ID: 948471239

View in Genome Browser
Species Human (GRCh38)
Location 2:238181500-238181522
Sequence TTGGACTTCTTGGGAACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948471239_948471245 22 Left 948471239 2:238181500-238181522 CCAGTTGTTCCCAAGAAGTCCAA 0: 1
1: 0
2: 3
3: 39
4: 136
Right 948471245 2:238181545-238181567 ACTACTTCAGATTTTCTCTCTGG 0: 1
1: 0
2: 1
3: 26
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948471239 Original CRISPR TTGGACTTCTTGGGAACAAC TGG (reversed) Intronic
904323046 1:29709078-29709100 TTGGTCTTCTGGAGAACAGCAGG + Intergenic
904672060 1:32173425-32173447 TTGGAGTTCTTAGGGAAAACTGG - Exonic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907700378 1:56780812-56780834 TTGGACTTCAGGGACACAACAGG - Intronic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921661348 1:217806501-217806523 TGGGACTTCTTGGGTTCTACAGG - Intronic
924083217 1:240420889-240420911 TTGGATTTATTTGGAAAAACAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1067192247 10:44081557-44081579 CTTGACTGCTTGGGGACAACAGG + Intergenic
1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG + Intergenic
1068842325 10:61629655-61629677 TTGTACTTTTTGAGAAGAACTGG + Intergenic
1069958243 10:72064462-72064484 TAGGACTTCTTGGGGACCTCAGG - Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072696506 10:97607724-97607746 TTGTACTTATTGGGAAGAATTGG + Intronic
1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG + Intronic
1075540677 10:123311178-123311200 TTGGTCATCTTGGGATCAAGAGG + Intergenic
1075984593 10:126773530-126773552 TTGGACTTATTGGTATTAACTGG - Intergenic
1076271001 10:129152122-129152144 CAGGTTTTCTTGGGAACAACTGG + Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080903443 11:36517093-36517115 TTGAACTTGGTGGGAAAAACAGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083048068 11:59754470-59754492 TTTGTCTTCTTGGGAACAAATGG - Intronic
1083104085 11:60340823-60340845 ATTGACTTCTTGGGAAAAAACGG + Exonic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1086616893 11:88831749-88831771 TTGGACTGCTTGGGATCCAAAGG + Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1087655079 11:100912757-100912779 TTGGAGTTTTGGGGAACAACTGG - Intronic
1090157405 11:124455383-124455405 TTGGACTTCTTGGTACCAAGAGG - Intergenic
1092258176 12:6938299-6938321 TTGCCCTTCTTGGGATCCACAGG - Intronic
1092670460 12:10855508-10855530 AGGAACTTATTGGGAACAACTGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095705344 12:45230885-45230907 TTGAACTCCTGGGGAACTACAGG - Intronic
1095852591 12:46827103-46827125 TTAGATTTATTGGGAACAATAGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098340137 12:69442955-69442977 GTTGACGTCTTGAGAACAACAGG - Intergenic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1104812721 12:131628404-131628426 TTGTCCTTCCTGGGAAAAACAGG + Intergenic
1106220744 13:27744446-27744468 TTGGACTTGTTGGGGAGTACAGG - Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1111600163 13:90462558-90462580 ACGCACTTCTTGGGAACATCAGG - Intergenic
1112603039 13:100875769-100875791 TTGAACTTCTTGGGCAAACCAGG - Intergenic
1115138577 14:30141540-30141562 TTGGAGTGCATGGGAACAATTGG - Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1117164704 14:53021857-53021879 TTGTATCTCTTGGGAACAATAGG + Intergenic
1117545663 14:56793144-56793166 TTGTAGTTCTTGGTGACAACTGG - Intergenic
1119172408 14:72545182-72545204 TTGGACTCCTTTGGGACCACTGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1125967288 15:43884615-43884637 TTGGACTTTTTGGTAGCCACTGG + Intronic
1126000823 15:44208026-44208048 TTCGTCTTCTTGGAAACACCTGG - Intergenic
1127109485 15:55652446-55652468 TTGGACTGCAGGGGAACAATGGG - Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1142233315 16:88909921-88909943 TTGGATTTCTGGGGAACCAGAGG + Intronic
1143768857 17:9155093-9155115 CTGGACCTCTCTGGAACAACGGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1151090707 17:71437137-71437159 TTACATTTCTTGTGAACAACTGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155671411 18:28376539-28376561 TTGGACTTCTAGGGGACACTGGG - Intergenic
1155822577 18:30397155-30397177 TTGGACCTCTTGGGGACTGCTGG - Intergenic
1161328496 19:3674806-3674828 GTGGACTTCTTTGGAACAGGAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167354552 19:48995192-48995214 TTGGTTTTCATGGGAACAGCGGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926079470 2:9972749-9972771 TTGTACTTGTTTGGAACAACAGG + Intronic
926830211 2:16953760-16953782 TTGGACTTCTTTGGAGCAGATGG + Intergenic
928775408 2:34755261-34755283 TTGGACTTATTGGGCATTACAGG - Intergenic
929290695 2:40187475-40187497 TTGGTCTCCCTGGGAACAGCAGG - Intronic
929554521 2:42917296-42917318 TGGGACTTTTTGGGCAGAACTGG + Intergenic
929945810 2:46370961-46370983 GTGGGCTCCTTGGGAACAAGGGG + Intronic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
934956315 2:98623213-98623235 ATGAGTTTCTTGGGAACAACAGG + Exonic
936904604 2:117522805-117522827 TTGCACTTCATGGGAAAAATAGG - Intergenic
937660106 2:124420937-124420959 TTGGGCTTCTTGGAAATCACTGG - Intronic
937701879 2:124871636-124871658 GCGGACTTCTTGGTAGCAACCGG - Intronic
937866979 2:126759784-126759806 TTAGACCTTTTGGGAACTACTGG + Intergenic
939776482 2:146393439-146393461 TTGTTCTTCCTGGGAAAAACAGG + Intergenic
940533919 2:154914252-154914274 TTGCACTGCTTGTGAATAACAGG + Intergenic
940623594 2:156145102-156145124 TGGGAGTTTTTGGGAACATCTGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941720861 2:168811245-168811267 TTGTCCTTCCTGGGAACAATAGG + Intronic
943399226 2:187384335-187384357 ATGGACTTTTTGGGAAGAACAGG - Intronic
943816680 2:192266372-192266394 TTGGACTTTTTTAGAACAAGTGG + Intergenic
947342458 2:229154327-229154349 TTGGTGTGTTTGGGAACAACAGG - Intronic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
948973296 2:241445980-241446002 GTGGACTTCATGGGTCCAACAGG - Intronic
1173047526 20:39526774-39526796 TTGGACTCTTTGAGAATAACAGG + Intergenic
1174981291 20:55398295-55398317 GTGGCCGTCTTGGGAACAAGAGG - Intergenic
1175850994 20:62092898-62092920 TTGGACTTCTTGGATTTAACGGG + Intergenic
1177387065 21:20422448-20422470 TTGGTCTTCTTAAAAACAACAGG - Intergenic
1177757922 21:25369585-25369607 TTGTTCTTCATGGGAGCAACAGG - Intergenic
1179521557 21:41948728-41948750 TTGGACTTCGTGAGCACAACTGG + Intronic
1182780480 22:32863466-32863488 TTGGCCTAGTTGGGAACACCAGG + Intronic
1182944153 22:34306269-34306291 TTGATCTTCTTGGAAACAAAAGG - Intergenic
1184526436 22:45026472-45026494 TTGGACTTCTGGGGCTCTACAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950432031 3:12956319-12956341 TTAGGTTTCTTGGGAACAACTGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
952493658 3:33896862-33896884 TTGGACTTCATGGGCAGAACTGG - Intergenic
953118681 3:40017764-40017786 TTAGACATCTTAGGTACAACTGG - Intronic
954628193 3:52034395-52034417 TTGGACTTACAGGGAACAAAGGG + Intergenic
957298375 3:78360503-78360525 CTGGACCTCTTGGGCTCAACTGG - Intergenic
957943312 3:87032533-87032555 TTGTACTGCTTGGGTACAGCTGG - Intergenic
960655099 3:119994834-119994856 ATGGACATTTTTGGAACAACTGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
974564613 4:63566969-63566991 TTAGACCTTTTGGGGACAACTGG + Intergenic
976199623 4:82565194-82565216 TAGGAGTTCTTGGGAACAGGGGG - Intergenic
981216132 4:142170751-142170773 TTGGAATTCCTGGGAAGAACAGG + Intronic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983914168 4:173273491-173273513 TTGTACTTCTTCTGAACAACTGG + Intronic
984123569 4:175776810-175776832 GTGGAGTTCCTGGGAACAAAGGG + Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
992426074 5:76658633-76658655 TTGGACTGCTGGTGAAGAACAGG + Exonic
994335158 5:98556218-98556240 TTGGACTTCTTGGGGACATACGG + Intergenic
994489665 5:100424882-100424904 TAGGACTTGTTAGGAAAAACAGG + Intergenic
994916562 5:105987991-105988013 TTTGACTTTTTGAGAAGAACTGG - Intergenic
994957110 5:106546172-106546194 TTGGACTCCTTGGTAACATTTGG + Intergenic
996975269 5:129425565-129425587 ATGGAGGTCTTGGGCACAACAGG - Intergenic
1005925142 6:30438233-30438255 TTTGACTTCTTGGGCTCAAGTGG - Intergenic
1008874442 6:56310245-56310267 TTGGACTACTTTGGAAGACCTGG + Intronic
1009698770 6:67146235-67146257 TTGTACTTATTGGGAAGAATGGG + Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015575215 6:134664069-134664091 ATTGTCTTCTTGGGAACTACTGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028095615 7:86756507-86756529 TTGAAGTTCTGGGGAAAAACTGG - Intronic
1029382926 7:100225172-100225194 TTGGGCTTCTCTGGAAGAACAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030361756 7:108602616-108602638 TTTGACTTCTAGGGCACAAATGG + Intergenic
1031050371 7:116938752-116938774 TTGGACATTTTGGAAACAACTGG - Intergenic
1031113622 7:117642438-117642460 GTGGGCCTCTTGGGAAGAACTGG + Exonic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1034566281 7:151918217-151918239 CTGGACTGCTTGGGCACAGCTGG + Intergenic
1037523049 8:19698697-19698719 TTGGAATTCTTGTGAATCACCGG + Intronic
1037873777 8:22526157-22526179 TTAGACTTCTTGGTATCTACAGG + Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1043524785 8:81084214-81084236 TTGTACTTAGTGGGAAGAACAGG + Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1047416542 8:124668838-124668860 TTGCACTTCACGGGAACAAAGGG - Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059315287 9:113420045-113420067 TTTGACTTCTTTAGAACAAGAGG + Intronic
1187472533 X:19581935-19581957 GTGGACTTCTTGTGAAGAGCTGG - Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194886118 X:99318251-99318273 TTTGACTTCTTTGAAACCACAGG - Intergenic
1198004294 X:132476332-132476354 TTGCAATTCTTGGGAAGAAGGGG + Intronic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic