ID: 948466865

View in Genome Browser
Species Human (GRCh38)
Location 2:238156482-238156504
Sequence CCCCACGCCGGCTCTGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948466861_948466865 2 Left 948466861 2:238156457-238156479 CCAGTGGGCAGGAGGGCCTCTGC No data
Right 948466865 2:238156482-238156504 CCCCACGCCGGCTCTGCCCATGG 0: 1
1: 0
2: 2
3: 32
4: 259
948466860_948466865 7 Left 948466860 2:238156452-238156474 CCTGTCCAGTGGGCAGGAGGGCC No data
Right 948466865 2:238156482-238156504 CCCCACGCCGGCTCTGCCCATGG 0: 1
1: 0
2: 2
3: 32
4: 259
948466854_948466865 21 Left 948466854 2:238156438-238156460 CCGTGAAGATGTAACCTGTCCAG No data
Right 948466865 2:238156482-238156504 CCCCACGCCGGCTCTGCCCATGG 0: 1
1: 0
2: 2
3: 32
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948466865 Original CRISPR CCCCACGCCGGCTCTGCCCA TGG Intergenic
900162868 1:1232562-1232584 GCCCAGGCCGGCCGTGCCCACGG - Exonic
900215944 1:1481781-1481803 CCACAGGCCGGCCCTGCCCATGG - Intronic
900223082 1:1519835-1519857 CCACAGGCCGGCCCTGCCCATGG - Intronic
900427736 1:2588129-2588151 CCCCAGGCTGGGTGTGCCCAGGG - Intronic
900555166 1:3276675-3276697 CCCCTCGCTGGCTCTGTTCACGG - Intronic
900555171 1:3276700-3276722 CCCCTCGCTGGCTCTGTTCACGG - Intronic
900604263 1:3516815-3516837 CCCAAGGCTGGCTCTGCCCCAGG - Intronic
901035510 1:6333810-6333832 CCCCACGCAGCCTCTCTCCATGG - Intronic
901204117 1:7484157-7484179 ACCCACACCGGGTCTGCCCTGGG - Intronic
901798123 1:11692042-11692064 CTCCTCGCCGCGTCTGCCCACGG + Intronic
901887793 1:12235647-12235669 GACCATGACGGCTCTGCCCATGG - Intronic
902408219 1:16198150-16198172 ACCCACTCAGGCTCTGACCAGGG + Exonic
902689787 1:18103419-18103441 CCCCAGGCAGGCCCTGCCCCAGG - Intergenic
905273437 1:36801834-36801856 CCCCACCCCAGCTGTGCCTAGGG + Exonic
905416718 1:37808744-37808766 CCCCACCCCAGCCCAGCCCAGGG - Intronic
905626442 1:39492797-39492819 CCCCACCCAGGCTCCGCACAGGG - Intronic
905789840 1:40784075-40784097 CCCCAGCCCGGCGCCGCCCATGG + Exonic
908019601 1:59886432-59886454 CCCCACGCTGGCTGTGCCACAGG - Intergenic
912473026 1:109918689-109918711 CCTCAAACCTGCTCTGCCCATGG - Intronic
915601239 1:156924356-156924378 CCCCACGCCGGGCCGGCCCACGG - Intronic
917433989 1:175000272-175000294 CCGCAGGGCGGCTCAGCCCACGG - Intronic
917447516 1:175119171-175119193 CCTCAGGGCTGCTCTGCCCATGG - Intronic
922176654 1:223202637-223202659 CCCCATCCCTGCTCTGCCCAGGG - Intergenic
922765630 1:228155257-228155279 CCCCTCGTGTGCTCTGCCCACGG - Intronic
1062957882 10:1552185-1552207 CCCCAGGCCAGCTCCCCCCATGG - Intronic
1065078172 10:22101735-22101757 CCCCAAGCAAGCCCTGCCCATGG - Intergenic
1067116182 10:43437092-43437114 CCCCTCGGCGGCCCCGCCCAGGG + Intronic
1067575571 10:47406390-47406412 CTGCCCGCAGGCTCTGCCCATGG + Intergenic
1067753320 10:48985884-48985906 CCCCAGGCAGGCTGTGCCCCTGG - Intergenic
1069158103 10:65054080-65054102 CCCCAGACTGGCCCTGCCCACGG - Intergenic
1069788641 10:71005499-71005521 ACCCACCCTGGCTCTGCCCTGGG - Intergenic
1069914118 10:71776742-71776764 CCTCACTGCGGTTCTGCCCATGG - Intronic
1070623718 10:78033797-78033819 CCCCACGCCGGCTCTTCCCGGGG + Exonic
1071255441 10:83868109-83868131 CCCCACTCCCACTCTCCCCATGG + Intergenic
1072188176 10:93061395-93061417 CTCCACCCTGCCTCTGCCCAAGG + Exonic
1073439478 10:103544143-103544165 CCCTCCCCTGGCTCTGCCCATGG - Intronic
1073622809 10:105066485-105066507 CCCCACACCAGCTCTGCTCCTGG - Intronic
1074780108 10:116796478-116796500 CCCCACGCTGTCCCTGCCCCAGG + Intergenic
1076358617 10:129870651-129870673 ACCCCCGCCGGCTCTCCCCAGGG + Intronic
1076683514 10:132186872-132186894 CCCCACCCCGGCTCCGCCCCCGG - Intergenic
1076695629 10:132246034-132246056 CCCCACCCCGACACTGCCCAGGG + Intronic
1076737854 10:132466764-132466786 CTCCACGCCGCCTCCTCCCAAGG + Intergenic
1076737861 10:132466780-132466802 CCCAAGGCAGGCTCTGCCCCTGG + Intergenic
1076855737 10:133114912-133114934 CCCGAGGCTGGCACTGCCCAGGG - Intronic
1077102834 11:829775-829797 CCACATACCGGCACTGCCCAGGG + Intronic
1077333960 11:1995099-1995121 CCCCAGCCCCCCTCTGCCCAAGG + Intergenic
1077350346 11:2090332-2090354 CCCCATGCCCGCCCTCCCCATGG - Intergenic
1077369291 11:2174034-2174056 CCCCGCCCCAGCTCTGCCCAGGG + Intergenic
1078057377 11:8019155-8019177 ACCCCCTCCGGCTCTGCCAATGG - Intergenic
1078110114 11:8385467-8385489 TCCCTCCCCGGCTCTTCCCACGG + Intergenic
1078480836 11:11673804-11673826 GCCCACCCCAGCACTGCCCAGGG - Intergenic
1078631634 11:13009308-13009330 CGCCGCTCTGGCTCTGCCCAAGG - Intergenic
1081709837 11:45209541-45209563 CCCCACGCAGGCCCTGCTCTTGG + Intronic
1083193117 11:61066706-61066728 CCCCACCCCTGCTCTGGCCAGGG - Intergenic
1084120672 11:67067125-67067147 TCCCACGGCGGCTCTGCCTGAGG + Intronic
1086006802 11:82047458-82047480 CCCCACTGGGGCACTGCCCAGGG + Intergenic
1089254671 11:117187949-117187971 CCCCACCCCAGGTCTACCCATGG - Intronic
1089868431 11:121651825-121651847 CCCCAGGCCTGCTCTGACCCAGG - Intergenic
1090785399 11:130043797-130043819 CCCCAGGCTGGAGCTGCCCAAGG + Intergenic
1202816943 11_KI270721v1_random:50281-50303 CCCCAGCCCCCCTCTGCCCAAGG + Intergenic
1091634318 12:2185797-2185819 TCCCAGGCCGCTTCTGCCCAGGG - Intronic
1094567353 12:31611709-31611731 GCCCAGGCCTGCTCTTCCCAGGG - Intergenic
1094682682 12:32679682-32679704 CGCCGCGCCGGCTCCGCCCCTGG - Intronic
1095227070 12:39689983-39690005 CCCCATACCTGCTCTACCCAAGG - Intronic
1096099082 12:48957804-48957826 CCCGATGCTGGCTTTGCCCAAGG - Intergenic
1096243987 12:49974277-49974299 CCAGACGCGGGCTCTGCCCACGG - Intronic
1096509697 12:52120885-52120907 CCCCAGGGCTGCTCTGCCTATGG - Intergenic
1096583122 12:52601198-52601220 CCCCAGCCCGGCGCTGCCGAAGG + Exonic
1097188475 12:57208379-57208401 CCCCATGCTGCCTCTGCCCAGGG + Intronic
1097237537 12:57550253-57550275 CCCCACGCCGGCTACCACCATGG + Exonic
1100823919 12:98457131-98457153 GCCCACGCCTCCTCTGCCCGGGG + Intergenic
1101324903 12:103706823-103706845 CCCAATGCCAGCCCTGCCCAGGG + Exonic
1102034770 12:109764942-109764964 CCCCATCCCGACTCTGCCCGGGG - Intronic
1102711882 12:114935255-114935277 CTCCAGGCCTGCTCTGACCAGGG - Intergenic
1104974989 12:132548305-132548327 CCCCATGGCAGCCCTGCCCAGGG - Intronic
1106304182 13:28495315-28495337 CCCCACGCGCGCTCGGCCCCGGG - Intergenic
1114871280 14:26662125-26662147 CCCTACCCTAGCTCTGCCCAAGG + Intergenic
1115841271 14:37473278-37473300 CCTCAGGCTGCCTCTGCCCATGG - Intronic
1118406843 14:65432892-65432914 CCCCGAGACTGCTCTGCCCATGG + Intronic
1121410285 14:93744670-93744692 CCCCACGCCTTCTCTGCCAGTGG + Intronic
1122072762 14:99215155-99215177 CCCCACCCCTGCTCCGGCCAAGG + Intronic
1122602356 14:102928145-102928167 CCCGGCTCCGGCTCTGCCCCTGG + Intronic
1122786988 14:104168433-104168455 CCCCACGGCGGCCCTCCCTAGGG - Intronic
1122881021 14:104690424-104690446 CCCCACGCCTGTGCTCCCCAGGG - Intronic
1122977955 14:105178672-105178694 CCCACCGGGGGCTCTGCCCAGGG + Intronic
1123039164 14:105483382-105483404 CCCCATGCCAGGTCTGCCCAGGG + Intergenic
1124251154 15:28107119-28107141 CCTCACGCCGGCTGCGCCCCGGG - Intergenic
1124416830 15:29479248-29479270 CCCCGCTCCTGCTCTCCCCATGG + Intronic
1125051163 15:35299464-35299486 CCGCCCGCCGACTCTGCCCATGG + Intronic
1126103422 15:45133380-45133402 CACCACACCGACCCTGCCCAGGG + Intronic
1128154655 15:65385022-65385044 CCCCCGGCCGGCTCTGACCCGGG - Exonic
1129718418 15:77864951-77864973 CCCCACCCCTGCTCTGTGCAGGG + Intergenic
1132594507 16:742282-742304 GCCCAAGCAGGCTCAGCCCATGG + Intronic
1132639461 16:971054-971076 TCCCTGGCCGGCCCTGCCCACGG + Intronic
1132751049 16:1457891-1457913 CCCCAGGCTGGGTCTCCCCATGG + Intronic
1132861838 16:2075717-2075739 CAACACGGCTGCTCTGCCCACGG - Intronic
1132906323 16:2284566-2284588 GCCCCTGCCGGCTCTGCACAGGG + Intronic
1132938886 16:2497198-2497220 CTCCAGGCGGCCTCTGCCCATGG + Intronic
1133287106 16:4695615-4695637 CCCCAAGCTGGCTCTCCCCCAGG - Exonic
1135995499 16:27244694-27244716 CCCCAGGCCCGCTCTACCGAGGG + Intronic
1136419557 16:30123239-30123261 CCCCACGGCGGCCCCGCCCGAGG + Exonic
1136628945 16:31478010-31478032 CCCCGCGCTGGCTCTGTCCCCGG + Intergenic
1136787731 16:32945719-32945741 CCCCATGCCAGCCCAGCCCACGG - Intergenic
1136882050 16:33908070-33908092 CCCCATGCCAGCCCAGCCCACGG + Intergenic
1137618156 16:49858725-49858747 CCCCACGCCCCCGCGGCCCAGGG + Intergenic
1138348815 16:56335660-56335682 CCTCAGGGCTGCTCTGCCCAAGG - Intronic
1138658336 16:58503310-58503332 CCCGACCCCGGCACTGCCCCTGG - Intronic
1138693813 16:58792753-58792775 CCCCATGCCAGCCCTGCCCCAGG + Intergenic
1140221391 16:73047217-73047239 CCCCACCCCGCCCCTGCCCAAGG + Intronic
1140314465 16:73881483-73881505 CCCCCCCCCCACTCTGCCCATGG + Intergenic
1141143542 16:81513545-81513567 CTCCACGCCGGCTCAGCCCCAGG - Intronic
1141526258 16:84613978-84614000 CACCAAGATGGCTCTGCCCAGGG + Intronic
1141635796 16:85313211-85313233 CCCCACGCAGGTGCTGCCCCCGG - Intergenic
1142028804 16:87828351-87828373 CCCCACCCCGGGTCTACCTAGGG - Intergenic
1142068584 16:88076684-88076706 CCCCTCGCCGGCTCCGCCTACGG + Exonic
1142281488 16:89150501-89150523 CACCAGGCCGCCCCTGCCCAGGG + Intronic
1142850820 17:2703964-2703986 CTCCACGCTGGCTCTGCCCTTGG + Intronic
1143651359 17:8265887-8265909 CCCCGAGCCGGTGCTGCCCAGGG - Exonic
1144625758 17:16843721-16843743 CTCCAGGTCGGCTCTGGCCAGGG + Intergenic
1144826440 17:18108137-18108159 GCACAGGCAGGCTCTGCCCAGGG + Intergenic
1145259306 17:21345276-21345298 CCCCACTCTGGCTCTGCTCTTGG + Intergenic
1145317309 17:21742673-21742695 CCCCACTCTGGCTCTGCTCTTGG - Intergenic
1146162911 17:30569646-30569668 CTCCAGGTCGGCTCTGGCCAAGG + Intergenic
1147579913 17:41622412-41622434 CTCCAGGTCGGCTCTGGCCAGGG + Exonic
1148447250 17:47745105-47745127 CCCTATGCGGACTCTGCCCATGG + Exonic
1148790341 17:50169159-50169181 AGCCACGCCCGCTGTGCCCAGGG + Exonic
1151330033 17:73401210-73401232 CAACACGGCGGCTCTCCCCAGGG - Exonic
1151335315 17:73436202-73436224 CCCCATACCGGCTTTGCACATGG + Intronic
1151942585 17:77301918-77301940 CCCCATCCCTGCTCTGCCCAGGG + Intronic
1152742404 17:82024073-82024095 CACCAAGCCGGCTCTGCACGCGG - Intronic
1153934930 18:9913379-9913401 CCCCACGCCTGTTCTCCACAGGG + Intergenic
1154154907 18:11936519-11936541 GCCCAAGCCTGCTCTGCCCATGG - Intergenic
1155395982 18:25387328-25387350 CCCCACCCCATCTCTACCCATGG + Intergenic
1158875739 18:61733065-61733087 CCTCACCCCTGCTCTGGCCATGG + Intergenic
1159447209 18:68555761-68555783 CCTCACGACTGCTCTGCCTATGG - Intergenic
1160554737 18:79717870-79717892 CCCGATGCCGGTTCTTCCCAAGG + Exonic
1160584506 18:79904900-79904922 CCCCACCCAGGCTCTGCCTCTGG - Intronic
1160622710 18:80181788-80181810 CCCCACACATGCTCTGCACAGGG - Intronic
1160745624 19:709631-709653 CCCCACCCCCGCCCTTCCCAAGG + Intronic
1161007891 19:1945410-1945432 CCCCCTGCCAGCCCTGCCCAGGG + Intronic
1161345525 19:3767172-3767194 CCCGTCGCCGCCTCTGCCCGAGG + Intronic
1162372687 19:10288772-10288794 CCCCACCCCGCCCCTGCCCGTGG - Intergenic
1162909247 19:13840549-13840571 ACCCAGCCCTGCTCTGCCCAGGG + Intergenic
1163551787 19:17969550-17969572 CCCCACCCCCTCCCTGCCCAGGG + Intronic
1164615528 19:29665166-29665188 CCCCACCCCACCCCTGCCCAAGG + Exonic
1164696168 19:30246022-30246044 CTCCACGACGCCTCTGCCCAGGG - Intronic
1164841040 19:31392450-31392472 CCCAAGGCCGGTTCTGCCAAAGG - Intergenic
1165179694 19:33957044-33957066 GGCCACGCCAACTCTGCCCAAGG + Intergenic
1165942909 19:39424184-39424206 CACCACTCCAGCTTTGCCCAAGG + Exonic
1167557038 19:50203271-50203293 CCCCACGCCGGCCCTTACAAAGG + Intronic
1167719243 19:51167450-51167472 CCCCACGGCCCCTCTCCCCAGGG - Intergenic
925027853 2:623709-623731 ACCCACGCCGCCCCAGCCCATGG - Intergenic
925410199 2:3635349-3635371 CCCCCAGCCTGCTCTGCCCTTGG + Intronic
927658475 2:24971821-24971843 CCCCACTTCGGCGTTGCCCATGG + Exonic
931763476 2:65435803-65435825 CCCCACCCCGGCCCTTCCCGCGG + Intergenic
932432787 2:71685693-71685715 CCCCACGCTGGCCCTGCTCCCGG - Intronic
934518753 2:95006136-95006158 CTCCACCCCTTCTCTGCCCAGGG - Intergenic
934649574 2:96083321-96083343 CCCTACTCCAGCTCAGCCCAAGG + Intergenic
934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG + Intergenic
936500545 2:113062699-113062721 ACCCGAGCTGGCTCTGCCCAGGG - Exonic
937092501 2:119215867-119215889 ACCCAAGCTGGCTCTCCCCAAGG + Intergenic
937265794 2:120613982-120614004 CCTCACACCGCCTGTGCCCAGGG + Intergenic
937354763 2:121191253-121191275 GCCCACGCCCGCAATGCCCATGG - Intergenic
938132014 2:128724805-128724827 CTCCATGCCGGGCCTGCCCAGGG - Intergenic
941904558 2:170708173-170708195 CCCCACCTCGGCTCTGCGAATGG + Intergenic
944439384 2:199727047-199727069 CCCCACAGGGGCTCTGTCCAAGG + Intergenic
944516138 2:200513593-200513615 CCCAACTCCGGCTGAGCCCAGGG - Intronic
946310021 2:218878137-218878159 CCCCACCCTGGCCCTGCCCTGGG - Intergenic
948466865 2:238156482-238156504 CCCCACGCCGGCTCTGCCCATGG + Intergenic
948519347 2:238525550-238525572 TCCCACGCCGGTGCTGCCCTTGG + Intergenic
948922438 2:241072004-241072026 CCCCACCCCGACTGTGCACAAGG + Intronic
949032349 2:241803056-241803078 CCCTCCTCCTGCTCTGCCCACGG + Intronic
1169402265 20:5292930-5292952 TCTCACACCAGCTCTGCCCACGG + Intergenic
1169960549 20:11154652-11154674 CCCCACAATGGCTCTGCCCTGGG - Intergenic
1170824687 20:19783576-19783598 CCCGAAGCCGGCTCTGAACAAGG + Intergenic
1171848205 20:30290587-30290609 CCCCAGGCCGGCCCCGCCCCCGG - Intergenic
1172126213 20:32626791-32626813 CCCAAAGCCAGTTCTGCCCAAGG + Intergenic
1172144120 20:32744251-32744273 CCCCATGCCCTCTCTTCCCAGGG + Intergenic
1173256294 20:41396111-41396133 CCCCACTCCAGCTCTGACCCAGG - Intergenic
1173826011 20:46047976-46047998 CCCCACTCCTTCTCTGCCCTGGG - Exonic
1174239054 20:49118167-49118189 CCCCACGCTGGCCCTCCCCTTGG + Intronic
1175521471 20:59604996-59605018 CCCCGCGCCGGCCGGGCCCATGG + Exonic
1175833409 20:61979234-61979256 CCCCTCACGGGCTGTGCCCATGG + Intronic
1176124971 20:63471349-63471371 CCCCCCGCCAGCCCTGCCCCAGG + Intronic
1176131837 20:63499542-63499564 CCCCTCCCCGGCCCTGCTCATGG + Intergenic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
1176286632 21:5022281-5022303 CCCCACCCCTGCGCTTCCCAGGG + Intergenic
1176550180 21:8217405-8217427 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1176569108 21:8400443-8400465 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1176577022 21:8444675-8444697 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1177833884 21:26169937-26169959 CCCGACGCCGGCTCGGGCTAGGG + Intronic
1178115483 21:29412369-29412391 CTCCACGTGGGCTCTGCACAGGG + Intronic
1179870549 21:44241194-44241216 CCCCACCCCTGCGCTTCCCAGGG - Intergenic
1180023558 21:45145329-45145351 CCCCACTCAGGCTCTGTCCTGGG - Intronic
1180553224 22:16557546-16557568 CCCACAGCCAGCTCTGCCCAAGG - Intergenic
1182090476 22:27591279-27591301 CCCCTTGCCGGCTCTGCCCAGGG + Intergenic
1182359977 22:29740612-29740634 CCCCACTCCCGCTTAGCCCAGGG + Intronic
1182441747 22:30368678-30368700 CCCCAGGCCCTCTCTGCCCAAGG + Intronic
1183346947 22:37313226-37313248 ACCCACTCTGGCCCTGCCCATGG + Intronic
1183417171 22:37689093-37689115 CCCCACGCCCCTTCTTCCCAGGG - Intronic
1183428468 22:37751881-37751903 CCCCACTCCTGGGCTGCCCAGGG - Intronic
1183560790 22:38570711-38570733 CCCCCCGCCCCCGCTGCCCATGG + Intergenic
1183736643 22:39648276-39648298 CCGCATGCCGGGCCTGCCCACGG - Intronic
1184664342 22:45979231-45979253 CCGCACGCCGGCTCTCCCCGCGG - Intergenic
1184865480 22:47199692-47199714 CCACCCGCCGGCCCTGCCCCCGG + Intergenic
1184893525 22:47393728-47393750 CCCCACCCCTCCTCTGTCCAAGG + Intergenic
1185063061 22:48617039-48617061 CCACACGCTGGGTCTGCACAGGG - Intronic
1185272368 22:49935293-49935315 CCCCAAGCCCGCTCTGCGCAGGG - Intergenic
1185386255 22:50532428-50532450 CCCCACGCAGGCCCTTCCCGGGG - Intronic
1203255075 22_KI270733v1_random:133743-133765 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1203263131 22_KI270733v1_random:178822-178844 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
950495541 3:13331894-13331916 CCCCACCCCAGACCTGCCCAGGG - Intronic
950554524 3:13687217-13687239 CCCCTGGCAGCCTCTGCCCAGGG + Intergenic
950577036 3:13838137-13838159 CCCCCCACCTGCTCTGCCCAGGG - Intronic
953901216 3:46845299-46845321 CCGCACCCCAGCCCTGCCCAGGG - Intergenic
954870205 3:53761977-53761999 GCCCTCGCCTGCTCTGTCCAGGG + Exonic
955071281 3:55574511-55574533 CCCCATCCCAGCTCTTCCCAAGG - Intronic
