ID: 948470669

View in Genome Browser
Species Human (GRCh38)
Location 2:238175833-238175855
Sequence GTGGCTATTCACAGACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948470664_948470669 5 Left 948470664 2:238175805-238175827 CCTGCTATGTTGCCCAGACTGGA 0: 5
1: 55
2: 864
3: 2667
4: 4078
Right 948470669 2:238175833-238175855 GTGGCTATTCACAGACATGGTGG 0: 1
1: 0
2: 1
3: 18
4: 130
948470666_948470669 -7 Left 948470666 2:238175817-238175839 CCCAGACTGGAGTGCAGTGGCTA 0: 35
1: 1043
2: 16955
3: 188976
4: 263054
Right 948470669 2:238175833-238175855 GTGGCTATTCACAGACATGGTGG 0: 1
1: 0
2: 1
3: 18
4: 130
948470667_948470669 -8 Left 948470667 2:238175818-238175840 CCAGACTGGAGTGCAGTGGCTAT 0: 28
1: 579
2: 2469
3: 24437
4: 209516
Right 948470669 2:238175833-238175855 GTGGCTATTCACAGACATGGTGG 0: 1
1: 0
2: 1
3: 18
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948470669 Original CRISPR GTGGCTATTCACAGACATGG TGG Intronic
900003939 1:31789-31811 GTGTATATTCACAGGCATCGTGG - Intergenic
900023663 1:202308-202330 GTGTATATTCACAGGCATCGTGG - Intergenic
901804279 1:11728086-11728108 GTGGCTCATTACAGGCATGGTGG - Intergenic
901887438 1:12232490-12232512 GTGGCTGATGACTGACATGGTGG + Intronic
903163755 1:21507193-21507215 AGGGCAAATCACAGACATGGGGG + Intergenic
903795841 1:25928300-25928322 GTGGCTATTCACAGGTGTGATGG - Intergenic
905035029 1:34912659-34912681 ATGGCTTATCACAGGCATGGAGG - Intronic
905985180 1:42274110-42274132 GTGGCAATGAACACACATGGTGG - Intronic
906647389 1:47485269-47485291 GTGGCTATTAAGAAATATGGTGG + Intergenic
906730835 1:48079806-48079828 TTGGATATTTGCAGACATGGAGG - Intergenic
906824103 1:48960272-48960294 GTTGCCATTTACAGAAATGGGGG + Intronic
907547821 1:55277437-55277459 GTTGCTGTTAACAGACATGCTGG - Intergenic
911736109 1:101338219-101338241 GGGCCTATGGACAGACATGGAGG - Intergenic
916699599 1:167277752-167277774 GATGCTATTCACTGACATGTGGG - Intronic
922853634 1:228755612-228755634 GTGCACATTCACAGATATGGGGG - Intergenic
1062980527 10:1718564-1718586 GGGGCAATGCTCAGACATGGAGG - Intronic
1071875436 10:89838173-89838195 GTCGCTATTCACAGAGGGGGCGG + Intergenic
1072267327 10:93743236-93743258 GTAGCTATTCACAGGCATGATGG - Intergenic
1072694738 10:97594830-97594852 GTGTCTAATCCCACACATGGGGG + Intronic
1073913822 10:108378460-108378482 CTGGCTATCCACATCCATGGCGG - Intergenic
1077284976 11:1761626-1761648 GTTGCCATTCACTGACTTGGGGG - Intronic
1078060799 11:8041634-8041656 GTCTCTATGAACAGACATGGTGG - Intronic
1078237511 11:9499655-9499677 GTGGCTCTTCACAGGCACGATGG - Intronic
1085549793 11:77358338-77358360 ATGGCTATTCTCAGAGATGCAGG + Intronic
1088185974 11:107170619-107170641 ATGGCTGTTAACAAACATGGAGG - Intergenic
1091224191 11:133947635-133947657 GTGGCCAGACACAGACATGAAGG - Intronic
1091377360 12:33840-33862 GTGTATATTCACAGGCATCGTGG - Intergenic
1092942728 12:13425512-13425534 GTGACCATTCACAGATATGAAGG - Intergenic
1095651726 12:44619125-44619147 GTGGCTCTTGACAGACAGGGAGG + Intronic
1096620944 12:52865157-52865179 GTGTTTATTGACAGATATGGGGG - Intergenic
1096801127 12:54111231-54111253 GTGGGTAATCACAGACAGGGTGG - Intergenic
1098786895 12:74770702-74770724 ATGGCTCTGCACAGAGATGGAGG - Intergenic
1098793644 12:74860760-74860782 GTGGCTATTCCCAGCCATGAGGG - Intergenic
1099329614 12:81267146-81267168 ATGGCTAATAACAGACATGGAGG - Intronic
1103069805 12:117931916-117931938 ATGGGGATTCAAAGACATGGAGG + Intronic
1104132271 12:125905823-125905845 ATGGGGAATCACAGACATGGAGG - Intergenic
1104664524 12:130638179-130638201 GTGTCTATTCCCAAACAGGGTGG - Intronic
1109412928 13:61998044-61998066 GTGGATATTCATAGGCTTGGAGG - Intergenic
1111838731 13:93423022-93423044 GTGGTTAGAAACAGACATGGTGG + Intronic
1115791843 14:36888406-36888428 GTGGCAAATCACAGGCATGTTGG - Intronic
1116735004 14:48678047-48678069 GTGGCTATTTGCAGTGATGGTGG - Intergenic
1117221190 14:53608337-53608359 CTGTCTCTTCACAGACCTGGAGG + Intergenic
1120592667 14:86394320-86394342 GAAGTTATTTACAGACATGGTGG + Intergenic
1120654621 14:87174865-87174887 GTGGCAATACATAGACATGCAGG + Intergenic
1126695798 15:51324159-51324181 GGGGCTATTCCCACACATGAAGG + Intronic
1126739062 15:51759789-51759811 GAGGCTATTTACAAAGATGGGGG + Intronic
1129604455 15:77018052-77018074 GAGGCTGTTCCCAGAGATGGTGG + Intronic
1129747671 15:78036070-78036092 GTAGCTATGCACTGACATAGTGG + Intronic
1132449565 15:101959153-101959175 GTGTATATTCACAGGCATCGTGG + Intergenic
1132593868 16:739397-739419 GGGGCTATTTGCAGAGATGGTGG - Intronic
1133200293 16:4200165-4200187 CTGTGTATTCACAGACAGGGAGG - Intronic
1134662279 16:15993163-15993185 TGGGCTAGTCACAGGCATGGGGG - Intronic
1134971538 16:18535486-18535508 GGCGCTGTTCACAGAGATGGAGG - Intronic
1136004938 16:27323021-27323043 GTGGGGACACACAGACATGGGGG - Intronic
1136600996 16:31288233-31288255 GTGGCTTATCCCAGACATGCAGG + Intronic
1141855177 16:86676419-86676441 TTGGCTTTTCCCAGACAAGGTGG + Intergenic
1147652320 17:42069628-42069650 GTGGCTGTTGGCTGACATGGAGG - Intergenic
1150060332 17:62063503-62063525 CTTGCTATTCAGTGACATGGTGG - Intronic
1156779659 18:40836132-40836154 GTCTCTATTCACAGACATAATGG - Intergenic
1159663417 18:71127393-71127415 GTGGCTGTTCACATACATTTTGG + Intergenic
1160635691 19:73398-73420 GTGTATATTCACAGGCATCGTGG - Intergenic
1164294862 19:23900974-23900996 GTGGTTATACACACACCTGGTGG - Intergenic
1166067089 19:40366317-40366339 GGGGCTATTCATAATCATGGGGG - Intronic
1167827346 19:51986163-51986185 GTGGCTATTTACAGATCGGGGGG - Intronic
1168632472 19:57968215-57968237 GGTGCTATTCCCAGTCATGGGGG + Intronic
925308057 2:2864152-2864174 GAGCCTATGCACAGCCATGGTGG + Intergenic
926334588 2:11853683-11853705 GGGGACACTCACAGACATGGAGG + Intergenic
927078622 2:19605014-19605036 GTGACTCTTCAAAGACATAGAGG - Intergenic
932336756 2:70936062-70936084 GGGGCTACTCACTGACACGGGGG - Exonic
936565787 2:113581652-113581674 GTGTATATTCACAGGCATCGTGG + Intergenic
937393669 2:121515713-121515735 GTGGAAATTTACAGACATGTAGG - Exonic
941094730 2:161225284-161225306 GTGGCTATTCACAGGCCTGATGG + Intronic
941711501 2:168718970-168718992 ATGGCTAATCACACAGATGGGGG - Intronic
943168262 2:184361153-184361175 ATGGCTATTCATAGACAAAGAGG + Intergenic
944361009 2:198856538-198856560 CTGGGTATTCACAGACATAAAGG + Intergenic
948470669 2:238175833-238175855 GTGGCTATTCACAGACATGGTGG + Intronic
1171351278 20:24505071-24505093 AGGGCTGTTCACAGACGTGGTGG + Intronic
1171852895 20:30321029-30321051 GTGGGTAATCACAGACAGGGTGG - Intergenic
1171880497 20:30614805-30614827 GTGGCAATCCATAGCCATGGGGG - Intergenic
1174225335 20:48994243-48994265 GTGCCTATTAAGTGACATGGTGG + Intronic
1178539989 21:33441289-33441311 GTGGCACTTCAAAGACATAGTGG - Intronic
1179500168 21:41803656-41803678 TTGGCAAGTCACAGGCATGGGGG - Intronic
1182051463 22:27315822-27315844 GAGGCTGGTCACAGACATTGGGG - Intergenic
1182972316 22:34589973-34589995 ATGGCTATGCACAGACCTTGAGG - Intergenic
1184841803 22:47056566-47056588 GTGGCTGTGCACAGACGGGGTGG - Intronic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
954727244 3:52623238-52623260 GTGGCTATTCACAGGTGTGATGG - Intronic
957708582 3:83822748-83822770 CAGGCCATTCACAGAGATGGTGG - Intergenic
960245874 3:115399962-115399984 GTGGCTATTCAAAGGGATAGGGG - Intergenic
962606402 3:137035996-137036018 TGGGCTATTCTCAGGCATGGGGG + Intergenic
965548844 3:169943372-169943394 GTGGCTATTATCAGACATATCGG - Intergenic
971968844 4:33595655-33595677 GTGGCAAGACACAGGCATGGTGG - Intergenic
973291897 4:48479192-48479214 GTGGCTATTCATAGGCATGTAGG - Intergenic
973794798 4:54413928-54413950 GTGGCTATTTCCTCACATGGTGG + Intergenic
974084393 4:57244042-57244064 CTGTCTATACACAGACATAGTGG + Intergenic
982442310 4:155451533-155451555 AAGGCTATTAAAAGACATGGAGG - Intergenic
986003857 5:3651308-3651330 GAGGCTCTTCTGAGACATGGAGG - Intergenic
988479774 5:31620024-31620046 GTGGCTAATCACACACATAGAGG + Intergenic
988987581 5:36635903-36635925 GGGGCTAATCACAAACATGTGGG + Intronic
990669781 5:58115058-58115080 GAGACTATTCACAGAGATGTGGG - Intergenic
990943363 5:61226320-61226342 GAGGCTTTACCCAGACATGGTGG - Intergenic
990986321 5:61643967-61643989 GTTGCCATTCACTGATATGGAGG + Intronic
995001614 5:107138017-107138039 AAGGCTGTACACAGACATGGTGG + Intergenic
998923948 5:147101740-147101762 ATTGCTATTCACAGAAATGTAGG + Intergenic
1001086229 5:168701770-168701792 GTGGCTTGGCACAGACCTGGTGG + Intronic
1002965969 6:1966776-1966798 GGTGCTATTTACAGACAGGGAGG - Intronic
1006945938 6:37784557-37784579 GAGGCTATTTACAGAGGTGGGGG + Intergenic
1007501839 6:42304489-42304511 GTGGATATTCACATAGAGGGAGG - Intronic
1010927061 6:81755538-81755560 ATGGCCATTCCCAGAAATGGAGG + Intergenic
