ID: 948468994

View in Genome Browser
Species Human (GRCh38)
Location 2:238165492-238165514
Sequence CCCAGCAAAGTGCCTGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 334}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948468994_948468998 -2 Left 948468994 2:238165492-238165514 CCAGGGTCAGGCACTTTGCTGGG 0: 1
1: 0
2: 7
3: 39
4: 334
Right 948468998 2:238165513-238165535 GGCATGTGTTGGCTGCTGGCAGG 0: 1
1: 0
2: 4
3: 25
4: 276
948468994_948469000 22 Left 948468994 2:238165492-238165514 CCAGGGTCAGGCACTTTGCTGGG 0: 1
1: 0
2: 7
3: 39
4: 334
Right 948469000 2:238165537-238165559 TTGTGTGTCGTAGGTGAAGTTGG 0: 1
1: 1
2: 0
3: 8
4: 104
948468994_948469002 26 Left 948468994 2:238165492-238165514 CCAGGGTCAGGCACTTTGCTGGG 0: 1
1: 0
2: 7
3: 39
4: 334
Right 948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 63
948468994_948468999 13 Left 948468994 2:238165492-238165514 CCAGGGTCAGGCACTTTGCTGGG 0: 1
1: 0
2: 7
3: 39
4: 334
Right 948468999 2:238165528-238165550 CTGGCAGGATTGTGTGTCGTAGG 0: 1
1: 0
2: 0
3: 15
4: 97
948468994_948469001 25 Left 948468994 2:238165492-238165514 CCAGGGTCAGGCACTTTGCTGGG 0: 1
1: 0
2: 7
3: 39
4: 334
Right 948469001 2:238165540-238165562 TGTGTCGTAGGTGAAGTTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 117
948468994_948468997 -6 Left 948468994 2:238165492-238165514 CCAGGGTCAGGCACTTTGCTGGG 0: 1
1: 0
2: 7
3: 39
4: 334
Right 948468997 2:238165509-238165531 GCTGGGCATGTGTTGGCTGCTGG 0: 1
1: 0
2: 3
3: 28
4: 300
948468994_948469003 27 Left 948468994 2:238165492-238165514 CCAGGGTCAGGCACTTTGCTGGG 0: 1
1: 0
2: 7
3: 39
4: 334
Right 948469003 2:238165542-238165564 TGTCGTAGGTGAAGTTGGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948468994 Original CRISPR CCCAGCAAAGTGCCTGACCC TGG (reversed) Intronic
900510972 1:3060986-3061008 CTCAGCACAGTCCCTGCCCCAGG + Intergenic
900963811 1:5943682-5943704 CCCAGCAATGTGCTTTTCCCTGG - Intronic
901061300 1:6473210-6473232 GCCAGCCAGCTGCCTGACCCTGG + Intronic
901138011 1:7010055-7010077 CCCTGGCAAGTGCCTGAGCCTGG - Intronic
901208048 1:7508579-7508601 CCCAGCACTGTGCCTGGCTCAGG + Intronic
901534439 1:9873097-9873119 CTCAGCAATGTGCCAGAGCCCGG + Intronic
901876606 1:12170227-12170249 CCCAGCCCAGTGCCTGGCTCTGG + Intronic
902546031 1:17190855-17190877 CCCAGGAAGGCTCCTGACCCCGG + Intergenic
902913274 1:19617446-19617468 ACCAGGAAAGTGCCAGACCAAGG - Intronic
903002019 1:20273329-20273351 CTCAGCAAGCTGCCTGGCCCAGG + Intergenic
903065720 1:20698190-20698212 CACAGCAAAGAGTCTGAGCCAGG - Intronic
903355693 1:22746082-22746104 CCTGGCAAAATGCCTGGCCCAGG - Intronic
903577686 1:24348976-24348998 CTCAGCCCAGTGCCTGTCCCAGG - Intronic
903660249 1:24972743-24972765 GCCAGCAAATTCGCTGACCCAGG + Intergenic
904410710 1:30323126-30323148 CCTAGCACAGAGCCTGACCCTGG - Intergenic
904469211 1:30725638-30725660 CCCAGCATGGTGCCTGGCACAGG + Intergenic
904867181 1:33589339-33589361 CCTGACACAGTGCCTGACCCAGG - Intronic
905669163 1:39779729-39779751 CCCAGCATGGTGCCTGACACAGG - Intronic
906316004 1:44786769-44786791 CCCAGCAAAGGGCCTGGTCCAGG + Intronic
906328195 1:44861981-44862003 CCCAGTAAAGTCCTTGATCCTGG - Intronic
906638148 1:47424210-47424232 AGCTGCAAAGTGACTGACCCAGG + Intergenic
906655841 1:47547947-47547969 ACCAGCTCTGTGCCTGACCCAGG - Intergenic
907048828 1:51316170-51316192 CCCAGCACACTGCCGGGCCCAGG + Intronic
907280138 1:53341960-53341982 CCAAGCACAGGGCCAGACCCAGG - Intergenic
907507242 1:54928600-54928622 CCCAGCACAGTGACTGGCACAGG + Intergenic
908423914 1:63986566-63986588 CCCAGCAAAGGTTCTAACCCAGG + Intronic
908767071 1:67563841-67563863 CCTAGCAGAGTGCCTGATACAGG + Intergenic
909881274 1:80881901-80881923 CCTAGCATAGTGCCTGACTTAGG + Intergenic
909881971 1:80891171-80891193 CCCAGCACAGTGGCTTACACTGG + Intergenic
910239771 1:85073979-85074001 CCCAGCACAGTGCCTGCAGCAGG + Intronic
910786759 1:91007327-91007349 CCCAGCAAATCGCTTGAACCTGG - Intronic
912387689 1:109280405-109280427 CCCAGGAAAGTGGCAGTCCCAGG - Exonic
912507205 1:110164526-110164548 CCCAGCCCAGTGCCTCAGCCTGG + Intronic
913168002 1:116206736-116206758 CCTAGCACAATGCCTGACACAGG + Intergenic
915213799 1:154327484-154327506 CCCAGAAGGGTGGCTGACCCAGG + Intronic
915281938 1:154828967-154828989 CCCAGCACAGTGCCTGGGCATGG - Intronic
915327556 1:155088502-155088524 CTGAGCCAAGTGCCTGGCCCAGG + Intergenic
915452081 1:156012859-156012881 CCCTGCAATGTGCCAGACTCTGG - Intronic
918301694 1:183210014-183210036 CCTAGAAAAGTGCCTGGCCCAGG - Intronic
920397586 1:205658390-205658412 CCCCCCAAAATGCCTAACCCAGG - Exonic
921243003 1:213206399-213206421 CCTAACACAGTGCCTGCCCCAGG - Intronic
921803394 1:219427833-219427855 CCCAGCAAAGTTTGTGACCCAGG + Intergenic
921940815 1:220837521-220837543 CACAGCACAGTGCATGATCCTGG + Intergenic
922548063 1:226473402-226473424 CCAAGCACAGTGCCTGACATTGG - Intergenic
923836411 1:237615974-237615996 CCCAGCAAAGGTCCTGAGGCAGG + Intronic
924422614 1:243923777-243923799 CCCCACCCAGTGCCTGACCCTGG - Intergenic
924899371 1:248379375-248379397 CCCAGAAAATAGCCTGACTCAGG - Intergenic
1063936341 10:11082444-11082466 CCTAGCACAGTGCCTCACCCAGG - Intronic
1064745659 10:18475743-18475765 CTCAGCACAGTGCCTGGCACAGG - Intronic
1065421546 10:25550277-25550299 CCTAGCACAGTGCCTGGCTCAGG + Intronic
1065826823 10:29579970-29579992 ACCAGGATAGTGCCTGACCTAGG + Intronic
1066662610 10:37751809-37751831 CCCAGCAATGAGCGTGGCCCGGG - Intergenic
1067217439 10:44314928-44314950 CTCAGCAAAGTGCCTGGCACAGG + Intergenic
1067550012 10:47227547-47227569 CCCAGCACACGGCCTGGCCCCGG - Intergenic
1069736782 10:70661799-70661821 TCCAGCACCGTGCCTGCCCCGGG + Intergenic
1069920227 10:71811831-71811853 CCCAGTGAAGGGCCTGAGCCAGG - Intronic
1070668947 10:78364634-78364656 CTCAGGACAGTGCCTGACACTGG + Intergenic
1071276690 10:84061968-84061990 TCCAGCAAAGTGAATTACCCTGG + Intergenic
1071492679 10:86146682-86146704 CCAAGCATAGGGCCTGGCCCAGG - Intronic
1072295415 10:94004750-94004772 GCCAGCATAATGCCTGACACAGG - Intronic
1072440347 10:95448587-95448609 CCCAGGAAAGTGCTTGGCCCAGG + Intronic
1073582600 10:104681741-104681763 CCCAGTAAAGCTCCTGCCCCAGG + Intronic
1075725019 10:124606662-124606684 CCCAAAAAAGTGCATGGCCCAGG - Intronic
1076173612 10:128345507-128345529 CCCAGCAATGTGGATGAGCCTGG + Intergenic
1076227910 10:128795027-128795049 CCCAGCAAAGTGCCAGGCAGAGG + Intergenic
1076415689 10:130286641-130286663 CCCAGAAAACTGTGTGACCCAGG - Intergenic
1076746727 10:132518261-132518283 CCCAGAACAGTGCCTGTCCAGGG - Intergenic
1077020054 11:413364-413386 CCAAGGAAAGTCCTTGACCCAGG + Intronic
1077120041 11:902986-903008 CCCAGCAAAGTGTCTGTCCCGGG + Exonic
1077355803 11:2116234-2116256 CCCAGCACAGTGGCTAACCTGGG + Intergenic
1078006086 11:7533418-7533440 CCCAGCAAAGAACCTGGCACAGG - Intronic
1078214697 11:9301657-9301679 CCCAGAAAACTGTCTGGCCCAGG + Intronic
1078570869 11:12456859-12456881 CACAGCACAGGGCCTGACCTGGG + Intronic
1080938436 11:36886550-36886572 CCCATTAGAGTGCCTGACCCTGG - Intergenic
1081701072 11:45153214-45153236 TCCAGCAAAGTGCCTTAGGCTGG + Intronic
1083722724 11:64611442-64611464 CCCAGCAAAGTGCCAGGCCCAGG + Intronic
1084267636 11:68013043-68013065 CCCAGCCCAGTGCCTGATTCAGG + Intronic