968473433 4:792120-792142 CCCCACGACCCCTCGGCCCAGGG + Intronic
968595077 4:1478035-1478057 CCCCACCCTGGCTGTGCCCAGGG - Intergenic
969633379 4:8351340-8351362 GCCCAGGCCGGCTCTGCTCTCGG - Intergenic
971207342 4:24583869-24583891 CCCCACCCAGGCCCTCCCCACGG + Intronic
974108795 4:57501961-57501983 GACCACGCCGGCTCTGCCGGTGG + Intergenic
982202754 4:152975468-152975490 CCCCAGGGCATCTCTGCCCATGG - Exonic
984443369 4:179801940-179801962 CCCCACCACTGCTCTGCCCGAGG + Intergenic
985840924 5:2305227-2305249 CCCCCCGCCAGCTCTTCCTAGGG + Intergenic
985856085 5:2428772-2428794 CCCTTCGCCGGCTGTTCCCAAGG + Intergenic
986024481 5:3837849-3837871 GCCCCAGCCTGCTCTGCCCATGG - Intergenic
997203487 5:132027001-132027023 CCCCACCCCAGCCCTTCCCAAGG + Intergenic
1001542706 5:172550572-172550594 CCTGAGGCCGGCTCTGCCCTTGG + Intergenic
1004216654 6:13710822-13710844 GCCCTCGCGGGCTCTGCCCTCGG - Intronic
1007119344 6:39367310-39367332 CCCCACGGGGACTCTGGCCAGGG + Intronic
1010124539 6:72416782-72416804 CCCCACCCCTCCGCTGCCCATGG + Intergenic
1013349303 6:109290984-109291006 CCCCACGCCGCCTCTGCTCCAGG - Intergenic
1014091976 6:117414195-117414217 CCCAACTCCAACTCTGCCCAGGG + Intronic
1014130296 6:117823383-117823405 TCCCAGGCTGGCTCTGCCCTTGG + Intergenic
1018567781 6:165174026-165174048 CTCCACTTCTGCTCTGCCCATGG + Intergenic
1019384317 7:746223-746245 CCCCCCGCCTGCCGTGCCCAGGG + Intronic
1019447381 7:1078474-1078496 CCCCAGCCAGGCTCTGCACAAGG + Intronic
1019492371 7:1321427-1321449 CCCCAGGCCGGCTCCCCCCAGGG - Intergenic
1019570163 7:1707587-1707609 GCCCACACCCGCTCTGCCCCAGG - Intronic
1019637953 7:2086477-2086499 CCACACACGGCCTCTGCCCATGG + Intronic
1020007965 7:4792313-4792335 CCCCACTCTGGCTCCGCCCCCGG + Intronic
1029449665 7:100633639-100633661 CCCCTCGCCGCCCCTGCCCCTGG - Intronic
1029496383 7:100897212-100897234 CCCCACGCCCGCTCGCCCCACGG + Intergenic
1031995439 7:128227404-128227426 CCGCACTCCTGCTCTGCCCAGGG + Intergenic
1033206443 7:139427167-139427189 CCCTACTCGGCCTCTGCCCAGGG - Intergenic
1034267052 7:149786144-149786166 CACGACGCAGGCTCAGCCCAGGG - Intergenic
1035221937 7:157411260-157411282 CCCCACGCCCGCTCAGTGCAGGG - Intronic
1035221961 7:157411335-157411357 CCCCACGCCCGCTCAGTGCAGGG - Intronic
1035221972 7:157411372-157411394 CCCCACGCCCGCTCAGTGCAGGG - Intronic
1035671727 8:1423280-1423302 CCCCAGGCCTGCTCAGTCCATGG + Intergenic
1036752995 8:11455024-11455046 CCTGACACCGGCTCTGACCAAGG - Intronic
1036827133 8:11986314-11986336 CCCCGCCCCGGCCCTGGCCAAGG - Intergenic
1037646323 8:20795888-20795910 CCCCACGCCTCTTCTGCCCCAGG - Intergenic
1038347024 8:26742021-26742043 GCCCACGCCTGCTCTGACCAAGG - Intergenic
1039864780 8:41490981-41491003 CCCCACGCCTGCTCTGGCGAGGG + Intronic
1040323170 8:46328614-46328636 CCCCACCCTGGGGCTGCCCAGGG + Intergenic
1049024602 8:139979924-139979946 CCACATTCCCGCTCTGCCCATGG + Intronic
1049439723 8:142603794-142603816 CCCCACCCTGCCTCTTCCCAAGG - Intergenic
1049446922 8:142635454-142635476 CCCCAGGCTGGCTCCTCCCAGGG + Intergenic
1049465457 8:142749355-142749377 CCCAGCGCCGGCTCCTCCCAAGG - Intergenic
1049613711 8:143567421-143567443 CCCCAAGCCGGCTGTGGCCGCGG - Exonic
1049618374 8:143586541-143586563 CCCCGGGCCGGGTCTGCTCAGGG - Intronic
1049814728 8:144592860-144592882 CCGCAGGCTGGCTCTGCACAGGG + Intronic
1049830682 8:144699377-144699399 CCCCACACCGGCCCGCCCCAAGG - Intergenic
1053288900 9:36867175-36867197 CCCCACACCCGCAGTGCCCATGG + Intronic
1057138948 9:92715294-92715316 GGCCACGCCGGGTCTGCTCATGG + Exonic
1057824512 9:98361660-98361682 CCCGACACTGGCTCTGCCCACGG - Intronic
1059176687 9:112175024-112175046 CACCGCGCCGGCCCGGCCCAGGG + Intronic
1059435532 9:114273775-114273797 CTCCACACCTGCTCTGCTCACGG + Intronic
1060826750 9:126692120-126692142 CTCCACGCAGGCCCTGGCCATGG - Intronic
1060979514 9:127784597-127784619 TCCCCCTCCAGCTCTGCCCAAGG - Intergenic
1061202097 9:129143801-129143823 CTCCACTCCGACTCTGCCCTGGG + Intronic
1061302657 9:129714562-129714584 TCCCAAGTCAGCTCTGCCCAGGG - Intronic
1062049083 9:134437980-134438002 CCTCCCGCAGGCTCTGCCCCCGG + Intronic
1062084429 9:134641576-134641598 CCCCACGTCCGCTCCGCCCCGGG + Intergenic
1062121177 9:134834892-134834914 CCCCACGTCCGCACTGCCCTGGG - Intronic
1062283962 9:135764910-135764932 CCCCCGGCCGGCCCTGCCCCAGG + Intronic
1062288720 9:135785239-135785261 CCCCACGCCGCCTCAGCCTGGGG - Intronic
1062335048 9:136061301-136061323 CCCACAGCAGGCTCTGCCCATGG + Intronic
1062522299 9:136963389-136963411 CCCCACGGGGACTCTGCCCTGGG + Intergenic
1062733466 9:138121650-138121672 CCCCAGGCCGGCTCAGCCGTGGG + Exonic
1203471473 Un_GL000220v1:116880-116902 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1203479294 Un_GL000220v1:160852-160874 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG + Intronic
1189025347 X:37388372-37388394 CCCCATGTGGGCTCTGCCCCTGG + Intronic
1189054532 X:37685597-37685619 CCCTACGACGGCTCAGGCCATGG - Intronic
1190720552 X:53143944-53143966 CCCCACACCGTGTCTTCCCATGG - Intergenic
1192822022 X:74656177-74656199 CACCACTCCTGCTCTGCCAAAGG - Intergenic
1192967568 X:76195465-76195487 CCCCACTGCGGCACTGCCTAGGG - Intergenic
1196881398 X:120201041-120201063 CCTCATGCTGCCTCTGCCCAAGG - Intergenic
1197493973 X:127154257-127154279 CCCAACCCAGGCTCTGCTCAAGG + Intergenic
1197769838 X:130082896-130082918 GCCCACCCCGGCACTGCCAAGGG - Intronic
1200159664 X:153999792-153999814 CCCCACGCCGGCTCGGACTTCGG + Intergenic