ID: 948469707

View in Genome Browser
Species Human (GRCh38)
Location 2:238169134-238169156
Sequence TCTCGGGAACAGTGGGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948469701_948469707 -1 Left 948469701 2:238169112-238169134 CCTGGGAAACTAGGGTCAAGCCT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 948469707 2:238169134-238169156 TCTCGGGAACAGTGGGACATAGG 0: 1
1: 0
2: 0
3: 10
4: 79
948469695_948469707 23 Left 948469695 2:238169088-238169110 CCTTGAAGGCTGGGAGTGAACCT 0: 1
1: 0
2: 0
3: 17
4: 178
Right 948469707 2:238169134-238169156 TCTCGGGAACAGTGGGACATAGG 0: 1
1: 0
2: 0
3: 10
4: 79
948469700_948469707 3 Left 948469700 2:238169108-238169130 CCTTCCTGGGAAACTAGGGTCAA 0: 1
1: 0
2: 1
3: 15
4: 834
Right 948469707 2:238169134-238169156 TCTCGGGAACAGTGGGACATAGG 0: 1
1: 0
2: 0
3: 10
4: 79
948469694_948469707 24 Left 948469694 2:238169087-238169109 CCCTTGAAGGCTGGGAGTGAACC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 948469707 2:238169134-238169156 TCTCGGGAACAGTGGGACATAGG 0: 1
1: 0
2: 0
3: 10
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948469707 Original CRISPR TCTCGGGAACAGTGGGACAT AGG Intergenic
907971302 1:59384269-59384291 TCTCTGGAAGAGAGGGAAATGGG - Intronic
908395541 1:63722104-63722126 TCTGGGAAACTGTGGGACATGGG + Intergenic
910798663 1:91123504-91123526 CCTTGGGCAGAGTGGGACATTGG - Intergenic
923146351 1:231201391-231201413 TCTCAGGAGCAGTGGGTCAAAGG + Exonic
924400830 1:243679217-243679239 TCTGGGCAACAGTAGGATATTGG + Intronic
924617315 1:245622871-245622893 TCTCTGGAAGAGTGGGGCCTGGG + Intronic
1063840469 10:10065845-10065867 TCTGGGGAACAGTGGAAGAAAGG - Intergenic
1066590354 10:36987760-36987782 TCTTGGGAAAATTGGGGCATTGG + Intergenic
1069950643 10:72015976-72015998 TTTCTGAAACAGTGGGACAAAGG + Intergenic
1071877095 10:89853490-89853512 TCTTTAGAACAGTGTGACATCGG + Intergenic
1079384015 11:19962850-19962872 TCTTGGGAACAGTGGGAGACAGG + Intronic
1084497660 11:69514247-69514269 CCTGGGGAAGAGTGGGACAGAGG - Intergenic
1096460145 12:51817862-51817884 TCTCGGGGGCAGTGGGATGTGGG - Intergenic
1098110904 12:67120740-67120762 TGTGGGGAACAGTGGGAGGTTGG + Intergenic
1106039882 13:26079739-26079761 TCTGAGGAAGAGTGTGACATTGG + Intergenic
1109187765 13:59291124-59291146 AGTGGGGAACAGTGGGGCATGGG - Intergenic
1113975736 13:114225913-114225935 TCTCCAGGTCAGTGGGACATGGG + Intergenic
1118513764 14:66505225-66505247 TCTCAGGAAACATGGGACATGGG - Intergenic
1118580313 14:67289494-67289516 CCTCGGTATCAGTGGGAGATTGG - Intronic
1121554788 14:94828268-94828290 TCTCTGGATCAGAGGGAAATCGG + Intergenic
1122274198 14:100582905-100582927 TCTCTGAAGCAGAGGGACATGGG + Intronic
1122357439 14:101132144-101132166 TCTTGGGGAGAGTGGGGCATGGG - Intergenic
1202903318 14_GL000194v1_random:55332-55354 CCTCGGGATAAGTGGGACAGAGG + Intergenic
1124615192 15:31236556-31236578 TCACTGGAGCAGTGGGAGATGGG + Intergenic
1129192945 15:73947949-73947971 TTTCAGGAACGGGGGGACATTGG - Intronic
1130468710 15:84205571-84205593 TCCTGGGAACAGGGGGCCATCGG - Intergenic
1130476200 15:84320122-84320144 TCCTGGGAACAGGGGGCCATCGG - Intergenic
1130495565 15:84468008-84468030 TCCTGGGAACAGGGGGCCATCGG + Intergenic
1130591003 15:85210170-85210192 TCCTGGGAACAGGGGGCCATCGG - Intergenic
1131262023 15:90892495-90892517 TCTCAGGAAGGGTGGCACATCGG + Intronic
1131934777 15:97491295-97491317 TCTCGGGAAGTGGGGGACAAGGG + Intergenic
1132699064 16:1214581-1214603 CCTCGGGGACATGGGGACATGGG - Intronic
1143686361 17:8519706-8519728 TATCTGGAACAGTGGGAGAAAGG + Intronic
1144197722 17:12911538-12911560 TCTCTGGAATAGTGGGTCTTTGG + Intronic
1145906649 17:28520139-28520161 TCGCAGGAACTGTGGGACTTTGG - Intronic
1160970335 19:1765076-1765098 TGTCGGGCACAGAGGGACATGGG + Intronic
1162051091 19:8033526-8033548 GCTCGGGCACAGAGGGAAATAGG - Intronic
1164962642 19:32447959-32447981 TCTCAGGAAGAGTGGGAGGTGGG + Intronic
925154024 2:1636715-1636737 CCTCAGGAACAGTGGCACAGGGG + Intronic
928123167 2:28598573-28598595 TCTCTGGTACTGTGGGACCTAGG - Intronic
928360517 2:30658805-30658827 TCTCCGGAACAGTAGGAAAATGG + Intergenic
934197912 2:89855964-89855986 TCTCAGGAACACTGGGAAGTAGG + Intergenic
934531335 2:95091120-95091142 TCTCGAGAACAGTGGGAAGGAGG - Intronic
937718527 2:125063138-125063160 TCTTGGCAACAGAGGGACTTTGG - Intergenic
944218547 2:197279527-197279549 TATGGGCAACAGTGGGAGATTGG - Intronic
948469707 2:238169134-238169156 TCTCGGGAACAGTGGGACATAGG + Intergenic
1170564422 20:17588836-17588858 TCTCTAGAACAGTGGGACAAAGG + Intronic
1170790766 20:19507706-19507728 TCTCTGGAACAATGAGAAATGGG + Intronic
1173442830 20:43093758-43093780 TCAAGGGAAGAGTGGGACAGGGG - Intronic
1176622683 21:9070100-9070122 CCTCGGGATAAGTGGGACAGAGG + Intergenic
1177188306 21:17821605-17821627 GCTGGGGATCAGTGGGGCATGGG + Intergenic
1183349649 22:37327735-37327757 TCTCGGTACCAGTGGGACTTTGG + Intergenic
1184586340 22:45450546-45450568 ACTCAGGAACAGTGCGTCATGGG + Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
952146455 3:30538003-30538025 TCTCTGCACCAGTGGGTCATGGG + Intergenic
955658416 3:61269861-61269883 TCTCGGTAACCATGGGAGATTGG + Intergenic
963407286 3:144882165-144882187 TGTCAGGAACTGGGGGACATGGG - Intergenic
967105757 3:186253821-186253843 ACTAGGGAATAGTGGGACATTGG + Intronic
969169222 4:5346472-5346494 TCCCCAGAACAGTGGGACATAGG + Intronic
972946549 4:44263939-44263961 ACTGGGGAACAGTGGGAGATTGG - Intronic
976577511 4:86691347-86691369 TTTGGGGAACAGTATGACATGGG + Intronic
983670777 4:170235424-170235446 GCTCAGGAACAGTGTGACCTTGG + Intergenic
986646567 5:9921828-9921850 TATCAGGAACACTGGGACAGAGG - Intergenic
990483120 5:56230555-56230577 TCTCGGGAAAAGTTGAACATGGG - Intronic
996525342 5:124473428-124473450 TTTCGGGAAGAGTCGGAGATGGG - Intergenic
998202227 5:140134218-140134240 TCTCTGGCAAAGTGGGACATAGG - Intergenic
1000198917 5:158988352-158988374 TCTTGAGAAGAGTGGGACCTAGG + Intronic
1001942305 5:175749452-175749474 TGTGGGGAACAGCTGGACATAGG - Intergenic
1006592159 6:35166355-35166377 TCTGGGGCAAACTGGGACATAGG - Intergenic
1017985003 6:159435941-159435963 TCTCGGGAACTGAGTGACAATGG + Intergenic
1018221420 6:161584043-161584065 TCTGGGAAACTGGGGGACATTGG - Intronic
1018466955 6:164056692-164056714 TCTCGTAAAAAGTGAGACATTGG - Intergenic
1020046804 7:5046356-5046378 TCTCGGGAGCCGTGGGGCAGAGG + Exonic
1023586730 7:41738532-41738554 TCTCGCGATCAGTGGAACAAAGG + Intergenic
1025610504 7:63072493-63072515 TTTGGGGAACAGTGAGACAGGGG - Intergenic
1026727354 7:72879845-72879867 TCTCGGGAGCCGTGGGGCAGAGG + Exonic
1026858753 7:73771078-73771100 TCTCCGCAAAAGTGGGAAATCGG + Intergenic
1027116502 7:75485882-75485904 TCTCGGGAGCCGTGGGGCAGAGG - Exonic
1029426247 7:100495799-100495821 TCTATGGAACAGTAGGAGATGGG + Intergenic
1029721035 7:102364371-102364393 TCTCGGGAGCCGTGGGGCAGAGG + Exonic
1035373773 7:158394880-158394902 TCACAGGGACAGTGGGACAGCGG + Intronic
1043483234 8:80673882-80673904 TCTGGGGCACAGTGGGCCCTGGG - Intronic
1044418985 8:91969601-91969623 TCTCAGGAAAAGAGGGACAAAGG - Intronic
1056890466 9:90487356-90487378 TCTCGGGAACAGTTGTCCACTGG + Intergenic
1062045638 9:134423277-134423299 TCTTGGGCCCAGGGGGACATGGG - Intronic
1062189515 9:135240633-135240655 CCTTGGGAATAGTCGGACATTGG - Intergenic
1203745874 Un_GL000218v1:40528-40550 CCTCGGGATAAGTGGGACAGAGG + Intergenic
1189472094 X:41322377-41322399 TCCAGGGAGCAATGGGACATCGG + Intergenic
1193983683 X:88214308-88214330 TATGGGGAACAGTGGAACAGTGG + Intergenic
1196144400 X:112301032-112301054 TCTCGGGAGAAGTGGGAATTGGG + Intergenic