1011986597 6:93454911-93454933 GAGGCTATTTACAGAGATGGGGG - Intergenic
1012446645 6:99313940-99313962 GTAGCCATTCACAGAGTTGGAGG - Intronic
1013142543 6:107352581-107352603 GTTGGTATTCAAAAACATGGTGG + Intronic
1017950440 6:159130999-159131021 TTGGCTGTTCCCAGACAAGGAGG - Intergenic
1018100277 6:160432200-160432222 GTGCCCAGTCACTGACATGGAGG + Intronic
1019750949 7:2729385-2729407 GTGGCTCTTCACAGACCTCACGG - Exonic
1020793247 7:12652186-12652208 CTGGCTTATCACAGTCATGGAGG - Intronic
1021764958 7:23939625-23939647 GTGGCTATAGCCAGGCATGGTGG + Intergenic
1023079412 7:36513498-36513520 GAGGTTATACAGAGACATGGGGG - Intronic
1023898329 7:44453591-44453613 GCTGCTATTCAAAGCCATGGAGG - Intronic
1024339537 7:48243163-48243185 GTGTCTGTTCACAGATGTGGGGG + Intronic
1032803499 7:135335115-135335137 GTTGCTATTCAGAGTCCTGGAGG + Intergenic
1035784976 8:2253086-2253108 GTGGCTACACACATAGATGGGGG - Intergenic
1036610994 8:10349809-10349831 GTGGCCGTTCACAGACATCAAGG - Intronic
1039457294 8:37715943-37715965 CTGGCTATTCCCAAACATGTTGG - Intergenic
1042277215 8:67018473-67018495 GTGGCTATTCACAGGCATGTAGG + Intronic
1042847321 8:73181431-73181453 CTGGCTAATCACAGACATTGCGG - Intergenic
1046408024 8:113800484-113800506 GTTGCTTTTCACAGGCGTGGTGG + Intergenic
1047708975 8:127531123-127531145 GTGTATAATCAAAGACATGGAGG - Intergenic
1049886633 9:31571-31593 GTGTATATTCACAGGCATCGTGG - Intergenic
1049934989 9:493078-493100 GTGAATATTCAGAGACAGGGAGG - Intronic
1052056224 9:23910751-23910773 GTGGCTATTCACAAGCATGATGG - Intergenic
1052791397 9:32878344-32878366 GTGCCTATGCACAGACAGGCAGG - Intergenic
1053586164 9:39461438-39461460 GAGGTTATTGACAGTCATGGTGG - Intergenic
1053790690 9:41684328-41684350 GTGGGTAATCACAGACAGGGTGG - Intergenic
1054154472 9:61630444-61630466 GTGGGTAATCAAAGACAGGGTGG + Intergenic
1054179038 9:61896022-61896044 GTGGGTAATCACAGACAGGGTGG - Intergenic
1054474246 9:65561564-65561586 GTGGGTAATCACAGACAGGGTGG + Intergenic
1054580144 9:66903793-66903815 GAGGTTATTGACAGTCATGGTGG + Intronic
1054658500 9:67684799-67684821 GTGGGTAATCACAGACAGGGTGG + Intergenic
1059477809 9:114561840-114561862 GTGGCTCTTCCCAGACACAGGGG - Intergenic
1061873575 9:133533212-133533234 GTGCTGAATCACAGACATGGTGG - Intronic
1061882714 9:133576038-133576060 GTGGCTTTTCCCAGACAAGAGGG + Intergenic
1061926275 9:133807565-133807587 GTGGCCACTCACACACAGGGTGG + Intronic
1062524886 9:136974187-136974209 TTGGGTGTTCACTGACATGGGGG - Intergenic
1187235412 X:17462813-17462835 GTCTCAATTTACAGACATGGGGG + Intronic
1195170539 X:102263244-102263266 GTCCCTATTTACTGACATGGTGG + Intergenic
1195188320 X:102423855-102423877 GTCCCTATTTACTGACATGGTGG - Intronic
1196805583 X:119582274-119582296 CTAGCTATCCACAGACATGTGGG - Intronic
1198280664 X:135138813-135138835 GTGGCCATTTAGAGACATGGTGG + Intergenic
1198290295 X:135233701-135233723 GTGGCCATTTAGAGACATGGTGG - Intergenic