1084512382 11:69614276-69614298 CTCAGGTCAGTGCCTGACCCAGG + Intergenic
1084780945 11:71407831-71407853 CCCAGCACAGTGCCTGTCCCAGG - Intergenic
1085451152 11:76634384-76634406 CCCAGCACAGGGCCTGGCACAGG + Intergenic
1088824606 11:113483234-113483256 CCCAGCACAGAACCTGACACAGG + Intergenic
1089300402 11:117495302-117495324 CACAGCAAAGAGCTTGAGCCAGG - Intronic
1089372840 11:117973471-117973493 CTTAGCACAGTGCCTGACACAGG + Intergenic
1089403616 11:118180022-118180044 TCCAGCACAGTGCCTGGCTCAGG + Intergenic
1089659710 11:119977961-119977983 CCCAGCACAGAGCCTGGCCCAGG - Intergenic
1089661719 11:119990427-119990449 CCAGGCACTGTGCCTGACCCTGG - Intergenic
1090825220 11:130380457-130380479 CCCAGCAAAGTGCCTGTTTCTGG + Intergenic
1090874137 11:130773982-130774004 CCCAGAATAGTGCCTGGCACAGG + Intergenic
1091100195 11:132864883-132864905 CTCAGCATAGTGCCTGGCCCAGG - Intronic
1091832166 12:3557561-3557583 CTCAGAGAAGTGCTTGACCCGGG + Intronic
1092535131 12:9379853-9379875 CTCATCACAGTGCCTGGCCCGGG - Intergenic
1095545001 12:43356519-43356541 CACAGCAAAGTGGCTCACTCAGG - Exonic
1096617439 12:52841815-52841837 CACAGCAATGTGCCTTTCCCAGG - Intronic
1098498297 12:71162567-71162589 CCAAGCCAAGGACCTGACCCTGG - Intronic
1100212485 12:92411862-92411884 CCCAGATAAGTGCCAGACACAGG - Intergenic
1101332276 12:103766660-103766682 CCTAGCCCAGTGCCTGACACAGG + Exonic
1101561677 12:105863137-105863159 CCCAGCACAGTGCCTGGGTCTGG - Intergenic
1102408039 12:112691116-112691138 CGCAGGAAAGTGGCTGAACCCGG - Intronic
1104358714 12:128112141-128112163 CCCAGGGCAGTGCCTGCCCCAGG + Intergenic
1105356305 13:19663191-19663213 CCCAGCACAGTGCCTGGCAGTGG - Intronic
1106175267 13:27324965-27324987 TCCTTCAAAGTGCCTGTCCCTGG - Intergenic
1107410329 13:40152245-40152267 CCCAGCAAAGTTCCAGCCCTTGG - Intergenic
1108008554 13:45978291-45978313 CCTAGCAAAGTGCCTGACATGGG + Intronic
1108079021 13:46713728-46713750 CCCAGCCAAGGGCCTCAGCCCGG - Intronic
1110616467 13:77547570-77547592 CCCAGCATGGTACCTAACCCTGG - Intronic
1112548239 13:100392903-100392925 CCCAGGGAAGTGACTCACCCAGG + Intronic
1113472559 13:110557402-110557424 CCCAGCAATCTGCCTGACTGAGG - Intronic
1116029655 14:39555394-39555416 CCCAGCACAGTATCTGACACTGG - Intergenic
1117457190 14:55910355-55910377 CACAGCTCAGTGCCTGACACAGG - Intergenic
1119593199 14:75909419-75909441 CCCAGCAAAGGTTCTGACCTAGG + Intronic
1120109615 14:80538991-80539013 TCCACCAAAGTGCCTGACCCAGG + Intronic
1120781292 14:88488403-88488425 CCTGCCAAAGTGCTTGACCCAGG + Intronic
1120834280 14:89026758-89026780 GTCAGCGCAGTGCCTGACCCAGG + Intergenic
1123438082 15:20270225-20270247 CCCAGCACAGTGCCAGGCACAGG + Intergenic
1124186182 15:27531486-27531508 CCCAGCAGTGTGCCACACCCAGG + Intronic
1125002613 15:34786972-34786994 CCCAGGAAAGTGTCTGAGCCTGG - Intergenic
1125749532 15:42019337-42019359 CCCACCCAGGAGCCTGACCCTGG - Intronic
1128497790 15:68208107-68208129 CCCAGCAGAGCGCCAGAGCCTGG + Exonic
1129024379 15:72555772-72555794 CCTAGCAAAGTGCCTGGCGATGG + Intronic
1129450883 15:75650603-75650625 CCCAGCAGAGAGCCAGACTCAGG - Intronic
1129697401 15:77748451-77748473 CCCAGCACAGAGCCTGGCTCAGG + Intronic
1130353984 15:83113536-83113558 CCCAGCAAGGTACCTGGCACAGG - Intronic
1130917609 15:88318197-88318219 CCCAGCACAGGACCTGACCTGGG - Intergenic
1131428257 15:92365206-92365228 CTCTGCAAAGTGCCTGCCGCCGG + Intergenic
1132071454 15:98780196-98780218 CTTAGAAAAGTGCCTGACACAGG - Intronic
1132481811 16:170101-170123 CCCAGCTAATTGCCCCACCCAGG + Intergenic
1132482679 16:174358-174380 CCCAGCTAATTGCCCCACCCAGG + Intergenic
1132693630 16:1192608-1192630 CCCAGCCACTTGCCTGACCCTGG - Intronic
1134071863 16:11265240-11265262 CCCAGCATAGCGCCAGACACAGG - Intronic
1135060670 16:19268923-19268945 CCCTGCTAAGGGCATGACCCAGG + Intergenic
1135326245 16:21527502-21527524 CCCAGCCAAGTGCCTTCCTCTGG + Intergenic
1136103334 16:28011215-28011237 CTCAGCAAAGAGCCTGGGCCTGG + Intronic
1136846496 16:33580627-33580649 CCCAGCACAGTGCCAGGCACAGG - Intergenic
1137017649 16:35393341-35393363 CCCAGCTAAGTGAATGAGCCAGG + Intergenic
1137031936 16:35532197-35532219 CCCAGCTAAGTGAATGAGCCAGG + Intergenic
1138440898 16:57034415-57034437 CCTAGCACAGCACCTGACCCGGG - Intronic
1138588981 16:57989163-57989185 ACCAGCAAAGGGCCTGGCCCAGG - Intergenic
1138607568 16:58098745-58098767 CCCAGGACAGTGCCTGGCACAGG - Intergenic
1140454460 16:75096912-75096934 CCCAGCCAGGTGCCTGTCCTCGG - Intronic
1140736093 16:77899065-77899087 CTCAGCACAGTGCCTGGCTCTGG - Intronic
1140967448 16:79980627-79980649 CCCAGCAACATGCATAACCCAGG - Intergenic
1141203560 16:81915281-81915303 CCCAGAACAGTGCCTGGCACAGG - Intronic
1203108204 16_KI270728v1_random:1429281-1429303 CCCAGCACAGTGCCAGGCACAGG - Intergenic
1142636333 17:1260091-1260113 CCCAGCTCAGAGCCCGACCCTGG + Intergenic
1143056845 17:4169087-4169109 CCCATCAATGTGCAGGACCCAGG + Intronic
1143751576 17:9032112-9032134 CTCAGCAAAGTGCCTCACTGGGG - Intronic
1144703721 17:17354139-17354161 CCCACCAAAGTTCTTGACCGTGG - Intergenic
1145064858 17:19755497-19755519 CCCAGCTAAGTGGCAGACACTGG + Intergenic
1146322535 17:31858425-31858447 CCTAGCATAGTGCCTGGCACAGG - Intronic
1146423866 17:32716802-32716824 GCCAGCAAACTGCATGACCCTGG + Intronic
1146891805 17:36511227-36511249 CCCACCATAGGGCCTGGCCCTGG - Intronic
1146905695 17:36616504-36616526 CCATGCACAGTGCCTGACCCAGG - Intergenic
1147988067 17:44317913-44317935 CCCAGCACGGTGCCTGGCACAGG + Intronic
1148439687 17:47705395-47705417 CTCAGCAGAGTGCCTGGCCCCGG + Intronic
1148603353 17:48909897-48909919 CCTGGCACAGTGCCTGACACAGG + Intronic
1148798296 17:50208050-50208072 CCCAGCAGAGGGCCTGACGCAGG + Intergenic
1149406396 17:56356182-56356204 CTCAGAAAAGTGCCTGGCACAGG - Intronic
1150630387 17:66876421-66876443 CCAAGTCCAGTGCCTGACCCTGG + Intronic
1151284403 17:73099593-73099615 TCCAGCAAAGTGCACGACACAGG - Intergenic
1152207126 17:78980285-78980307 GCCAGCAACGTGCTAGACCCAGG - Intergenic
1152429930 17:80243176-80243198 GACAGCAAAGTGAGTGACCCAGG + Intronic
1156485873 18:37465318-37465340 CCCATCAGATTGCCTGGCCCTGG + Intronic
1156665946 18:39407139-39407161 CCCAGCATAGTGCCTGATACAGG + Intergenic
1159189913 18:65028031-65028053 TCCATCAAAGTGCCTGTCTCTGG + Intergenic
1160260854 18:77292930-77292952 CCCAGTACACTTCCTGACCCAGG - Intergenic
1160828006 19:1089697-1089719 CCCAGAGAAGAGCGTGACCCAGG - Intronic
1162043161 19:7982482-7982504 TCCAGCAGAGAGCCTAACCCAGG + Intronic
1162348673 19:10136072-10136094 CCAAGTACAGGGCCTGACCCAGG + Intronic
1162498351 19:11035979-11036001 CCATGCAAAGTGCCACACCCAGG + Intronic
1162874407 19:13610142-13610164 CCCAGCCAGGTGCCTGCGCCTGG + Intronic
1164435479 19:28224930-28224952 CCCAGCACAGTGCCCGCCACAGG - Intergenic
1165034051 19:33020126-33020148 CCCAGCACAGTGCCAGGCACAGG + Intronic
1165917647 19:39270409-39270431 GCCAACAATGTGACTGACCCTGG - Intergenic
1166214036 19:41324229-41324251 CCGAGCGAAGTGCCTGACACCGG + Exonic
1168314970 19:55481082-55481104 CCCTGCAAAGTGGGTGACCTGGG + Intronic
925437862 2:3856874-3856896 CCCAGCCAAGTGCCTGCCTGTGG - Intergenic
926197282 2:10771643-10771665 CCCAGCACAGAGCCTGGCCCTGG + Intronic
