Intronic
948466552 2:238154702-238154724 GGTGAATGACACGGCCCCGGAGG - Intergenic
1172385082 20:34528478-34528500 GGTGAATGACACGGGAACAGAGG - Intronic
1179826903 21:43971346-43971368 GGTGAATGACCCAGCCCAGGCGG - Intronic
1180663125 22:17486450-17486472 TGTGACTGACACGCCCCCAGTGG - Intronic
1181049996 22:20233914-20233936 GGTGACTGACACTGTCCCTGAGG - Intergenic
1182280343 22:29214720-29214742 GGTGAATGTCATGGCCCTAGGGG - Intronic
1185127929 22:49022098-49022120 AGTGACTGACACCTCCCCGGAGG + Intergenic
950232515 3:11288837-11288859 GGTGGTAGACACAGCCCCGGGGG + Intronic
954456216 3:50601136-50601158 GGTGGAGGACACGCCCCAGGGGG - Intergenic
961091806 3:124119173-124119195 GCTGACTGACAGGGCCCTGGGGG + Intronic
961259797 3:125593130-125593152 TGTGAATGCCAGGGCCGCGGCGG + Intronic
962309235 3:134313635-134313657 GGTGGAGGACAGGGCCCCGAGGG + Intergenic
975666054 4:76736080-76736102 GGTGAATGAAACGGCCCTTATGG + Intronic
977418359 4:96764164-96764186 GGTGACTGACAAGGCCCCCTGGG + Intergenic
983679766 4:170339839-170339861 GGTGAATGACACAGCAGTGGGGG + Intergenic
985737655 5:1594157-1594179 GGTGAAGGTCACGACCCCGCGGG - Intergenic
987113779 5:14711277-14711299 GGAGAATGAGTCGGCCACGGAGG - Exonic
987242201 5:16011488-16011510 GGAGAATGACATGGACCTGGGGG + Intergenic
992678482 5:79129474-79129496 GGTGAAAGACACCTCCCAGGAGG + Intronic
998295830 5:140967837-140967859 CGTGAATGACAATGCCCCAGAGG + Exonic
1002910488 6:1487507-1487529 GGTGAATGACACGTCTGAGGAGG + Intergenic
1006491576 6:34392511-34392533 GGGGAATGAGGCGGCCGCGGCGG - Exonic
1011450296 6:87484489-87484511 GGTGAATGACACAGCAGCAGGGG - Intronic
1011570612 6:88730383-88730405 GGTGAATGACACAGCAGCAGGGG + Intronic
1024594357 7:50919298-50919320 GGTCAATGACAAAGCCCCAGGGG + Intergenic
1026918625 7:74138910-74138932 GGAGAATGACATGAACCCGGGGG - Intergenic
1035602268 8:903654-903676 GGTGAATGGCACGGCCATGGAGG + Intergenic
1035727016 8:1831032-1831054 GGTGAATGCCAGGGCAGCGGGGG + Intronic
1036635674 8:10548332-10548354 GGTGACAGACACAGCCCTGGAGG + Intronic
1037311161 8:17558251-17558273 GGTGAAGTAAACGGCCCAGGAGG - Intronic
1049189571 8:141279280-141279302 GGTGAAGGAAACGGCTCTGGAGG + Intronic
1049300191 8:141865657-141865679 GGTGCATGCCACGGCCTGGGGGG - Intergenic
1049745530 8:144261668-144261690 GCTGAAGGACCCGGCCCCCGAGG + Exonic
1057354402 9:94322134-94322156 AGTGAATGACAGAGGCCCGGTGG - Intronic
1057653360 9:96935501-96935523 AGTGAATGACAGAGGCCCGGTGG + Intronic
1060529438 9:124339795-124339817 GGTGAAGGACAGGGCCCTGGTGG - Intronic
1061285626 9:129620697-129620719 GGTGAACGCCACCGGCCCGGCGG + Exonic
1061587923 9:131580241-131580263 CGTGAGTGCCACTGCCCCGGGGG - Exonic
1062011937 9:134272103-134272125 GCTGAGAGACACGGCCACGGTGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic