ID: 948467506

View in Genome Browser
Species Human (GRCh38)
Location 2:238159250-238159272
Sequence CCTCCCGCCGCCCCGAGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948467506_948467514 13 Left 948467506 2:238159250-238159272 CCCCGGCTCGGGGCGGCGGGAGG 0: 1
1: 0
2: 4
3: 39
4: 286
Right 948467514 2:238159286-238159308 CGAGCCCGCCCTCACCCCCGAGG 0: 1
1: 0
2: 0
3: 18
4: 177
948467506_948467515 14 Left 948467506 2:238159250-238159272 CCCCGGCTCGGGGCGGCGGGAGG 0: 1
1: 0
2: 4
3: 39
4: 286
Right 948467515 2:238159287-238159309 GAGCCCGCCCTCACCCCCGAGGG 0: 1
1: 0
2: 0
3: 12
4: 117
948467506_948467524 30 Left 948467506 2:238159250-238159272 CCCCGGCTCGGGGCGGCGGGAGG 0: 1
1: 0
2: 4
3: 39
4: 286
Right 948467524 2:238159303-238159325 CCGAGGGCTGCTGCATCGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948467506 Original CRISPR CCTCCCGCCGCCCCGAGCCG GGG (reversed) Intronic