926210875 2:10868632-10868654 CCCAGCTAAGGGCCTGCCTCTGG + Intergenic
926305330 2:11633975-11633997 CCCAGCAGGGTGCCTGGCCCTGG + Intronic
926424887 2:12731635-12731657 CACAGCCAAGTGCAGGACCCAGG + Intronic
927254227 2:21026058-21026080 CCAAGCACAGTGCCTGATGCTGG - Intronic
928353152 2:30581603-30581625 CCCAGCAACATGGATGACCCTGG + Intronic
928389654 2:30899305-30899327 CCCAGCACTGTGGCTGACCCAGG + Intergenic
928413297 2:31070841-31070863 GCAAGCACAGTGCCTGTCCCTGG - Intronic
928641194 2:33301763-33301785 CCCTGCAAAGTGTCTTCCCCGGG + Intronic
932701887 2:73997732-73997754 CCCAGCAAAGAGCTAGTCCCAGG - Intronic
933567483 2:83968963-83968985 CCCAGCAAAGTCTCTGAACCAGG + Intergenic
936246729 2:110834955-110834977 CCCCACAAAGAGCCTGACCCAGG - Intronic
936475658 2:112837614-112837636 ACCAGCAAAGTGCCTGCTCCAGG + Intergenic
937048230 2:118864394-118864416 CCCAGCAAACTGGCTTCCCCGGG - Intergenic
937230888 2:120397562-120397584 CCCAGCTCGGTGCCTGACCTAGG + Intergenic
937247767 2:120504470-120504492 CCCAGCACAGGGCCTGGCGCAGG - Intergenic
937355252 2:121194446-121194468 CCCAACCCAGTGCCAGACCCTGG + Intergenic
938291911 2:130155026-130155048 CCCAGCTAAGGGCCTGGCCCTGG + Intronic
938325094 2:130393081-130393103 GCCAGCAAATTGCTTGAGCCTGG - Intergenic
938392697 2:130917470-130917492 CCCAGGAAGGTCCCTGAGCCAGG - Exonic
938464640 2:131517938-131517960 CCCAGCTAAGGGCCTGGCCCTGG - Intergenic
941235558 2:162968034-162968056 TTCAGCACATTGCCTGACCCTGG + Intergenic
942451678 2:176112282-176112304 TCCAGCAAAGCCCCTGACCTTGG + Intronic
942588026 2:177507723-177507745 CCAGGCAGAGTGCCTGACTCAGG - Intronic
944115828 2:196185118-196185140 CCCAACAAAGTGGCAGAACCAGG + Intergenic
946185309 2:217977589-217977611 CCCAGCCCAGTGCCTGGCACAGG - Intronic
947258126 2:228189131-228189153 CCCAGCAAAATGGCTGATCATGG - Intergenic
947856032 2:233325108-233325130 CCCAGCCAATTGCTTGAACCTGG + Intronic
948468994 2:238165492-238165514 CCCAGCAAAGTGCCTGACCCTGG - Intronic
948625601 2:239266188-239266210 CCCAGCACAGTGCCCGAGGCAGG + Intronic
1169264663 20:4160572-4160594 CCCAGCAAAGGGCCTGGCACAGG + Intronic
1169400876 20:5279215-5279237 CCCAGCAATTTGCCTCTCCCAGG + Intergenic
1170179230 20:13510784-13510806 CTCAGCACAGTACCTGACCATGG + Intronic
1170369088 20:15628721-15628743 CCCACCAAGGTGCCAGACCTGGG - Intronic
1172114087 20:32563364-32563386 CCTAGAATAGGGCCTGACCCAGG - Intronic
1172793170 20:37520167-37520189 TCCAGCAAGCTGCCTGGCCCAGG - Intronic
1172935133 20:38614883-38614905 CCCAGCAAGCTGCCTGCACCAGG + Intronic
1174300259 20:49576768-49576790 ATCAGCAAAATACCTGACCCAGG + Intergenic
1174396478 20:50250091-50250113 CCCAGCACAGAGCCTGGCACAGG - Intergenic
1174565454 20:51461442-51461464 CCCTGCAAAGTGACTTCCCCAGG + Intronic
1175199709 20:57268517-57268539 CCCAGCATGGTGCTTGGCCCTGG - Intergenic
1175400915 20:58699418-58699440 CCAAGCCCAGTGCCGGACCCTGG + Intronic
1175611496 20:60355152-60355174 CCCAGCAAAATGGGAGACCCTGG + Intergenic
1175770700 20:61622348-61622370 CTCAGCAAACTACCTGCCCCAGG - Intronic
1175828960 20:61951705-61951727 CCCACCACAGGGCCTCACCCTGG - Intergenic
1176215886 20:63947570-63947592 CCCAGCACAGTGCCTCGGCCTGG + Intronic
1176260460 20:64176804-64176826 CCCAGCACACTGCCTGCCCTGGG + Intronic
1176659303 21:9619091-9619113 CCCAACAAAGTGTGTGGCCCAGG - Intergenic
1178298361 21:31429707-31429729 GACTGCACAGTGCCTGACCCAGG - Intronic
1179180581 21:39041598-39041620 CACAGCACAGTGCCTGCCCGGGG + Intergenic
1179189828 21:39114394-39114416 CCCAGTGCAGTGCCTGGCCCGGG - Intergenic
1179259696 21:39746972-39746994 CCAAGCCAAGTGCCTGCCCTTGG - Intronic
1179928458 21:44551323-44551345 CCCAGCCCCCTGCCTGACCCTGG - Exonic
1180060397 21:45382079-45382101 CCCCACAAAGCGCCTGCCCCAGG + Intergenic
1180077593 21:45470901-45470923 CCCAGCCCAGGGCCAGACCCAGG - Intronic
1180159566 21:45992978-45993000 CCCAGCCATGTGCCTGATGCTGG + Intronic
1180189392 21:46155285-46155307 CCCTGGGGAGTGCCTGACCCAGG - Intronic
1181270760 22:21657402-21657424 CGCAGCCAAGAGCCCGACCCGGG + Intronic
1182920645 22:34076016-34076038 TCTGGCAAAGTGCGTGACCCTGG + Intergenic
1183332397 22:37228608-37228630 CCCAGCTCAGTGCCTGGCACAGG - Intronic
1183341497 22:37284289-37284311 CCCAGCCATGGGCCTAACCCTGG + Intronic
1183587256 22:38760062-38760084 CTCAGTACAGTGCCTGGCCCTGG + Intronic
1184252200 22:43267226-43267248 CCCAGCACAGGGCCTGGCACAGG + Intronic
1184445983 22:44547173-44547195 CTCAGCCAAGGGCCTGAGCCCGG - Intergenic
1184486914 22:44785289-44785311 GCCAGCAAAGTGCCACAACCTGG + Intronic
1184724287 22:46334533-46334555 CCCAGAAAAGCCCCTGGCCCAGG - Intronic
1185275354 22:49948244-49948266 CCCAGCCAGGTCCCAGACCCAGG + Intergenic
1185322958 22:50210328-50210350 CCCAGCAAAGTGCAGGCCCCAGG + Intronic
949233995 3:1786725-1786747 CCAAGCAAATTGCTTGAACCCGG - Intergenic
949466752 3:4352349-4352371 TCCAGTACAGTGCCTGGCCCTGG + Intronic
949481145 3:4494480-4494502 GGCAACAGAGTGCCTGACCCAGG + Exonic
950156597 3:10725644-10725666 CCCTGCACAGTTCCTCACCCTGG + Intergenic
950535009 3:13573520-13573542 CCCAGCAGAGACCCTGACCTTGG - Intronic
950563528 3:13749819-13749841 CACAGCACAGTGCCTGGCCGTGG - Intergenic
950627988 3:14262297-14262319 CCCAGCAGAGAGCATCACCCAGG + Intergenic
953371637 3:42393515-42393537 CGCAACAAAGTGAGTGACCCTGG - Intergenic
955225583 3:57057575-57057597 CCTAGCACAGGGCCTGGCCCAGG + Intronic
956047378 3:65210151-65210173 TCCAGCACAGTACCAGACCCAGG + Intergenic
956068858 3:65426243-65426265 CTCAGGAAACTGTCTGACCCTGG + Intronic
956792873 3:72693664-72693686 TCCAGCAAAGTGCTTGAGGCAGG - Intergenic
960527995 3:118732359-118732381 CCCACAAGAGTGCCTGACACTGG + Intergenic
961570957 3:127798505-127798527 CTCAGCAAAGGGCCTGTCCAAGG - Intronic
962282877 3:134065528-134065550 GCCCGCACAGTGCCTGGCCCTGG + Intronic
962806754 3:138932968-138932990 TCCAGGACAGTACCTGACCCAGG + Intergenic
962933568 3:140059339-140059361 CCCAGCACAGTTCCAGGCCCTGG - Intronic
962962335 3:140322061-140322083 CTGAGCAAGGTGCCTGTCCCAGG - Intronic
963273587 3:143308756-143308778 CTGAGCACAGTGCCTGGCCCAGG + Intronic
963644348 3:147895161-147895183 TCCATCAAAGTGCCTGTCTCTGG - Intergenic
964367690 3:155967279-155967301 GCCAGAAAAGTGCTTCACCCTGG - Intergenic
965727935 3:171739188-171739210 CCCAGCTAAGTGTCTTCCCCTGG - Intronic
965754905 3:172015814-172015836 CCCAGCACAGTGCTTGACACGGG + Intergenic
966635247 3:182125962-182125984 CCTTGCACAGTGCCTGACACTGG - Intergenic
966736888 3:183193940-183193962 CCTACAAAAGTGCCTGGCCCTGG + Intronic
966770372 3:183498716-183498738 CCTAGCACTGTGCCTGACCTCGG - Intronic
969306914 4:6331010-6331032 CCCAACACAGTGCTAGACCCTGG - Intronic
974393733 4:61308142-61308164 CCCAGAGAAGGGCCTCACCCTGG + Intronic
975269680 4:72417242-72417264 CCCAGATGAGTGCCTGACTCAGG + Intronic
975754430 4:77558755-77558777 CTCAACAAAGGCCCTGACCCTGG + Intronic
976195123 4:82524626-82524648 CCCAACAGAATACCTGACCCAGG - Intronic
977633311 4:99267827-99267849 CCCAGCTTAGTACCTGACCTAGG - Intergenic
977637907 4:99321935-99321957 CCCAGCTTAGTGCCTGACACAGG - Intergenic
977640508 4:99353319-99353341 CCCAGCTTAGTGCCTGACACAGG - Intergenic
983111683 4:163758168-163758190 CTCAGCCAAGTGACTGGCCCAGG - Intronic
984710400 4:182879745-182879767 CCTAGAACAGTGCCTGGCCCAGG - Intergenic
984715506 4:182920877-182920899 CCCAGCAAAGTGGCAGGCCAAGG + Intergenic
985416203 4:189738106-189738128 CCCAACAAAGTGTGTGGCCCAGG + Intergenic
985424308 4:189813359-189813381 CCCAGCACAGTGGCAGAGCCTGG + Intergenic
985475073 5:74279-74301 CCCAGCAAAGACCCTGGCCTGGG - Intergenic
986302213 5:6486655-6486677 ACCAGCACAGTTCCTGACACAGG + Intronic
986877954 5:12133326-12133348 CCCAGCAAAGTTTCTTAACCAGG + Intergenic
987310252 5:16674955-16674977 ACCAACAAAGTGCCCCACCCCGG - Exonic
987993686 5:25247986-25248008 CCTAGCAGAGTGTGTGACCCTGG + Intergenic
988683349 5:33503872-33503894 CCAAGCATAGAGCTTGACCCTGG + Intergenic
991233730 5:64368464-64368486 CCCAGCCAAGTGGCAGACCTAGG + Intronic
991462943 5:66878586-66878608 CCCAGCACAGTCCATGCCCCAGG - Intronic
991994805 5:72376397-72376419 CCCAGCATCTGGCCTGACCCAGG + Intergenic
995623178 5:114050289-114050311 CACAGCACAGTGTCTGGCCCTGG - Intergenic
995736659 5:115308268-115308290 CCCAGCAAAATGGCTGCCTCAGG - Intergenic
997377144 5:133405420-133405442 TCCAGCCAAGTGCCTGCCCATGG + Intronic
998142358 5:139707351-139707373 CAGAGCAAAGTGCCTGGCCCTGG + Intergenic
998251744 5:140558078-140558100 CCCAGCTTAGTGCCTGGCACAGG + Exonic
998457682 5:142286330-142286352 CCCAGCTAATTGCTTGAACCGGG - Intergenic
999161653 5:149505885-149505907 CCCAGAAAAGTGTCTTCCCCAGG - Intronic
999912427 5:156218156-156218178 CCCAGCAAATCGCTTGAACCTGG + Intronic
1001093068 5:168755914-168755936 ACCATCAAAATGCCTGGCCCTGG + Intronic
1001155939 5:169272538-169272560 CCCAGCACAGTGCCTTGCCCAGG + Intronic
1001297899 5:170511631-170511653 CCGAGCAAGGTGCCTGGCACTGG - Intronic
1001563044 5:172682667-172682689 CAGAGCACAGTGCCTGGCCCTGG - Intronic
1001892448 5:175350868-175350890 CCCAGCTAAGTCCCTACCCCAGG + Intergenic
1002644549 5:180646723-180646745 CCCAGCATAGTGCCTGTTCGGGG - Intronic
1004084496 6:12431792-12431814 CCAAGCAAAGAGTCTGGCCCCGG + Intergenic
1005214744 6:23511975-23511997 CTCAGCAAGCTGACTGACCCAGG + Intergenic
1006084752 6:31587811-31587833 CCCAGAACACTGCCTGGCCCTGG + Intronic
1006514464 6:34538260-34538282 CCCATCTGAGTGCCTGGCCCAGG - Exonic
1010729660 6:79377181-79377203 CCCAGCACAGTGCCTGACACAGG + Intergenic
1011764990 6:90610982-90611004 CCGAGCTAAGTGCCAGAGCCAGG + Intergenic
1012934080 6:105347334-105347356 CCCAACACAGTGCCTGGCACAGG + Intronic
1013020776 6:106215271-106215293 CCCAGTTAAGTGTCTAACCCAGG + Intronic
1014038707 6:116798787-116798809 ACCAGCAAAATGCTTGAACCTGG + Intronic
1015414580 6:132934062-132934084 CCCTGCATGGTGCCTGACACAGG + Intergenic
1016089935 6:139964559-139964581 CCCAGCAAAGTCTGTGATCCAGG + Intergenic
1018706568 6:166467858-166467880 CCCTGGAAAGTGCCTGAGACTGG + Intronic
1018923487 6:168191384-168191406 CCCTGCATGGAGCCTGACCCTGG - Intergenic
1019124134 6:169827984-169828006 CCCAGCTAAGACCCTGACGCAGG + Intergenic
1019541288 7:1552625-1552647 CCCAGCTAAGTGTCCAACCCGGG + Intronic
1019599129 7:1872717-1872739 CCCAGCACAGGGCCAGACACGGG + Intronic
1019621329 7:1993870-1993892 CCCAGCTGAATGCCTGGCCCTGG + Intronic
1019872328 7:3776067-3776089 CGCATCAAAGTGCCAGACACTGG + Intronic
1019919670 7:4155431-4155453 CCCGGCTCAGTGCCAGACCCAGG + Intronic
1022469104 7:30671020-30671042 CCCAGGTAACTGCCTGAACCAGG - Intronic
1022522597 7:31017685-31017707 CCCAGGAAAGACCCTCACCCAGG + Intergenic
1023120540 7:36904039-36904061 CCCTACACAGTGCCTGATCCAGG - Intronic
1023150207 7:37194963-37194985 CCCAGCACAGTTCCTGCCACTGG - Intronic
1027887762 7:83931273-83931295 CCCAGCCCAGTGCCTGACCCAGG - Intergenic
1028492716 7:91431383-91431405 CACAGCAACATGCATGACCCTGG - Intergenic
