ID: 948469002

View in Genome Browser
Species Human (GRCh38)
Location 2:238165541-238165563
Sequence GTGTCGTAGGTGAAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948468994_948469002 26 Left 948468994 2:238165492-238165514 CCAGGGTCAGGCACTTTGCTGGG 0: 1
1: 0
2: 7
3: 39
4: 334
Right 948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948469002 Original CRISPR GTGTCGTAGGTGAAGTTGGT GGG Intronic
902064922 1:13677075-13677097 GTGTCGGAGGTAGAGCTGGTGGG - Intergenic
906967894 1:50477108-50477130 GTCACGCAGGTGAATTTGGTTGG + Intronic
908589563 1:65615283-65615305 CTGCCATAGGTGAAGTTGATTGG + Intronic
917805235 1:178607179-178607201 CTGTAGAAGGTGATGTTGGTTGG - Intergenic
923057582 1:230438775-230438797 GTTTTGTGAGTGAAGTTGGTGGG + Intergenic
1063090204 10:2858716-2858738 GTCTGGTAGGTGATGTTGGCAGG + Intergenic
1063506857 10:6607435-6607457 GTGTGGTATGTGAGGCTGGTGGG - Intergenic
1069940844 10:71954247-71954269 GTGTAGTGGGTGGTGTTGGTGGG + Intergenic
1073553479 10:104425718-104425740 GTGTCCTAGCTGAGGTTGGTTGG + Intronic
1076762357 10:132611861-132611883 GTGTGGGAGGTGAAGTGGGCAGG + Intronic
1078636531 11:13055473-13055495 GTTTGGGAGGTGAAGGTGGTGGG + Intergenic
1080376904 11:31723383-31723405 GTTTTGTAAGTGAAGTTTGTGGG - Intronic
1080680156 11:34468216-34468238 TTGTAGTAGGTGAATTTTGTTGG + Intronic
1086248306 11:84782421-84782443 GTGTGGTAGGGGTAGTTAGTGGG - Intronic
1087218686 11:95522353-95522375 ACGTGATAGGTGAAGTTGGTGGG - Intergenic
1104812216 12:131626240-131626262 GGGCCGTGGGTGAAGTTGGGGGG - Intergenic
1123215907 14:106809312-106809334 TTGTCCTAGATGAACTTGGTCGG + Intergenic
1123487170 15:20751745-20751767 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1123543660 15:21320800-21320822 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1124466991 15:29949031-29949053 GTGGCGGAGGTGATGGTGGTGGG - Intronic
1129301180 15:74626447-74626469 GGCTCCTTGGTGAAGTTGGTAGG + Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1202951977 15_KI270727v1_random:47926-47948 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1136873472 16:33828768-33828790 TTGTCCTAGATGAACTTGGTCGG - Intergenic
1139251611 16:65501900-65501922 GTGTCATGGTTGAAGGTGGTTGG - Intergenic
1141839545 16:86566005-86566027 GTTTCGAAGCTGAAGTTGGTAGG + Intergenic
1203098703 16_KI270728v1_random:1287287-1287309 TTGTCCTAGATGAACTTGGTCGG + Intergenic
1146924643 17:36735948-36735970 GTGTCGGAGGTGAGATTGGTGGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1150137142 17:62702244-62702266 GTGGAGGAGGTGGAGTTGGTGGG + Intronic
1151765407 17:76131081-76131103 GTGTCCTTAGTGCAGTTGGTGGG - Intergenic
1157353702 18:46914562-46914584 GTGTCGGGGGTGGAGTTGGGGGG - Intronic
1159557582 18:69961615-69961637 GAGTCGTGGGTGAAGTTTGCTGG - Intronic
1159974385 18:74692480-74692502 GATTCGTAGTTGAAGTAGGTAGG + Intronic
1163342674 19:16719699-16719721 GTCTAGGAGGTGCAGTTGGTTGG - Intergenic
1166345944 19:42165839-42165861 GAGTAGTAAGTGAAGGTGGTGGG + Intronic
1167711758 19:51115944-51115966 GTGTAGGAGGTGAAGTGGGGTGG - Intergenic
1168113909 19:54210129-54210151 GAGTCGTGGGTGAAGCTGATAGG + Intronic
930881555 2:56276434-56276456 GTGTCGTAGGAGGAACTGGTGGG + Intronic
937496713 2:122428206-122428228 GTGTGGAAGGTGGAGTTGCTGGG - Intergenic
939776348 2:146392498-146392520 GGGTCGCGGGTGAAGTTGGGGGG - Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1172460653 20:35115821-35115843 TTGTTGTGGATGAAGTTGGTTGG + Exonic
1172785339 20:37464801-37464823 GTGTCCTGGGTGAACTTTGTGGG - Intergenic
1173271618 20:41541614-41541636 GTGAGATAAGTGAAGTTGGTGGG + Intronic
1178140230 21:29674529-29674551 GTGTCGGGGGGGAACTTGGTGGG + Intronic
1178189002 21:30258549-30258571 GTGTCCTAGGTGGGGTTGGGAGG - Intergenic
953362485 3:42310087-42310109 GAGTCGTAGGTGAATTTGAAAGG - Intergenic
956547611 3:70422264-70422286 GAGGTGAAGGTGAAGTTGGTGGG - Intergenic
958049279 3:88323739-88323761 GTGTCGAAGGGGAACCTGGTGGG + Intergenic
964495356 3:157283543-157283565 GTGTTGATGGTGAAGTTGGTGGG + Intronic
995447775 5:112265570-112265592 ATGTCATAGATGAAGTGGGTTGG - Intronic
1000302076 5:159965463-159965485 GTGTGGTGGGTGAAGCTGCTGGG - Intronic
1006485533 6:34337986-34338008 GTGTGGTAGGGCCAGTTGGTGGG - Intronic
1008908312 6:56705306-56705328 GTGCCATGGGTGAAGTAGGTGGG - Intronic
1009751946 6:67886431-67886453 GAGTTGTAAGGGAAGTTGGTAGG + Intergenic
1015329556 6:131961649-131961671 GTGTTGGAGGTGGAGCTGGTGGG + Intergenic
1017077630 6:150633443-150633465 GAGTCGCAGGTGAAGCTGGTGGG + Intronic
1027331034 7:77093342-77093364 GTGGCTTGGGTGAAGTAGGTTGG - Intergenic
1028950042 7:96624402-96624424 GTGTAGTGGGTCAAGTGGGTCGG + Intronic
1029784740 7:102777986-102778008 GTGGCTTGGGTGAAGTAGGTTGG + Intronic
1032246325 7:130216885-130216907 ATGAACTAGGTGAAGTTGGTTGG + Intergenic
1033313664 7:140280673-140280695 GGGTTGCAGGTGAAGATGGTGGG - Intergenic
1038145636 8:24892847-24892869 GTCTGGTAGGTGAATCTGGTGGG + Intergenic
1041073273 8:54145845-54145867 CTGTTGTAGGTGAAGTAGGTAGG + Intronic
1051272092 9:15365532-15365554 GTGTCTGAGGTGAAGCTGGCTGG - Intergenic
1053385480 9:37683931-37683953 GTGAGGGAGATGAAGTTGGTGGG + Intronic
1185969601 X:4647811-4647833 GTGTAGTGGGAGGAGTTGGTGGG - Intergenic
1200432816 Y:3108367-3108389 GTGTCGTAGTCTAAGTTTGTAGG - Intergenic
1201157136 Y:11141387-11141409 GTGTGGTAGGTGGTGGTGGTTGG + Intergenic
1201274373 Y:12284603-12284625 GTGTAGTAGGTGATGTTGGAGGG + Intergenic