ID: 948473522

View in Genome Browser
Species Human (GRCh38)
Location 2:238202494-238202516
Sequence GTCTCCAGCCCCCGCTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948473511_948473522 24 Left 948473511 2:238202447-238202469 CCTTACTCACCTCCGTCTACCCT 0: 1
1: 0
2: 0
3: 17
4: 242
Right 948473522 2:238202494-238202516 GTCTCCAGCCCCCGCTGGGTTGG 0: 1
1: 0
2: 1
3: 13
4: 161
948473512_948473522 15 Left 948473512 2:238202456-238202478 CCTCCGTCTACCCTACAACAGCA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 948473522 2:238202494-238202516 GTCTCCAGCCCCCGCTGGGTTGG 0: 1
1: 0
2: 1
3: 13
4: 161
948473514_948473522 5 Left 948473514 2:238202466-238202488 CCCTACAACAGCAGCTCCCAAAC 0: 1
1: 1
2: 0
3: 21
4: 250
Right 948473522 2:238202494-238202516 GTCTCCAGCCCCCGCTGGGTTGG 0: 1
1: 0
2: 1
3: 13
4: 161
948473513_948473522 12 Left 948473513 2:238202459-238202481 CCGTCTACCCTACAACAGCAGCT 0: 1
1: 0
2: 0
3: 13
4: 178
Right 948473522 2:238202494-238202516 GTCTCCAGCCCCCGCTGGGTTGG 0: 1
1: 0
2: 1
3: 13
4: 161
948473515_948473522 4 Left 948473515 2:238202467-238202489 CCTACAACAGCAGCTCCCAAACC 0: 1
1: 1
2: 0
3: 31
4: 279
Right 948473522 2:238202494-238202516 GTCTCCAGCCCCCGCTGGGTTGG 0: 1
1: 0
2: 1
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948473522 Original CRISPR GTCTCCAGCCCCCGCTGGGT TGG Intronic
900599855 1:3498323-3498345 GTCTGCAGGCCCTGCTGGGAAGG - Intronic
900919766 1:5662774-5662796 GCCTCCTGCCCCTGCTGGGAAGG - Intergenic
901047354 1:6405220-6405242 GGCTCCGGCCTCTGCTGGGTGGG - Intergenic
901199085 1:7456699-7456721 GTCTCCAGCTCCCGCTTGGCTGG + Intronic
901934850 1:12619922-12619944 GACACCAGCCGCTGCTGGGTGGG - Intergenic
902518480 1:17002429-17002451 GTCTCCAGCCTGCACAGGGTGGG - Intronic
903305341 1:22409007-22409029 GCCCCCAGCCCCAGCTGGGATGG + Intergenic
904033983 1:27549456-27549478 GTGGCCAGGCCCCGCTGGGCAGG + Exonic
905445427 1:38025673-38025695 GTCTCTTGCCCCTGCTGGGTGGG + Intergenic
905682721 1:39885705-39885727 GTCTGCAGTCCCAGCTGGGGTGG - Intergenic
912951524 1:114123823-114123845 GTCTCCAGCCCCAGGTGGCCAGG + Intronic
914919485 1:151837976-151837998 CGCTGCTGCCCCCGCTGGGTGGG - Exonic
915092600 1:153437029-153437051 GTCTCCAGAGGCCCCTGGGTAGG + Intergenic
915105622 1:153533604-153533626 GTCTTCTGTCCCCACTGGGTGGG - Intergenic
915463379 1:156082348-156082370 GTCTCTAGCCCCCGCTGTCCAGG + Intergenic
916578580 1:166088399-166088421 ATCTGCAGACCCTGCTGGGTGGG + Intronic
919282029 1:195502756-195502778 GTATCCAGCCCCCGTTGGTTGGG - Intergenic
920895131 1:210040908-210040930 GTCTCCAGCCCCAGATAGCTGGG + Intronic
924771944 1:247087117-247087139 CACTTCAGCCCCCGCTGGGCTGG - Intergenic
1063368514 10:5506521-5506543 GTCTCCAGCTCTCCCTGGGATGG - Intergenic
1066367614 10:34792192-34792214 GGCTCCACCCAACGCTGGGTGGG + Intronic
1067564628 10:47327657-47327679 CCCTCCAGACCCCACTGGGTTGG + Intergenic
1070803102 10:79255009-79255031 GCCTCCAGCCCGGGCTGGCTGGG + Intronic
1073435299 10:103512676-103512698 TTCCCCAGCGCCCGCAGGGTTGG + Intronic
1076494043 10:130885260-130885282 GACCCCAGCACCAGCTGGGTGGG - Intergenic
1076740013 10:132478349-132478371 GTCTCTAGCCCCCTCTGGAGCGG + Intergenic
1077392343 11:2305795-2305817 CACTCCAGTCCCAGCTGGGTGGG + Intronic
1077600232 11:3569551-3569573 GGCTGCAGCCCCCGCTGAGCTGG - Intergenic
1078548609 11:12264507-12264529 GTCCTCAGCCTCCCCTGGGTGGG + Intergenic
1083270910 11:61572080-61572102 CTCTCCAGCCCCCGCCTGGTTGG - Intronic
1083853293 11:65379925-65379947 GTCTGCAGCCTCACCTGGGTGGG + Exonic
1083879047 11:65539327-65539349 GCCTCCCGCGCCCGCTGCGTGGG - Exonic
1084534105 11:69746667-69746689 GTCTCCAGTCCCGCCTGGGACGG + Intergenic
1084728703 11:71059563-71059585 GTCTTCATCCCTGGCTGGGTGGG + Intronic
1086937852 11:92764121-92764143 GTCTCCCTCCCCAGCTGGGCAGG - Intronic
1087855868 11:103091686-103091708 GTCTCCAGCCCCAGCCCGGCAGG + Intronic
1088706765 11:112470952-112470974 GGCTCCAGCTCCTGCTGGGCAGG + Intergenic
1090401163 11:126449202-126449224 GTGTCCAGCTCCCGGAGGGTTGG - Intronic
1091243516 11:134070613-134070635 ATGTCCAGCACCCGCTGTGTTGG + Intronic
1091996395 12:4997451-4997473 GTCTGCACCCTCCTCTGGGTGGG - Intergenic
1096242468 12:49966827-49966849 GTCTCCTGGCCCCGCTGGACAGG - Intergenic
1106325342 13:28684127-28684149 GTCTCCCGCCCCTGCAGGCTTGG + Intergenic
1112771645 13:102799892-102799914 GTCTCCACGCCACGCTGGGCAGG + Intronic
1113917662 13:113884050-113884072 GGCTCCAGCACCGGCTGTGTGGG + Intergenic
1113932369 13:113975154-113975176 GCCTCCAGACCACGGTGGGTGGG + Intergenic
1115202998 14:30874186-30874208 AGCTCCAGGCCTCGCTGGGTGGG + Intergenic
1119290353 14:73490896-73490918 GCCTCCAGCCACCTCGGGGTTGG - Intronic
1119551146 14:75514985-75515007 GCCTCAAGCCCCCTCTGCGTGGG + Intergenic
1121104895 14:91273404-91273426 GTCTCGGGGCCACGCTGGGTGGG + Exonic
1122010650 14:98743759-98743781 ATCTCCAGCTCCTGCTGGCTTGG - Intergenic
1122123825 14:99568602-99568624 CTCTGCAGCCCCCTCGGGGTTGG - Intronic
1122546580 14:102526164-102526186 GTCTCCGGCTCTGGCTGGGTAGG - Intergenic
1122783000 14:104151536-104151558 GTCTCCAGCCCCGGTGGGGCAGG - Intronic
1123033395 14:105461649-105461671 GTCTCCAGCCTCTGCTGCGCTGG - Intronic
1129221388 15:74133705-74133727 GACTCCAGCACCCGCTTGGCCGG + Exonic
1129373063 15:75109969-75109991 ATCTCCACCCCCGGCAGGGTTGG + Intronic
1130133193 15:81160663-81160685 ATCTCCAGCTCCTTCTGGGTGGG - Intronic
1130877022 15:88023469-88023491 ATCTCCAGGCCCTGCTTGGTAGG - Intronic
1132463637 16:67753-67775 CTCTGAAGCCACCGCTGGGTAGG + Intronic
1132690397 16:1179373-1179395 CTCTCCTGCCCCCGCGAGGTTGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133045511 16:3086500-3086522 GTCTCCATGCCCTGGTGGGTTGG + Intergenic
1133270394 16:4608497-4608519 GCCTCCAGCACACACTGGGTAGG - Intergenic
1133473362 16:6096839-6096861 GTCATCAGCCTCCGCTGGGAAGG + Intronic
1138163336 16:54776852-54776874 GCCTCCAGCCCCCACAGTGTGGG + Intergenic
1138172491 16:54866081-54866103 GCCTCCAGGCTCAGCTGGGTAGG - Intergenic
1139921192 16:70461550-70461572 GGCTGCAGCCCCCGCTGGGCTGG + Intronic
1141604582 16:85145534-85145556 TTCCCCAGGCCCCGCTGGGATGG - Intergenic
1142184116 16:88686339-88686361 GTCTCCAGCCGCCGGTAGTTGGG + Exonic
1142376873 16:89711139-89711161 GCCCCCCGCCCCCGCTGGGGAGG + Intronic
1142851847 17:2708161-2708183 GGCTCCCGCCCACCCTGGGTAGG - Intronic
1142982197 17:3678787-3678809 GTGTCCAGCCCCCACTGGGAGGG + Intronic
1143545562 17:7593102-7593124 GTCGCCAGGCCCAGCTCGGTTGG + Exonic
1143659033 17:8313417-8313439 GACTCCAGCCCCAGCAGGGATGG - Intronic
1144727346 17:17508422-17508444 GTCTCCAACCCCCGCTGCTACGG + Intronic
1145282062 17:21475398-21475420 GTCACCAGCAGCCTCTGGGTAGG - Intergenic
1145784357 17:27584460-27584482 TTCTACAGCCCCTTCTGGGTGGG - Intronic
1145808250 17:27749953-27749975 GTGTCTAGGCCCAGCTGGGTGGG + Intergenic
1146062286 17:29613661-29613683 GTCTCCAGCCGCCGCTCTGCAGG - Exonic
1147214349 17:38890699-38890721 CTCTCCAACCCCCTCTAGGTAGG - Intronic
1147400575 17:40178075-40178097 GGCTCCAGCCCCGGCTCGGCGGG - Intronic
1150251358 17:63706482-63706504 GTCACTATCCCCCACTGGGTGGG + Intronic
1151522666 17:74641492-74641514 GGCTCCAGCCTCAGATGGGTGGG - Intergenic
1152638665 17:81440563-81440585 CTCTCCACACCCAGCTGGGTGGG - Intronic
1152639259 17:81442869-81442891 GTCACCAGGACCCGCTGGGCGGG + Exonic
1160740426 19:683025-683047 GTCGCCAGCCCCGGCTGCATTGG - Exonic
1160935545 19:1592827-1592849 CTCGCCAGCCCCCGCTCGGGGGG + Intergenic
1161447564 19:4327061-4327083 CTCTCCCGCCCCCGCTCGGACGG - Intronic
1163379028 19:16952138-16952160 GACTCCATCACCAGCTGGGTGGG - Exonic
1166560849 19:43731508-43731530 ATGTCCATCCCCCGCTGGGGTGG - Exonic
1166851906 19:45765298-45765320 GTCTCCATCCCCCTTTGGATGGG - Exonic
1167659217 19:50786113-50786135 GACTCCAGCCACCCCTTGGTTGG + Intergenic
927518469 2:23685693-23685715 GTCTCCTGCCCCCGGTGCTTGGG + Intronic
929775594 2:44929118-44929140 GTCCCCAGCCCCAGCTGGACAGG - Intergenic
929961547 2:46500227-46500249 TCCTCCCGCCGCCGCTGGGTCGG + Intronic
931758470 2:65395281-65395303 GTCTTCAGCCCCAGCTGAATGGG + Intronic
936938297 2:117859031-117859053 GTCTCCCGACGCCGCTGGGTGGG + Intergenic
936945997 2:117931447-117931469 GTCTCCAGACACTGCCGGGTGGG - Intronic
938111920 2:128573644-128573666 CTCCCCAGCCCCAGCTGGGGTGG - Intergenic
942228385 2:173836816-173836838 AGCTCCAGTCCCCCCTGGGTTGG + Intergenic
945066838 2:205954831-205954853 GTGTTCTGCCCCAGCTGGGTAGG - Intergenic
948473522 2:238202494-238202516 GTCTCCAGCCCCCGCTGGGTTGG + Intronic
1172149677 20:32780875-32780897 GGATCCCGCCCCAGCTGGGTTGG + Intronic
1172793567 20:37522545-37522567 CTCTCCAGCCTACGCTGGATGGG + Intronic
1173310151 20:41890101-41890123 CTCTCCACACCCCACTGGGTCGG + Intergenic
1174186092 20:48707298-48707320 CTCTCCAGCCTCGGCTGGGCAGG + Intronic
1174709380 20:52688642-52688664 CTCTCCAGGCCCAGATGGGTGGG + Intergenic
1176009832 20:62887076-62887098 CTCTCCAGCAGCTGCTGGGTGGG + Intronic
1180957062 22:19745900-19745922 GGATCCAGCCCCGGCTGGGCAGG - Intergenic
1180996837 22:19970107-19970129 TTCTCCAGCCCATGCTGGCTGGG - Exonic
1184499682 22:44864044-44864066 GACTCCATCCCCAGCTGGGATGG - Intergenic
1184518998 22:44981311-44981333 GTCTCCAGCAGCCCCTGGCTGGG + Intronic
950111914 3:10424083-10424105 GTCTGCAGCCCCAGCCGAGTGGG - Intronic
950542468 3:13620584-13620606 GGATCCAGCACCTGCTGGGTTGG + Intronic
950549588 3:13658087-13658109 GTCTCCAGCCCCGGCTACCTGGG - Intergenic
950630148 3:14276788-14276810 TTCTCCAGCTCCCAGTGGGTGGG - Intergenic
954812163 3:53255206-53255228 GTCTCCTGCCACCCCTGGGTTGG - Intronic
957071060 3:75568202-75568224 GGCTGCAGCCCCCGCTGAGCTGG - Intergenic
961283055 3:125778522-125778544 GGCTGCAGCCCCCGCTGAGCTGG + Intergenic
962084165 3:132173296-132173318 GTCTGCAGGCCCGGATGGGTCGG - Intronic
966734530 3:183178851-183178873 GTCTGCGGCCCCCGCCGGGTTGG + Exonic
966820522 3:183920694-183920716 GTCTCCAGCCACCCCTGGAGCGG + Exonic
968084395 3:195867963-195867985 GTCTCCAGCCCCCCCGGGCGAGG - Exonic
968955919 4:3719359-3719381 GGTGCCAGGCCCCGCTGGGTGGG - Intergenic
969014659 4:4095900-4095922 GGCTGCAGCCCCCGCTGAGCTGG - Intergenic
969460224 4:7325116-7325138 GTCCCCAGGCCCCCTTGGGTGGG + Intronic
969569047 4:7997681-7997703 GTCTCCTGCTGCTGCTGGGTGGG + Intronic
969643161 4:8411289-8411311 GGTTCCAGCCCCTGCAGGGTGGG + Intronic
970333230 4:15004508-15004530 AACCCCAGCCCCCGGTGGGTTGG + Intronic
971426843 4:26524520-26524542 GTCTGCACCGCCCGCTGGCTCGG - Intergenic
983673064 4:170260239-170260261 GTCTCCAGCCACCTCTCGCTGGG - Intergenic
987322831 5:16786108-16786130 CTCTCCGGCCCCTGGTGGGTAGG - Intronic
1001587944 5:172845904-172845926 GTCCCCAGGCTCCTCTGGGTGGG + Intronic
1002050696 5:176568911-176568933 GTGGTGAGCCCCCGCTGGGTGGG - Intronic
1003105554 6:3212365-3212387 GTCTCTCTCCCCCGCTGGCTTGG + Intergenic
1003618124 6:7673387-7673409 GTCCCCAGCCCGGGCTGGGGCGG + Intergenic
1005847483 6:29792801-29792823 GTCTCCAGGTCCCGCTGCCTCGG - Intergenic
1005930720 6:30481865-30481887 GTCTCCAGCCCCAGCACGTTGGG - Intergenic
1006360998 6:33586916-33586938 GGCTCCAGCCCCCACTGCCTGGG + Intergenic
1007310722 6:40944134-40944156 GACTCCAGCCCCATCTGGGAGGG + Intergenic
1011590539 6:88966362-88966384 TTCCCCAGCCCCAGCTGGGAGGG - Intergenic
1017250233 6:152272346-152272368 GTCACCAGTCCCCACTGGGTGGG + Intronic
1017801034 6:157896906-157896928 GGCTCCAGCCCCCTCTGGCTGGG - Exonic
1019205865 6:170361053-170361075 GTCACCAGCCACTGTTGGGTAGG + Intronic
1019594993 7:1854333-1854355 GTCCCCAACCCCCGCTGTGGGGG + Intronic
1019742160 7:2680370-2680392 GTCTCCAGTGCCTGCTGGGTGGG - Intronic
1020114706 7:5470109-5470131 ATCTCTAGCCCCTGCTGGGAAGG - Intronic
1023200972 7:37696035-37696057 GCCTCCAGCCACCTCTGGTTTGG + Intronic
1024491080 7:49986400-49986422 GGCCCCAGCCCCAGCTGGGAGGG - Intronic
1029373946 7:100166895-100166917 GTCACCAGCCCCAGGTGGGATGG + Intronic
1029795550 7:102890525-102890547 CTCTCCAGCTGCCTCTGGGTGGG + Intronic
1030866985 7:114711868-114711890 GTCACCTTCCCCCGCTGGATGGG - Intergenic
1032130702 7:129225201-129225223 GTCTCCACCGCCCGCCGGGGGGG - Exonic
1033210138 7:139454171-139454193 GTCTCCAGGCACTCCTGGGTGGG - Exonic
1034708708 7:153171246-153171268 GTCACCAGCCCCTGCGGGTTGGG + Intergenic
1035290870 7:157837658-157837680 GCATCCAGCCCCCGCAGGGCAGG + Intronic
1035519437 8:265698-265720 GTCTCCAGCCTGCGCTGGGTGGG - Intergenic
1035741232 8:1929988-1930010 CTCTCCAGCCCCTGCCGCGTTGG + Intronic
1037647860 8:20810179-20810201 GTCTCCAGCCCACCCTGAGAAGG - Intergenic
1037912060 8:22749424-22749446 CTCTCCAGCTCTAGCTGGGTAGG - Intronic
1040319874 8:46287095-46287117 CCCTCCAGCGCCCCCTGGGTGGG - Intergenic
1040408620 8:47133475-47133497 GTCTCCAGGCCCTGCTGAGCGGG + Intergenic
1043372848 8:79613036-79613058 GTCTCGCGCCCGGGCTGGGTGGG - Intronic
1049001179 8:139826451-139826473 GCCTCCTTCCCCCGCAGGGTCGG + Intronic
1049288500 8:141789348-141789370 GCCTCCATCCCCCTCTGGGGTGG - Intergenic
1049361864 8:142215794-142215816 GTGTCCAGGCCCAGCTGGGTGGG - Intronic
1053282400 9:36829204-36829226 CTCTCTAACCCCAGCTGGGTTGG - Intergenic
1053509069 9:38671939-38671961 GTCTCTAGCCCCCACGGGGAGGG - Intergenic
1055321591 9:75088201-75088223 GGTTCCAGCCCCCGTTGGGGCGG + Exonic
1056922337 9:90801817-90801839 CTCTCCAGCCGCCGCCGGGGTGG - Exonic
1057726790 9:97573676-97573698 GTCTCCTGCCCACGCTGTGAGGG - Intronic
1061669837 9:132182527-132182549 GCCTCCAGGACCCCCTGGGTGGG - Intronic
1185505359 X:629683-629705 GTCCCCAGGCCCCGCCGGGGAGG + Intronic
1187169809 X:16840027-16840049 GACTCCAGCCCGCGTTGGGGCGG + Intronic
1192197430 X:69037969-69037991 GTCCCCTGCCACTGCTGGGTGGG - Intergenic
1199713391 X:150488290-150488312 CTCTCCAGGCCCTGCTGAGTTGG - Intronic