ID: 948469379

View in Genome Browser
Species Human (GRCh38)
Location 2:238167455-238167477
Sequence TCCCAGGTAGGGGCCCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 318}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948469379_948469392 6 Left 948469379 2:238167455-238167477 CCAGCCAGGGCCCCTACCTGGGA 0: 1
1: 0
2: 2
3: 47
4: 318
Right 948469392 2:238167484-238167506 CAGCTGACGCAGGGCTGAGGGGG 0: 1
1: 0
2: 2
3: 30
4: 320
948469379_948469388 -3 Left 948469379 2:238167455-238167477 CCAGCCAGGGCCCCTACCTGGGA 0: 1
1: 0
2: 2
3: 47
4: 318
Right 948469388 2:238167475-238167497 GGAGAGGGTCAGCTGACGCAGGG 0: 1
1: 0
2: 4
3: 13
4: 232
948469379_948469391 5 Left 948469379 2:238167455-238167477 CCAGCCAGGGCCCCTACCTGGGA 0: 1
1: 0
2: 2
3: 47
4: 318
Right 948469391 2:238167483-238167505 TCAGCTGACGCAGGGCTGAGGGG 0: 1
1: 0
2: 0
3: 19
4: 235
948469379_948469389 3 Left 948469379 2:238167455-238167477 CCAGCCAGGGCCCCTACCTGGGA 0: 1
1: 0
2: 2
3: 47
4: 318
Right 948469389 2:238167481-238167503 GGTCAGCTGACGCAGGGCTGAGG 0: 1
1: 0
2: 1
3: 28
4: 259
948469379_948469394 17 Left 948469379 2:238167455-238167477 CCAGCCAGGGCCCCTACCTGGGA 0: 1
1: 0
2: 2
3: 47
4: 318
Right 948469394 2:238167495-238167517 GGGCTGAGGGGGCTGCCACAGGG 0: 1
1: 0
2: 3
3: 34
4: 409
948469379_948469393 16 Left 948469379 2:238167455-238167477 CCAGCCAGGGCCCCTACCTGGGA 0: 1
1: 0
2: 2
3: 47
4: 318
Right 948469393 2:238167494-238167516 AGGGCTGAGGGGGCTGCCACAGG 0: 1
1: 0
2: 6
3: 47
4: 422
948469379_948469387 -4 Left 948469379 2:238167455-238167477 CCAGCCAGGGCCCCTACCTGGGA 0: 1
1: 0
2: 2
3: 47
4: 318
Right 948469387 2:238167474-238167496 GGGAGAGGGTCAGCTGACGCAGG 0: 1
1: 0
2: 0
3: 23
4: 205
948469379_948469390 4 Left 948469379 2:238167455-238167477 CCAGCCAGGGCCCCTACCTGGGA 0: 1
1: 0
2: 2
3: 47
4: 318
Right 948469390 2:238167482-238167504 GTCAGCTGACGCAGGGCTGAGGG 0: 1
1: 0
2: 1
3: 22
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948469379 Original CRISPR TCCCAGGTAGGGGCCCTGGC TGG (reversed) Intronic
900227753 1:1540773-1540795 TCCCGGGGAGGGGTCCCGGCCGG - Intergenic
900284937 1:1894540-1894562 CTCCAGGGATGGGCCCTGGCTGG - Intergenic
900396944 1:2456981-2457003 TGACAGGTAGGGGCCCTGGCTGG - Intronic
900429121 1:2593634-2593656 TGCCAGGCTGGGGCCCTGTCTGG - Intronic
900569048 1:3349414-3349436 TCCCAGCAAGTGGCCATGGCGGG + Intronic
900866941 1:5275611-5275633 TCCAAGGAAGGGCCCCAGGCAGG - Intergenic
901065111 1:6490687-6490709 TCCCAGGAAGGGCCCCGCGCCGG + Intronic
901534192 1:9871901-9871923 TCCCAGGGAGGGGCCCTGCTGGG - Intronic
901703680 1:11058909-11058931 GTCAAGGCAGGGGCCCTGGCAGG + Intronic
901840335 1:11950220-11950242 TCCCAGATGGTGGCCCAGGCTGG + Intronic
902198282 1:14814622-14814644 GGCCAGGTAGGAGCCCTTGCTGG - Intronic
903180642 1:21603302-21603324 TTCCGGGGAGGGGCCCTAGCTGG - Intronic
903641497 1:24863190-24863212 TCCTAGGTAGGGACCTTGGGAGG - Intergenic
903781668 1:25823942-25823964 TCCCATGTGGGGGACCTGTCAGG - Intronic
904811041 1:33163684-33163706 TCCTTGGTCGGCGCCCTGGCGGG - Intronic
906972641 1:50533131-50533153 TCCCACGTTGTTGCCCTGGCTGG + Intronic
909478403 1:76108411-76108433 ACCAAGCTAGGGGTCCTGGCTGG - Intronic
912928023 1:113930058-113930080 TCCCAGGCAGGGGCCCTTTGAGG - Intronic
912942308 1:114056117-114056139 ACACAGGTAGGAGCCCTGGATGG + Intergenic
915637941 1:157199437-157199459 GGCCAGGCAGGAGCCCTGGCTGG + Intergenic
916524072 1:165592777-165592799 TCCCTGGTAGGGGCCTAGGAGGG - Intergenic
918084219 1:181231517-181231539 GCCAAGGTCAGGGCCCTGGCTGG + Intergenic
920193668 1:204212035-204212057 TTCCAGGTAGAGGCCTGGGCTGG - Intronic
924775477 1:247112363-247112385 GCCGAGGTGGGGGCCCTTGCCGG - Exonic
1064393180 10:14959226-14959248 TCCCAGGTAGGAGCGCTGCCAGG - Intergenic
1064547578 10:16466183-16466205 TCCCAGGCAGGTGTCCAGGCAGG + Intronic
1066351659 10:34642110-34642132 ACCCAGGTATGGGCCCAGGGTGG - Intronic
1067525498 10:47036011-47036033 TCCCAGGTGTGGGGCCTGGCAGG + Intergenic
1067734373 10:48837864-48837886 TCCCAGGCAGTGGGCCAGGCAGG + Intronic
1070803317 10:79256043-79256065 GCCAAGGAAGGGGCCCTGGGGGG - Intronic
1071089560 10:81902576-81902598 TCCAAGATCGAGGCCCTGGCAGG - Intronic
1073403676 10:103278271-103278293 TACCAGGTAAGGGCCGGGGCTGG + Exonic
1075714592 10:124548696-124548718 GCCCAGGTAGAGACCCTTGCTGG + Intronic
1075731454 10:124639066-124639088 CCCCAGGAAGGGTCCCTGGTGGG - Intronic
1076114651 10:127886889-127886911 TCCCAGGGAAGGGCTCTAGCGGG + Intronic
1076715642 10:132362526-132362548 TCCCTGGGTGGGTCCCTGGCTGG + Intronic
1076889732 10:133277606-133277628 CCCCAGGGAGGGGTCCTGGGTGG - Intergenic
1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG + Intergenic
1077899580 11:6478024-6478046 TGCCAGGTGTGGGCACTGGCAGG - Exonic
1077917636 11:6621749-6621771 TCCCAGGTCGGGGCCCAGCCTGG + Exonic
1078067869 11:8089897-8089919 GCCCAGGTGGCTGCCCTGGCAGG - Intronic
1078564049 11:12398348-12398370 GACCAGGTGAGGGCCCTGGCTGG + Intronic
1079162519 11:18008389-18008411 TCCTAGGTAGGCACCCTGGCAGG + Intronic
1080422815 11:32126813-32126835 TCCCAGGCAGGGACCCTGGGAGG - Intergenic
1083633658 11:64108801-64108823 CCCCAGGTGGGGTCCCTTGCAGG - Intronic
1083784330 11:64935117-64935139 TGCCACGTGGGAGCCCTGGCAGG + Exonic
1084530779 11:69726642-69726664 GCCCAGGGAGAGGCCCCGGCAGG - Intergenic
1084774239 11:71364939-71364961 GGCCAGGAAGGGGCCCTTGCAGG + Intergenic
1085401524 11:76238723-76238745 TCCCAGGAAGGGCCCCGGCCTGG - Intergenic
1085453514 11:76653182-76653204 TCGCAGGGAGGGGCCAGGGCTGG + Intergenic
1085774497 11:79353059-79353081 TCCCAGGTAGGGGGACAGGCAGG + Intronic
1089497455 11:118914798-118914820 TCTGAGGTTGGGGCCCTGGCAGG + Intronic
1202815920 11_KI270721v1_random:46442-46464 TTCCAGGAAGGGGCCCCCGCTGG + Intergenic
1092162692 12:6324586-6324608 CCCCAGGTCCCGGCCCTGGCAGG + Intronic
1094641951 12:32284191-32284213 TCCCAGGGAGTGCCACTGGCAGG - Intronic
1095376199 12:41531524-41531546 GCCCAGGATGGGGCCATGGCAGG + Intronic
1095962869 12:47846318-47846340 CCCCAGGTATGGGGCCAGGCAGG - Exonic
1096311233 12:50522597-50522619 ACACAGATAGTGGCCCTGGCTGG + Intronic
1096743599 12:53711729-53711751 TCCCAGGGAGGGGTCCTGTTCGG - Intronic
1096823906 12:54259561-54259583 TCCCAGGTCTGGGTCTTGGCGGG + Intronic
1097181622 12:57175109-57175131 TCCCTGGGAGGGACCCTGGGAGG - Intronic
1101886251 12:108665607-108665629 TCACAGGTAGTGGCCCAGGCAGG - Intronic
1103923174 12:124410081-124410103 ACTGAGGGAGGGGCCCTGGCAGG - Intronic
1104405203 12:128511170-128511192 TCCCAAGTAGGAGCTCTGTCTGG + Intronic
1104724146 12:131065874-131065896 TCCCAGGTTAGGGCCCTCTCCGG + Intronic
1104799830 12:131547033-131547055 TCCCAGGCAAGGGCTCTGGTTGG - Intergenic
1105580267 13:21689208-21689230 TCTCAGGCAGGGACCCAGGCAGG - Intronic
1105621515 13:22071991-22072013 AGCCATGTAGGGGCCCTGGAGGG + Intergenic
1105705850 13:22966933-22966955 TCCCGGGTGGCGGCCCTGGGTGG - Intergenic
1105986308 13:25570867-25570889 CCCCAGGTGAGGGCTCTGGCCGG + Exonic
1106127087 13:26909432-26909454 TCCCAGGGAGAAGCCCTGCCTGG + Intergenic
1108676469 13:52741161-52741183 CCCCAGGGATGAGCCCTGGCTGG - Intergenic
1109735875 13:66483818-66483840 GCCCAGGAAGGGGGCGTGGCAGG - Intronic
1110418783 13:75280992-75281014 ACACAGGCAGTGGCCCTGGCAGG + Intergenic
1112258534 13:97856865-97856887 TCCCAAGTGGTGGCCCTGGTAGG - Intergenic
1112772387 13:102805167-102805189 CCCCAGGCAGGTGCCCGGGCAGG - Intronic
1113710104 13:112457531-112457553 TCCCAGGTAAGGGCCACAGCAGG + Intergenic
1114523306 14:23352273-23352295 GCCCAGGTGGGGGCGCTGGGCGG - Exonic
1114991559 14:28295801-28295823 TACCAAGCAGGGGCCCCGGCTGG - Intergenic
1117872628 14:60217193-60217215 TCCCAGGTAGGGGCTGTGTCAGG + Intergenic
1117963946 14:61188451-61188473 TCCCAGGCAGCGGCTCGGGCAGG + Intronic
1119662583 14:76462486-76462508 TGGCAGGTGGGGGCCCTGGGCGG + Intronic
1119717200 14:76867468-76867490 TCTCTGCAAGGGGCCCTGGCTGG + Intronic
1119786943 14:77320976-77320998 CCCCAGGTACGGGGCGTGGCGGG + Exonic
1120624428 14:86807214-86807236 TCCAAGGTCGAGGCCCTGGCAGG + Intergenic
1121019473 14:90570372-90570394 ACCAAGGCAGGAGCCCTGGCTGG + Intronic
1121033405 14:90678955-90678977 TCCCAAGTTGGGTCCTTGGCAGG - Intronic
1121055078 14:90845651-90845673 TCCCAGGATGGGGCCCGGGTAGG + Intergenic
1121232950 14:92371888-92371910 ACCAAGGCAGGGGCCATGGCTGG + Intronic
1121278110 14:92681242-92681264 TGCCACCTAGTGGCCCTGGCAGG + Intronic
1121509230 14:94500084-94500106 TCCTAGGTACAGGCCCTGCCTGG - Intronic
1122367114 14:101200774-101200796 TCTCAGGTAGGGGTCTTGGCTGG + Intergenic
1122411488 14:101528267-101528289 TCCCAGGGTGGGGTCCTGCCAGG + Intergenic
1122703833 14:103607992-103608014 GCCCAGGTGGGGGCCGTGGCTGG + Intronic
1122903671 14:104792346-104792368 TTCCTGGTGTGGGCCCTGGCAGG - Intronic
1124633655 15:31351664-31351686 GCCCAGGTATGCACCCTGGCAGG + Intronic
1125674143 15:41493730-41493752 TCCCTCGCAGGGGCCCTGGGAGG + Intronic
1125728066 15:41878219-41878241 CCCCAGGGAGGGGCCCAGACTGG - Intronic
1125756867 15:42070555-42070577 TCCCACCTAAGGACCCTGGCAGG + Intronic
1126777731 15:52113528-52113550 TCCAAGGTTGAGGCCCTGGCAGG + Intergenic
1128512065 15:68319437-68319459 TCCCAGGTGGGGGCCATGGTGGG + Intronic
1129182086 15:73884018-73884040 TCACAGGTAGGGTGCATGGCTGG + Intronic
1129242989 15:74262504-74262526 CCCCAGATAGGGGCTCTGGTGGG - Exonic
1129670617 15:77605877-77605899 TCCCAGCTAGGGGCTCTGCCTGG + Intergenic
1130221360 15:82022306-82022328 GCCCAGGCAGTGACCCTGGCTGG - Intergenic
1131067735 15:89444687-89444709 CCCCAGGAAGGGGCCTGGGCAGG - Intergenic
1131097847 15:89667165-89667187 CCCCAGGTAGCAGCCCTGCCAGG - Exonic
1131301464 15:91203218-91203240 CCCCAGGTAGGGGCCTGGCCTGG + Intronic
1132537916 16:492442-492464 TCCCCGGGAAGGGCCCTGGGCGG - Intronic
1132691195 16:1182631-1182653 TCCCACATCGGGGGCCTGGCTGG + Intronic
1132698367 16:1211887-1211909 TCCTGGGTAGGGCCCCTGGCGGG + Intronic
1132949700 16:2554268-2554290 TGCCAGGGAGGGACCCTGACAGG + Intronic
1132964648 16:2645899-2645921 TGCCAGGGAGGGACCCTGACAGG - Intergenic
1133130491 16:3673602-3673624 TCCCACGCAGGAGCCCTGGGTGG + Intronic
1133270260 16:4607872-4607894 TCCCAGGAATGGGCCCTCCCAGG - Intergenic
1133287557 16:4697661-4697683 ACCCGGGTCTGGGCCCTGGCTGG + Intronic
1133434449 16:5767116-5767138 CCCTAGGTAGGGGCTCTGGAGGG - Intergenic
1133887666 16:9845674-9845696 TTCCAGGTAGAGGCAATGGCAGG - Intronic
1135424780 16:22326973-22326995 TCACTGGGAGGGGCCCTGACGGG + Intronic
1135689238 16:24522895-24522917 TTCCAGATAGTGGCCCCGGCTGG - Intergenic
1136580514 16:31148601-31148623 TCCCAGGACGGGCCCCTGGACGG - Exonic
1136913501 16:34162163-34162185 TCACATGTAGGGGCCACGGCAGG - Intergenic
1138455782 16:57119835-57119857 TCAAAGGTGGGGGCCCTGCCCGG - Intronic
1138744502 16:59347739-59347761 GCCTATGCAGGGGCCCTGGCTGG - Intergenic
1140958021 16:79885478-79885500 TTCCAGGTAGCGGGCCTGCCCGG - Intergenic
1141518575 16:84562698-84562720 GCCCAGGGTGCGGCCCTGGCTGG - Intergenic
1142185555 16:88693228-88693250 TGCCAAGTAGGTGCCCCGGCTGG + Intergenic
1142287056 16:89175768-89175790 TCCCAGGCAGGGGACCCTGCCGG - Intronic
1142348371 16:89568583-89568605 TCCCAGCTTGGGGCCGTGCCTGG - Intergenic
1142362296 16:89633168-89633190 GCCCGGGCAGGGTCCCTGGCTGG + Intronic
1142591045 17:1006268-1006290 CCCCAGGAAGGGGCGGTGGCCGG - Intronic
1143109271 17:4544360-4544382 TGCGAGCTAGGGGCCCAGGCTGG + Intronic
1143608441 17:8003763-8003785 TCACAGGTAGGCTCCCTTGCAGG + Exonic
1143762846 17:9117308-9117330 TCCCAGGGAAGGGCCCGGCCTGG + Intronic
1143938844 17:10516664-10516686 GCCCAGTTAAGGACCCTGGCTGG + Exonic
1145118265 17:20232143-20232165 GCCCAGGCACTGGCCCTGGCAGG + Intronic
1145279098 17:21455438-21455460 GCCCTGGTGGGGGCCCTGGCAGG + Intergenic
1146053423 17:29569081-29569103 CCGCAGGTAGGAGCCCTGGAGGG + Exonic
1146503384 17:33383644-33383666 GCCCAGGGTGGGGCCCTGGTGGG - Intronic
1147211568 17:38875165-38875187 GCCCAGGCAGGGGCCTAGGCAGG + Intronic
1148454258 17:47802458-47802480 TCCAAGGATGTGGCCCTGGCTGG - Intergenic
1149527362 17:57367114-57367136 ACCCAGGTAGGGGCCCTGAAGGG + Intronic
1149535594 17:57431188-57431210 TCACAGGTGGGAGCCCAGGCAGG + Intronic
1150698092 17:67423349-67423371 CCCAAGGTAAGGGCCCTGCCAGG - Intronic
1151372403 17:73656490-73656512 GCCAAGGTAGAGGCCCAGGCGGG - Intergenic
1151441399 17:74131607-74131629 GCGCAGGTATGGGTCCTGGCAGG - Intergenic
1151443758 17:74150180-74150202 TCCCAGGCAGGGGCCTTGCCTGG - Intergenic
1151475386 17:74342055-74342077 TCAAAGGCAGGGGCCCTGGAGGG - Intronic
1151666617 17:75549028-75549050 TCCGGGGCAGGGGCACTGGCTGG + Intronic
1151713432 17:75819407-75819429 TCCGAGGCAGGGACCCTGGATGG + Intronic
1151828045 17:76534679-76534701 TGCCAGGAAGGGGCCCAGGCAGG + Intronic
1152246395 17:79186883-79186905 TCCCTGGCAGGGGCCTTGGAGGG + Intronic
1152748104 17:82050459-82050481 CCCCAGGTAGACGTCCTGGCTGG + Exonic
1152827376 17:82475730-82475752 TGCTAGGTAGGGGCCCTGAGAGG - Intronic
1153171300 18:2319078-2319100 TCCCAGGTAGCTGACCTGGTTGG - Intergenic
1153480661 18:5543592-5543614 TCCCAGGGAGGCCCCCAGGCCGG + Intronic
1154165553 18:12011796-12011818 TCCCAGGTGGGGCGCCAGGCAGG - Intronic
1155248969 18:23937703-23937725 TCCCAGGCAGGAGCCCAGGCTGG + Intronic
1157205262 18:45692418-45692440 CCCCAGGTAGGGACCATTGCTGG - Intergenic
1157310510 18:46549140-46549162 TACCAGGGAGGGGACCAGGCAGG + Intronic
1157597953 18:48875247-48875269 GGCCAGGCAGGGGCCTTGGCAGG + Intergenic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1160413085 18:78688072-78688094 ATCCAGGTCAGGGCCCTGGCAGG - Intergenic
1160501656 18:79404199-79404221 TCCCAGGTTGGGCCCCGGGCTGG + Intronic
1160583743 18:79901544-79901566 TCCCACGGAGGGGCCCTCACTGG + Intergenic
1160740987 19:685745-685767 TCCCAGGCAGGGGGCCGGGCTGG + Exonic
1160946212 19:1645166-1645188 CCCCAGGGGTGGGCCCTGGCTGG - Intronic
1161235482 19:3196127-3196149 CCCCTGGCTGGGGCCCTGGCTGG + Intronic
1161374287 19:3931219-3931241 GCCCAGATAAAGGCCCTGGCAGG - Intergenic
1161454405 19:4362914-4362936 TCCAAGGTGGGGGTCCAGGCTGG - Intronic
1161684504 19:5696232-5696254 TCCAAGGTGGGGGGCCTGTCTGG - Exonic
1161702314 19:5802339-5802361 TCCAAGGTAGGGGGCGGGGCGGG - Intergenic
1162067404 19:8134500-8134522 CCCCAGGGAGGGGCCCTGGGGGG - Intronic
1162142441 19:8592733-8592755 GCCCAGTTGGGGGCCCTGGCCGG + Intronic
1162337503 19:10070933-10070955 CCCCAGTCAGTGGCCCTGGCCGG + Intergenic
1162567366 19:11451709-11451731 CTCCAGGGAGGGGGCCTGGCTGG + Exonic
1163578310 19:18123395-18123417 GCCCAGGGAGGGGCCGGGGCTGG - Intronic
1163638857 19:18450460-18450482 CCCCAGGTAGGTGCCCAGGCAGG - Exonic
1163826208 19:19526255-19526277 GCGCAGGTAGGGCCCCTGGTGGG + Exonic
1163830928 19:19546864-19546886 AGGCAGGGAGGGGCCCTGGCAGG + Intergenic
1164692431 19:30221507-30221529 GCACAGATAGTGGCCCTGGCTGG + Intergenic
1165285727 19:34839842-34839864 TCCCTGGTAGTGACCCTGCCAGG + Intergenic
1165343447 19:35228233-35228255 TACCTGGTGGGAGCCCTGGCAGG - Exonic
1165370730 19:35404244-35404266 TTCCAGGTAGGGGCACCAGCGGG - Intergenic
1165791646 19:38496324-38496346 TCCAAGGTGAGGGCCCAGGCAGG + Exonic
1166382772 19:42363285-42363307 TGCCAGGCAAGGGCCCGGGCAGG + Intronic
1166689493 19:44814049-44814071 TCCCAGGTGAGGGCTATGGCGGG - Intronic
1167451597 19:49573436-49573458 TCCAGAGTAGGGGCCCTGGTTGG + Intronic
1167771864 19:51525746-51525768 CACCAGGCAGGGCCCCTGGCTGG + Intronic
1167771866 19:51525748-51525770 CCCCAGCCAGGGGCCCTGCCTGG - Intronic
926103421 2:10135464-10135486 TCCAAAGTAGGGGCCCTGGTGGG + Intergenic
926222996 2:10948564-10948586 GACCAGTTAGGGGCCATGGCAGG + Intergenic
933670189 2:84999839-84999861 TCCCAGTTAGAGGCCCTGACAGG + Intronic
934736492 2:96692281-96692303 CGACAGGCAGGGGCCCTGGCTGG - Intergenic
934884921 2:98016182-98016204 ACCCAGGCAAGGGCCATGGCAGG - Intergenic
935976701 2:108585536-108585558 TCCCTGTTAGTGGCACTGGCTGG - Intronic
936403775 2:112185001-112185023 TCCCAGGGAGGGGCACTCCCTGG + Intronic
937932791 2:127219441-127219463 TCCCGGGGAGGGACCCAGGCAGG - Intronic
938534215 2:132222104-132222126 TCCCAGATAGGGCGGCTGGCCGG - Intronic
938652871 2:133401753-133401775 GCCCAGGTTGGAGCCCTGACTGG - Intronic
939516020 2:143169319-143169341 CCCCATGAAGGGGGCCTGGCTGG - Intronic
940599852 2:155845220-155845242 GCCCAGGATGGGGGCCTGGCAGG - Intergenic
941231392 2:162915993-162916015 CGCCAGGAAGTGGCCCTGGCTGG - Intergenic
941858661 2:170255226-170255248 ACCCCAGTAGGGACCCTGGCGGG - Intronic
941933545 2:170965629-170965651 TTCCAGATAGAGGCCCTGGCAGG - Intronic
943351871 2:186805877-186805899 CACCAGATAGGGCCCCTGGCTGG - Intergenic
944666030 2:201960528-201960550 GCCTAGCTTGGGGCCCTGGCTGG - Intergenic
945172191 2:207008369-207008391 TTCCAGGAAGGGACCCTGCCAGG - Intergenic
946777835 2:223162075-223162097 ACCCAGATAGTGGGCCTGGCTGG + Intronic
948469379 2:238167455-238167477 TCCCAGGTAGGGGCCCTGGCTGG - Intronic
948579178 2:238972351-238972373 TCTCAGGGAGGGGGCCTGGGAGG - Intergenic
948589281 2:239038979-239039001 GCCCAGGAAGAGGCCTTGGCAGG + Intergenic
948804466 2:240447511-240447533 TCCCAGGGAGGCGGCCTGCCGGG + Intronic
1168972068 20:1937805-1937827 TCCCAGGTTGGTTCCCTGGCTGG - Exonic
1170584688 20:17725528-17725550 TGCCAGGCTGGTGCCCTGGCAGG - Intronic
1170601311 20:17843501-17843523 TCCAATGCAGGCGCCCTGGCAGG - Intergenic
1170812926 20:19688471-19688493 CCCCAGGAAGCGGGCCTGGCTGG - Intronic
1170943211 20:20866332-20866354 TCCCAGGTGGGCGGCCTGCCAGG + Intergenic
1171035271 20:21708548-21708570 TCTCCTGCAGGGGCCCTGGCTGG + Exonic
1171861555 20:30405803-30405825 TCCCAGGCAGGGCGGCTGGCCGG - Intergenic
1172116702 20:32577256-32577278 TCCCAGCCAGGGGGCCGGGCGGG + Intronic
1174067040 20:47873152-47873174 ACTCAGGCAGGGGCCCTGTCAGG + Intergenic
1174103374 20:48144420-48144442 TCCCAGGTATGCGTCCTGGGAGG + Intergenic
1175357595 20:58381161-58381183 TCACAGGTCTGGCCCCTGGCTGG - Intergenic
1175361149 20:58413744-58413766 TCCCGGGTGGGGCCGCTGGCCGG + Intronic
1175700272 20:61131822-61131844 TCCCATGAAGGGGGCGTGGCAGG + Intergenic
1178432007 21:32525488-32525510 GCTCAGGTCGGGGGCCTGGCAGG + Intergenic
1178960731 21:37062331-37062353 TCCCAGGTTGGGCTCCAGGCTGG + Intronic
1179257126 21:39726757-39726779 CCTCAGGTAGGGGTGCTGGCAGG - Intergenic
1179426500 21:41283625-41283647 ACCCAGGTAGAGGCCAGGGCTGG - Intergenic
1179457133 21:41507704-41507726 TCCCAGGCGGGGGCCGTGGAGGG + Intronic
1179494662 21:41764092-41764114 TCCCAGGAGGGCCCCCTGGCAGG + Intronic
1180106350 21:45620747-45620769 TTCCAGTTGGGGGCCCGGGCAGG + Intergenic
1180159327 21:45992099-45992121 TGCCAGGTATGGGCCCAGGGAGG + Intronic
1181029542 22:20143178-20143200 TGCGGGGTAGGGGCCGTGGCGGG - Exonic
1181092563 22:20484021-20484043 TCCCAGCTATGGCGCCTGGCTGG - Intronic
1182470322 22:30544309-30544331 TCCCAGGTCGGTTCCCTGGCTGG - Intronic
1183242974 22:36672121-36672143 AGCCAGGAAGGGGCCCTGGTGGG + Intronic
1183285393 22:36959480-36959502 TGCCAGGAAGGGGACCTGGCTGG + Intergenic
1183662178 22:39227719-39227741 TCCCAGGTGGCCACCCTGGCAGG + Intronic
1183780467 22:39995599-39995621 TCCCAGGCAGGGCCCGGGGCAGG + Intronic
1183786165 22:40030335-40030357 TCCCAGGTAAAGGCCCTGTAAGG - Exonic
1183984525 22:41562188-41562210 TCCCAGGGAGAGGCCCCTGCCGG - Intronic
1184240753 22:43210277-43210299 TGCTGGGCAGGGGCCCTGGCCGG + Intronic
1184297085 22:43531837-43531859 TCAGAGGTGGGGGCTCTGGCCGG - Intronic
1184568354 22:45307004-45307026 TCACAGGCAGGGTCCCTGGTGGG - Intergenic
1184628611 22:45757420-45757442 TCCGAGGTGGGAGCCCAGGCTGG + Intronic
1184669276 22:46004311-46004333 TCCCAGGTAGAGGGGCTGGAGGG + Intergenic
1184729963 22:46366581-46366603 TGCCAGGCAGGGGCCCAGCCAGG - Intronic
1184996288 22:48209784-48209806 TCCCAGGGACGGGTCCTGGGTGG + Intergenic
1185052103 22:48559402-48559424 TCTCAGGGAGGGGCTCTAGCTGG - Intronic
1185172384 22:49301579-49301601 TCCCATGAGGGGGCCATGGCAGG + Intergenic
1185302229 22:50087935-50087957 TCCCAGGGAGTGGCCCGAGCTGG + Intergenic
950112231 3:10426620-10426642 TCCCAGGCTGAGGCCCAGGCTGG - Intronic
950204778 3:11071166-11071188 TCCCACGTAAGGGCCGTGGGCGG + Intergenic
950431868 3:12955492-12955514 CACCAGGCAGAGGCCCTGGCTGG - Intronic
953024236 3:39135569-39135591 GCTCAGGTTGGAGCCCTGGCAGG + Intronic
953257762 3:41306444-41306466 TCCCAGATGGGGCCACTGGCCGG - Intronic
954063520 3:48088597-48088619 TCCGAGGGAGGGGGCCAGGCGGG - Intronic
954228864 3:49200626-49200648 TACAAGGGAAGGGCCCTGGCAGG - Intronic
956511623 3:69999680-69999702 GCCCAGGTTGGGGGCGTGGCCGG - Intergenic
958560764 3:95744811-95744833 TCCCAGATAGGGCGGCTGGCTGG + Intergenic
961373952 3:126450225-126450247 TCCAAGGTTGGAGCCCTGGCAGG - Intronic
961461121 3:127050990-127051012 TCCCAGGTGGGGGCCCTTGAGGG + Intergenic
961740873 3:129032583-129032605 TCCCAGGAAGGGGCTCTGACTGG + Intronic
963042898 3:141082266-141082288 TCCCAGGGAGTGCGCCTGGCAGG + Intronic
964423918 3:156532413-156532435 TACCAGGTAGTGGCTATGGCAGG - Intronic
966807079 3:183816136-183816158 TCCCAGGTGCTAGCCCTGGCAGG - Exonic
967319897 3:188184846-188184868 TACCAGGAAGGGGGACTGGCTGG + Intronic
967968671 3:194983774-194983796 TCCCAGCCAGGAGCCCTGGCAGG - Intergenic
968551573 4:1226213-1226235 GCTCAGGGAGGGGCACTGGCTGG - Intronic
968623117 4:1613249-1613271 CCCAAGGTAGGGGCGCCGGCAGG + Intergenic
968812110 4:2804760-2804782 TGCCTGGTAGGGGCCCTGCCAGG + Intronic
968904024 4:3443500-3443522 ACCCGGGCAGGGGTCCTGGCTGG + Intronic
968908103 4:3463711-3463733 GCGCAGGTGGGGGCCCTGGACGG + Intronic
969079826 4:4609734-4609756 AGCCAGGAAGGGGCCCTTGCCGG + Intergenic
969447991 4:7256258-7256280 TCCCTCGTGGCGGCCCTGGCTGG - Intronic
969450237 4:7268818-7268840 TCCCAGGGAGAGGGCCTGGAGGG + Intronic
970855824 4:20648687-20648709 CACCAGGGAGTGGCCCTGGCAGG + Intergenic
971877259 4:32323281-32323303 TGCCAGGCAGTGGCCCTGGCTGG - Intergenic
978368370 4:108006139-108006161 TCCCAGGCAGGAGGCCTGGTGGG + Intronic
978630262 4:110735859-110735881 TGCCAGGAATGGGCCCTGGGAGG - Intergenic
983315940 4:166133530-166133552 TCCCAGTTCTGTGCCCTGGCTGG + Intergenic
984927312 4:184818121-184818143 TCCCAGGATGGGGAGCTGGCGGG - Intronic
985508794 5:300112-300134 TCCCAGGAGGGGCCCTTGGCTGG + Intronic
985588035 5:751018-751040 TCCCAGGGAGAGGCCGGGGCAGG - Intronic
985602704 5:843485-843507 TCCCAGGGAGAGGCCGGGGCAGG - Intronic
985739331 5:1605804-1605826 TCCCAGGAGGGGCCCTTGGCTGG - Intergenic
985899800 5:2779731-2779753 TCGCAGGTGGGGACCTTGGCAGG + Intergenic
988809461 5:34770092-34770114 TCCCGGGTAGGGGAGCTTGCAGG + Intronic
989579258 5:43016782-43016804 TCCTAGGTAGAGGCCATGCCAGG - Intergenic
990563962 5:57010429-57010451 TGCAAGGTAGGGCCCTTGGCTGG - Intergenic
992392902 5:76345743-76345765 TCCCAGCTAGGGTTCCTGGGAGG - Intronic
994895158 5:105693692-105693714 GCCCAGGTAGGTTCCCTGACTGG - Intergenic
995663030 5:114507160-114507182 TCCCAGCTAGGGGCTGAGGCAGG + Intergenic
997471710 5:134120891-134120913 TGCCAGGGAGGGGCCCAGGGAGG + Intronic
998132064 5:139656196-139656218 ACCCAAGTAGGGGCCTAGGCTGG + Intronic
998142840 5:139709722-139709744 TCCCACGCCGGGGCCCTGTCTGG + Intergenic
998592856 5:143496426-143496448 TCCCAGGGATGGTCTCTGGCTGG - Intergenic
1001394201 5:171404201-171404223 TCCCAGATAGGGCGGCTGGCCGG + Intronic
1001954932 5:175842655-175842677 TCAGAGGTAGAGGGCCTGGCTGG - Intronic
1002088805 5:176792689-176792711 TCCCAGGTAGGAAACCTGGCCGG + Intergenic
1002128319 5:177063577-177063599 CCCCAGGGAGGGGCTCTGGTTGG - Intronic
1002536340 5:179878292-179878314 TGCCAGGTAAGGGGCCTGACAGG - Exonic
1002660310 5:180787132-180787154 TCACAGGAAGAGGCTCTGGCAGG + Intergenic
1003163275 6:3654365-3654387 ATCCAGGTAGGGGAGCTGGCTGG - Intergenic
1005851847 6:29828428-29828450 TCCCAGGTAGAGGGTCTGGGCGG - Intronic
1006741018 6:36309058-36309080 TCCCAAGTGGGGTCCCTGGATGG + Intergenic
1013883557 6:114934054-114934076 GGCCAGGTAGGGGCCCTTGCTGG + Intergenic
1015522848 6:134148677-134148699 TATCAGGTAGGGGCCTGGGCAGG - Intergenic
1016937411 6:149457346-149457368 TCCCAGCTAGGGGCCCATGCAGG - Intronic
1018046309 6:159969260-159969282 CCCCAGGTGGGGGCTCCGGCCGG - Exonic
1018459747 6:163986373-163986395 CCCCAGGTAGTGGGCCAGGCAGG - Intergenic
1019358463 7:593094-593116 TCCCAGGCAGGGGCCCAGCCCGG - Intronic
1019935942 7:4258040-4258062 TGCCAAGAAGGGGGCCTGGCGGG - Intronic
1020118121 7:5487717-5487739 CCCCAGGCAGGCGCCCTGGAGGG + Intronic
1020125170 7:5529518-5529540 CACCAGGTAGGGGAGCTGGCTGG - Exonic
1020245251 7:6424435-6424457 TCCCGGGTGTGGGGCCTGGCTGG + Intronic
1023287238 7:38631987-38632009 GCCCAGTGAGGGGCCCTGGCTGG + Intergenic
1025103459 7:56151925-56151947 TCCCAGGTGGGGCGGCTGGCCGG - Intergenic
1025242412 7:57288347-57288369 TCCCATGTAGGTGCCCTTGATGG + Intergenic
1026167803 7:67925910-67925932 TCCCATGTAGGAGCCCTCGATGG + Intergenic
1026533381 7:71219893-71219915 TCACTGGTAGGTGCTCTGGCAGG + Intronic
1026878860 7:73895252-73895274 TCCCATGGATGGGGCCTGGCTGG + Intergenic
1029609772 7:101620689-101620711 TTCAAGGGAGGGGGCCTGGCAGG + Intronic
1032198621 7:129804196-129804218 TCCCAGATGGAGGCCCTGCCAGG + Intergenic
1032384049 7:131509260-131509282 TCCAACGCAGGGCCCCTGGCTGG - Intronic
1033597332 7:142867018-142867040 GCCCCCGTAGGGGCCGTGGCCGG - Exonic
1034271506 7:149805468-149805490 CCCCGGGAGGGGGCCCTGGCTGG + Intergenic
1035663855 8:1365809-1365831 TCTCATGTCGGGGCCCTGGGGGG + Intergenic
1035731042 8:1853722-1853744 TCCCAGGTCAGGGTGCTGGCAGG + Intronic
1036795956 8:11757078-11757100 TCCCAGGTACGCGCCATGGCTGG + Exonic
1039153178 8:34528854-34528876 TCCCAGATGGGGCGCCTGGCCGG + Intergenic
1039916753 8:41865730-41865752 TCCCAGGTAGGGCCTCTGGAAGG + Intronic
1040121195 8:43687521-43687543 TCCCAGGTGGGGTGGCTGGCCGG + Intergenic
1041405926 8:57499220-57499242 TCCTATGTAGGGGTCCTGTCAGG - Intergenic
1044186121 8:89254028-89254050 GGCCAGGCAGGGGCCCTGGAAGG + Intergenic
1044699363 8:94951951-94951973 GCCCAGGCAGGGAACCTGGCTGG - Intronic
1045690003 8:104750594-104750616 TCCCAGATAGTGTCCCTTGCTGG - Intronic
1049178567 8:141208628-141208650 TCTCAGGCAGGGGCCTTAGCTGG - Intronic
1049431848 8:142569038-142569060 CCCCAGGTAGGGTCCCAGGTGGG - Intergenic
1049452928 8:142672039-142672061 TTCTGGGGAGGGGCCCTGGCAGG - Intronic
1049543604 8:143219473-143219495 TCCCAGGAAGGAGGCCTTGCCGG + Intergenic
1055586611 9:77762317-77762339 TCCCAGGTGGGGCGGCTGGCCGG - Intronic
1056219271 9:84435415-84435437 TCCAAGGTCAGGGCACTGGCAGG + Intergenic
1056821942 9:89848713-89848735 TCCACGGTCGGGGCTCTGGCAGG + Intergenic
1059154145 9:111975157-111975179 TCTCAGGTAGGGGCCAGGGACGG + Intergenic
1059401969 9:114076312-114076334 TCCCAGGTTGGGTCCCTGGGGGG + Intronic
1060052508 9:120387294-120387316 TCCCAGGTAGAGGTCCTTGGGGG + Intergenic
1060197109 9:121631011-121631033 GCCCAGGGAGGGGCCCTCACAGG + Intronic
1061078978 9:128358798-128358820 TCCCAGGTGAGGGCCCAGACCGG - Intronic
1061236644 9:129346957-129346979 TCCCGGGGACGGGCCCTAGCAGG + Intergenic
1061727475 9:132589610-132589632 TCCCGGGAGGGGGCCCTGCCCGG + Exonic
1061858561 9:133456243-133456265 TGCCAGTTATGGGCCCTGCCAGG + Intronic
1062074382 9:134576588-134576610 TGCCAGGGAGGGGGCCAGGCAGG - Intergenic
1062431307 9:136527948-136527970 TTCCATGGAGCGGCCCTGGCAGG - Intronic
1062464204 9:136674012-136674034 TCCCAGGGAGGGGCTGTGGGGGG - Intronic
1062481569 9:136754889-136754911 TGCCAGGCAGGGACCCTGGGAGG - Intronic
1062542875 9:137049277-137049299 TTCCAGGCATGGGCGCTGGCTGG - Intronic
1203775123 EBV:68631-68653 TCCCAAGTAGGGGTCCTAGGAGG - Intergenic
1187648465 X:21374807-21374829 TCTCAGGTGGGGTCCCTTGCTGG - Intronic
1189833398 X:44997546-44997568 GCCCAGGTTGGGGGCGTGGCAGG + Intronic
1195305058 X:103573875-103573897 TCAGAGGTGGGGGCCCTAGCAGG - Intergenic
1197393594 X:125898435-125898457 AGCCAGGCAGGGGCCCTGGAAGG + Intergenic
1198177755 X:134172708-134172730 GCCCAGGCAGAGGCCGTGGCCGG + Intergenic
1198815058 X:140580680-140580702 TCCCAGGTAGGGGCCTGGGCCGG + Intergenic
1199581818 X:149368180-149368202 CTCCAGGTAGGGCTCCTGGCTGG + Intergenic
1200750908 Y:6943326-6943348 TTCTAGGTAGGGGTCATGGCAGG - Intronic