1029849501 7:103447251-103447273 CCCAGCCAAAGGCCTGGCCCAGG - Intergenic
1031987185 7:128170783-128170805 CCCTGCTAAGCACCTGACCCAGG - Intergenic
1032409417 7:131683643-131683665 CCCAGCAGAGCACCTGGCCCAGG - Intergenic
1033439206 7:141363502-141363524 CCCACCCATGAGCCTGACCCTGG - Intronic
1033508829 7:142034156-142034178 CCCACAAAAGTGCCTGCCCAGGG + Intronic
1033647195 7:143314719-143314741 CCCAGCAATGTGGGTGACCAAGG - Intergenic
1034536333 7:151728062-151728084 CCCAGCAGAGTGTTTGACCACGG + Intronic
1036218128 8:6897609-6897631 CCCAGCAATGTCCCTGAGCTGGG + Intergenic
1036926325 8:12909509-12909531 CCCAGCCCAGACCCTGACCCTGG - Intergenic
1037912731 8:22753715-22753737 CCCGGCAAAGCCCCAGACCCTGG - Intronic
1040039175 8:42898155-42898177 TCCAGCAAAGTGCCTTGCACAGG - Intronic
1043053733 8:75411309-75411331 CCTAGAAAAGTGCCTTCCCCAGG - Intronic
1043580356 8:81705117-81705139 CCGAGCAGGGAGCCTGACCCAGG - Intronic
1043740717 8:83808165-83808187 CCTAGGAGAGTGCCTGGCCCAGG + Intergenic
1046785469 8:118261011-118261033 TCTAACAAAGTGCCTGGCCCAGG + Intronic
1047819839 8:128506757-128506779 CCCAGCATAGTGCTTGGCACAGG + Intergenic
1048339584 8:133528387-133528409 CCTAGCACAGTGCCTGACACAGG - Intronic
1048658972 8:136574772-136574794 CCAAACAAAGTGTCTGATCCTGG + Intergenic
1048743894 8:137591958-137591980 CCCAGCCCAGTGCCTCCCCCAGG - Intergenic
1048831319 8:138480005-138480027 CCCTGCAAAGTGGCAGCCCCAGG - Intronic
1049240243 8:141534030-141534052 CCCAGCAAAGCACCTGAGCTTGG + Intergenic
1049427924 8:142545532-142545554 CCCAGAACTGTGCCTGCCCCAGG - Intergenic
1049725293 8:144142917-144142939 CCCAGCCAGCTGCCTGCCCCAGG - Intergenic
1050183009 9:2940811-2940833 CCCAGAACAGTGCCTGCCACAGG - Intergenic
1050235878 9:3579538-3579560 CACAGCATGCTGCCTGACCCAGG + Intergenic
1051369220 9:16344053-16344075 CCCAGCAAAGTGCTGGGGCCAGG - Intergenic
1053122192 9:35555640-35555662 CCGAGCAGAGAGCCTGGCCCGGG + Exonic
1053348428 9:37395318-37395340 CACTGCGAAGTGCCAGACCCTGG + Intergenic
1053469550 9:38336455-38336477 CCCTGCAAACTGACAGACCCAGG + Intergenic
1055003603 9:71481526-71481548 CCCAGCATGGTGCCTGCCACAGG - Intergenic
1055120360 9:72653263-72653285 CATAGCAATGTGCCTGACTCTGG - Intronic
1056096704 9:83261968-83261990 ACATGCAAAGTGCCTGACACTGG + Intronic
1057184935 9:93052177-93052199 CCCAGCCAAGTGCCTCTACCTGG + Intergenic
1057566206 9:96168155-96168177 CCCAGCACAGTGTCTGACACAGG + Intergenic
1058864691 9:109150835-109150857 CCCAGCATAGTGCTTGGCACTGG + Intronic
1058940983 9:109812387-109812409 CCCAGCAAAGAGACCAACCCAGG - Intronic
1059395892 9:114033823-114033845 CCCAGCCCAGTGCCTGGCACAGG - Intronic
1059773084 9:117446345-117446367 CCAAGCACAGTGCCTGTCACAGG + Intergenic
1060515928 9:124265862-124265884 CCCAGCACAATGCCTGACCCAGG - Intronic
1060522763 9:124303068-124303090 CCCAGCAAGGCACCTGATCCGGG + Intronic
1061396479 9:130346517-130346539 GCTGGCAAAGTGACTGACCCAGG + Intronic
1062346875 9:136119057-136119079 CCCAGCAGAGGGCTTGACCGTGG + Intergenic
1203636865 Un_KI270750v1:120934-120956 CCCAACAAAGTGTGTGGCCCAGG - Intergenic
1185632471 X:1525044-1525066 CCCTGCAAGGTGACAGACCCTGG - Intronic
1186444122 X:9611665-9611687 CCAAACAAAATGCCTGAGCCAGG - Intronic
1189246361 X:39566462-39566484 CCCAGCACAGTGCCAGGCACTGG + Intergenic
1190227917 X:48560253-48560275 CCCAGCCAAGTGGCAGACGCTGG + Exonic
1190780203 X:53586706-53586728 CCCAGAAGAGTGCCTGATTCAGG + Intronic
1194798335 X:98240351-98240373 CCCAGCACAGTGCTCGAACCCGG - Intergenic
1200162471 X:154016566-154016588 CCCGGCAAAGCGGCTGAACCGGG + Exonic