ID: 948477099

View in Genome Browser
Species Human (GRCh38)
Location 2:238227259-238227281
Sequence GACTCAGCCTTGGTGCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948477096_948477099 -10 Left 948477096 2:238227246-238227268 CCAGAAGTCCAGGGACTCAGCCT 0: 1
1: 0
2: 2
3: 28
4: 308
Right 948477099 2:238227259-238227281 GACTCAGCCTTGGTGCAGACTGG 0: 1
1: 1
2: 0
3: 17
4: 199
948477094_948477099 -1 Left 948477094 2:238227237-238227259 CCTCTCTCTCCAGAAGTCCAGGG 0: 1
1: 0
2: 1
3: 25
4: 312
Right 948477099 2:238227259-238227281 GACTCAGCCTTGGTGCAGACTGG 0: 1
1: 1
2: 0
3: 17
4: 199
948477092_948477099 0 Left 948477092 2:238227236-238227258 CCCTCTCTCTCCAGAAGTCCAGG 0: 1
1: 0
2: 1
3: 33
4: 334
Right 948477099 2:238227259-238227281 GACTCAGCCTTGGTGCAGACTGG 0: 1
1: 1
2: 0
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948477099 Original CRISPR GACTCAGCCTTGGTGCAGAC TGG Intronic
900583286 1:3419820-3419842 GACACAGCCCTGGGGCAGCCGGG - Intronic
900759548 1:4461796-4461818 GAGACAGCCGTGGTGCAAACTGG + Intergenic
900925810 1:5705493-5705515 GCCACAGCCTGGGTGCAGACTGG - Intergenic
901387711 1:8922000-8922022 GAGTCAGGCTTGGAGCAGGCAGG - Intergenic
901429427 1:9203901-9203923 ACCTCAGCCTGGGTGCAGCCAGG - Intergenic
902369975 1:15999917-15999939 CACTCAGTCTTTGTGAAGACTGG + Intergenic
904358442 1:29956793-29956815 GACCCAGCCATGGTGAAGCCAGG + Intergenic
905912818 1:41665268-41665290 AACTCTGCCTTTCTGCAGACTGG - Intronic
906626868 1:47332822-47332844 AACTGAGCCTTGGTGCATACAGG - Intergenic
909015340 1:70373935-70373957 GACTCAGCCTGCCTGCAGCCAGG + Intronic
913501502 1:119476389-119476411 GACTCAGCCATGGACCCGACAGG + Intergenic
917456731 1:175192412-175192434 GACTCAGCCCAGGCGCAGAGAGG + Intronic
917630256 1:176884483-176884505 GTCTCAGCCTGTGTGCAGACAGG + Exonic
919943677 1:202305171-202305193 GACTCAGCCTTGCCACTGACTGG + Intronic
923250883 1:232178766-232178788 GACTGAGCCTAGGTGCAGGGAGG + Intergenic
1064372674 10:14766727-14766749 GAATCAGTCTTGGTGAAGAGGGG - Intronic
1065045948 10:21747754-21747776 GCCTTTGCCTGGGTGCAGACTGG + Intergenic
1065732498 10:28722321-28722343 AACTCAGCCTCTGGGCAGACCGG + Intergenic
1065973652 10:30824236-30824258 CCCTCAGCCTTGCTGCACACGGG - Intronic
1066952014 10:42128710-42128732 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1068528887 10:58162699-58162721 GTCTCAGCCTGGGTCCAGTCAGG - Intergenic
1069637079 10:69931381-69931403 GACCCAGCCTGGGAGCAGGCAGG + Intronic
1069919464 10:71807737-71807759 TACTCAGCCTTGGTGAAGCGTGG - Exonic
1072788148 10:98298460-98298482 GAATCACCCCTGGTGCAAACAGG - Intergenic
1076249926 10:128977633-128977655 GACTCTGCCTGCGTGCAGATGGG - Intergenic
1077618420 11:3696491-3696513 GACTCTGTCTTGGTGCAGGGGGG + Intronic
1078406997 11:11079145-11079167 GCCCCAGCCTAGGTACAGACAGG + Intergenic
1078577676 11:12515759-12515781 GACTCACCCTAGGTGGACACGGG - Intronic
1085055132 11:73398867-73398889 CACCCAGCCTTGGTGCACCCTGG - Intergenic
1087114920 11:94514380-94514402 GACTCAGCCTAAGTAGAGACAGG + Intergenic
1090441019 11:126725755-126725777 GGCCCTGCCTTTGTGCAGACTGG - Intronic
1090765063 11:129869507-129869529 GACACAACCGTGGTGCTGACAGG + Exonic
1092231561 12:6778442-6778464 GACTCAGGCTTGCTGCTGACAGG - Exonic
1092974477 12:13730973-13730995 GACACAGGCCTGGTGGAGACAGG - Intronic
1095152790 12:38815089-38815111 GAGTCTGCCTAGGTGCAGAGAGG - Intronic
1096442840 12:51660252-51660274 GACACAGTCTTGGAGAAGACAGG + Intronic
1097014227 12:55974101-55974123 GACACAGGCTTGGGGCCGACGGG + Exonic
1102534100 12:113568157-113568179 GACTCAGCCTAGGGGCATGCAGG + Intergenic
1103536836 12:121639052-121639074 GGCCCAGCCCTGGTGCAGGCTGG - Intronic
1104561372 12:129848152-129848174 GACGCACCCTTGGTTCAGAGAGG - Intronic
1105232931 13:18516481-18516503 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1105480775 13:20773621-20773643 TAGGCAGCCTTGGTGCTGACGGG - Intronic
1106124060 13:26885695-26885717 GAGGCAGGCTTGGTGCAGAATGG - Intergenic
1107031092 13:35854442-35854464 GTCTCAGCCTTGGTGCAGACAGG - Intronic
1108003691 13:45927083-45927105 GATACAGACTTGGTACAGACTGG + Intergenic
1113553722 13:111214299-111214321 GCCTCAGCCCTGGTGCTGGCTGG + Intronic
1116396096 14:44450145-44450167 GACTCAGCCTGCCTGCAGCCAGG - Intergenic
1116929826 14:50679205-50679227 GACTCAGCCTACCTGCACACAGG - Intergenic
1118069901 14:62235006-62235028 GACTCAGCTTTGGAGCTCACTGG + Intergenic
1120561581 14:86000703-86000725 GACTCACTCTTTGTCCAGACTGG + Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1202938040 14_KI270725v1_random:111334-111356 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG + Intronic
1126260237 15:46681051-46681073 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1131765018 15:95666411-95666433 AAGTCAGCCTTGGTGCACCCGGG + Intergenic
1132050212 15:98601512-98601534 GACTCTGCCTTGGTGGGGCCGGG - Intergenic
1132495672 16:262142-262164 GAGGCAGCCTTGGTGTGGACGGG + Exonic
1133175117 16:4008684-4008706 GACTCAGCCTGTGAGCAGGCAGG + Intronic
1133198428 16:4187228-4187250 CACCCAGCCTGGGTGCAGCCTGG + Intergenic
1134807860 16:17140969-17140991 CACGCAGCCTCTGTGCAGACTGG + Intronic
1136221632 16:28833182-28833204 GACTCTGTCTTGGAGGAGACGGG - Exonic
1136936218 16:34468078-34468100 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1136940259 16:34517913-34517935 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1136945506 16:34645875-34645897 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1136948432 16:34685022-34685044 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1136955831 16:34784896-34784918 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1136959561 16:34830656-34830678 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1136963602 16:34880492-34880514 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1136967745 16:34935023-34935045 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1137220455 16:46444583-46444605 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1137339339 16:47584592-47584614 ACCACAGCCTTGGTGCAGAAGGG + Intronic
1138578691 16:57925561-57925583 TCCTCAGCCTTGGTGAACACAGG + Intronic
1140207974 16:72948991-72949013 GACTCAGCTATGGTGCAGTGAGG - Intronic
1140544020 16:75788985-75789007 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1142435997 16:90057839-90057861 TACTCATCCTTCCTGCAGACTGG + Exonic
1142562583 17:819583-819605 GATTCAGCGTTGGTGCAGTGGGG - Intronic
1143056810 17:4168897-4168919 ATCTCAGCTTTGGTGCAGGCAGG + Intronic
1144684245 17:17215756-17215778 GACCCAGCCTGGGTGCTGATTGG + Intronic
1144847327 17:18226671-18226693 CACTCCACCTTGGTGCAGAAAGG - Intronic
1145691776 17:26748959-26748981 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1146371465 17:32267288-32267310 GACTCAGCCTTGGAAGAGAATGG + Intronic
1149344462 17:55720553-55720575 GACTTGGCGTTGGAGCAGACTGG - Exonic
1151991299 17:77576347-77576369 GACTCAGCAATGGGACAGACAGG - Intergenic
1152019220 17:77771751-77771773 GCCTCGGCCTTGGGGCTGACAGG + Intergenic
1152158114 17:78648243-78648265 GCCTCGGCCTTGCTGCAGTCCGG - Intergenic
1152482748 17:80566111-80566133 GACTCAGACCAGGAGCAGACAGG - Intronic
1152808776 17:82371542-82371564 GGGTCAGCCTTGGGGCAGCCGGG + Intergenic
1152939656 17:83161501-83161523 GACCCAGCCCTGGTGCACAGTGG - Intergenic
1203183296 17_KI270729v1_random:86504-86526 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1153433620 18:5045550-5045572 GAGTCACCCTTGGTGCAAAGTGG - Intergenic
1153770893 18:8415787-8415809 GGATCAGTCTGGGTGCAGACTGG - Intergenic
1153786368 18:8538579-8538601 AACCCATCCTTGGTGCAAACAGG - Intergenic
1154520373 18:15221975-15221997 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1158703437 18:59770114-59770136 GACTCCTCATTGGGGCAGACAGG + Intergenic
1159619477 18:70620798-70620820 GACTCTGCATTGATGCAGCCAGG + Intergenic
1161456709 19:4373255-4373277 GCCTCTGCCTTGGGGCTGACTGG + Intronic
1162291683 19:9785556-9785578 GACTCGGTCTTGGTTGAGACAGG - Intronic
1167046142 19:47049934-47049956 GACTCAGCCTGCCTGCAGCCAGG - Intergenic
1167046902 19:47055047-47055069 GACTCAGCCTGCCTGCAGCCAGG - Intergenic
1202671410 1_KI270709v1_random:57050-57072 GAATCTGCCTTGATGCAGCCAGG - Intergenic
925119164 2:1403966-1403988 GACTCTGAATTGGTGCAGGCTGG - Intronic
925372695 2:3358763-3358785 GGCTCAGCCTTGGAGTAGTCAGG - Intronic
925547729 2:5036671-5036693 GAAGCAGGCGTGGTGCAGACAGG - Intergenic
925850247 2:8074408-8074430 GATTCAGCCTTGGCACAGAAAGG + Intergenic
925906850 2:8544845-8544867 GGGTCTGCCTTGGTGCAGAGAGG - Intergenic
926104911 2:10143997-10144019 GAGACAGCCTTGGTGGAGACGGG - Intronic
926152384 2:10432393-10432415 GACTCCGGCTTGGGGCAGCCTGG + Intergenic
928427766 2:31192927-31192949 GACTCTGCCTTGGTGCACATTGG + Intronic
930251481 2:49039422-49039444 GACTCAGCCTTCGTGGAGGAGGG + Intronic
931438050 2:62266071-62266093 GACTCAGCTTCGGGGCAGAATGG + Intergenic
932453624 2:71832062-71832084 GGCTCAGCCTGGGAGGAGACTGG - Intergenic
933369524 2:81397332-81397354 GACTCAGCCTTCCTGCACCCAGG - Intergenic
934250001 2:90343260-90343282 GAATCTGCCTTGATGCAGCCAGG + Intergenic
934259571 2:91460181-91460203 GAATCTGCCTTGATGCAGCCAGG - Intergenic
934302867 2:91792101-91792123 GAATCTGCCTTGATGCAGCCAGG - Intergenic
934330394 2:92060666-92060688 GAATCTGCCTTGATGCAGCCAGG + Intergenic
934468615 2:94290562-94290584 GAATCTGCCTTGATGCAGCCAGG + Intergenic
934859822 2:97755358-97755380 AACGGAGCCTTGGTGCAGACTGG - Intergenic
937348365 2:121142574-121142596 GACCCATCCTGGGTGCAGGCAGG - Intergenic
938519730 2:132055750-132055772 GAATCTGCCTTGATGCAGCCAGG + Intergenic
939162676 2:138608257-138608279 AACACAGCCCTGGTGCAGTCTGG - Intergenic
946481414 2:220060370-220060392 GACTCAGCCCTGGAGCAGTGTGG + Intergenic
947585974 2:231357226-231357248 CACTCAGCCTTGGTGGTCACGGG + Intronic
948477099 2:238227259-238227281 GACTCAGCCTTGGTGCAGACTGG + Intronic
1168805094 20:667917-667939 GATTCAGCCATGATGCAGAAAGG - Intronic
1170513908 20:17107968-17107990 GACTGAGGTTTGGTGTAGACCGG - Intergenic
1171114465 20:22512689-22512711 GACTCAGCCTAGCAGCTGACTGG - Intergenic
1173291847 20:41722198-41722220 GACTCAGCTTTGGTGAATAGAGG + Intergenic
1173993197 20:47318674-47318696 AAGTCAGCCAGGGTGCAGACCGG - Intronic
1175101226 20:56580164-56580186 GACACAGCCCAGGTGCAGTCAGG - Intergenic
1176585276 21:8577802-8577824 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1176776908 21:13144783-13144805 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1179982936 21:44905860-44905882 GAGTTAGCCTTGGGGCAGAGTGG - Intronic
1180268085 22:10554701-10554723 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1180524872 22:16248090-16248112 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1180600632 22:17012927-17012949 GACTGAGCCATGGTGAAGACAGG - Intergenic
1184122172 22:42458986-42459008 GTCTCAGCCTGTGTACAGACTGG - Intergenic
1184314507 22:43674358-43674380 GTCTCTGCCTTTGTGGAGACAGG + Intronic
1184910225 22:47527218-47527240 GATTCTGCCTTGCTGAAGACAGG + Intergenic
1185100367 22:48837013-48837035 GTCTGAGCCTTGGGGCAGCCTGG + Intronic
1203237118 22_KI270732v1_random:14997-15019 GAATCTGCCTTGATGCAGCCAGG - Intergenic
950669010 3:14514055-14514077 GACTCTGCCTTCAGGCAGACAGG + Intronic
950717896 3:14862719-14862741 GGCTCAACCTTGGTGAGGACTGG + Intronic
950920304 3:16687317-16687339 TTCTCATCCCTGGTGCAGACAGG - Intergenic
955076930 3:55622723-55622745 TACTCTGCCTTGGTCCAGAAAGG + Intronic
955253086 3:57304176-57304198 GACTCAGCCTGCGTGCACCCAGG + Intronic
959100160 3:102001076-102001098 TACTGGGCCTTGGTGGAGACAGG - Intergenic
968723545 4:2226281-2226303 GGCTCAGTCTTGTTGCAGTCAGG - Intronic
969229580 4:5820659-5820681 GACTCACTCTTGGTAGAGACTGG - Intronic
969707402 4:8819279-8819301 GGCTCAGCCTGGGTGCACACTGG + Intergenic
970724491 4:19028009-19028031 GACTCAGCCTTCCTGCACCCAGG - Intergenic
975683529 4:76898034-76898056 GACTCAGCCTTGGGGCCACCCGG - Exonic
975739136 4:77411668-77411690 CACTCAGCTTTTGTGCACACAGG - Intronic
978492782 4:109326542-109326564 GACTCATCTTTGGTGCAAATTGG + Intergenic
983979212 4:173973530-173973552 GGCTCAGCCTAAGTGAAGACTGG + Intergenic
985717558 5:1471234-1471256 GAATCAGCCTTGGTGCTTAGGGG - Intronic
985757822 5:1729778-1729800 GACCCAGCCTGTGTGCAGAGGGG + Intergenic
986001425 5:3633783-3633805 GAGTCACCCTTGGTGCAAAGAGG - Intergenic
986554534 5:8998433-8998455 GACTCAGCCTGCGTGCACCCAGG - Intergenic
988441697 5:31241232-31241254 AACTCAGCCTTGGTTCACATGGG - Intronic
992173165 5:74124025-74124047 TCCTCAGCCTTGGTGCAGTCAGG - Intergenic
996357875 5:122616958-122616980 GACTCAGCCTGCATGCAGCCAGG - Intergenic
997695281 5:135856557-135856579 CACACAGCCTTGGGGCAGCCAGG - Intronic
1002094904 5:176824916-176824938 GACGCAGCCTTGGTGTGCACGGG - Intronic
1004135908 6:12966205-12966227 GACTCAGGCTGGGGGCAGACGGG + Intronic
1005151397 6:22755881-22755903 GAGACAGCCTTGGTGCAGAAAGG - Intergenic
1006894410 6:37457876-37457898 GATTTAGCTTTGTTGCAGACTGG + Intronic
1007320016 6:41021354-41021376 CTCTCACCCTTGGTGCAGTCAGG - Intergenic
1007634303 6:43288528-43288550 GAGTCTGGCTTTGTGCAGACAGG + Intergenic
1013370668 6:109468295-109468317 GAGTGAGCCTTGATGCAGTCAGG + Intronic
1013479909 6:110544410-110544432 GACTCTGCCTGGGTGGAGATAGG - Intergenic
1018984122 6:168622957-168622979 CAGTCAGCCTTAGTGCACACTGG + Intronic
1019304876 7:328560-328582 GACACAGCCTGGGTGGGGACAGG - Intergenic
1019594487 7:1852110-1852132 GACCCAGACTTGGGGCAGAGCGG + Intronic
1019670397 7:2274929-2274951 AGCCCAGCCTTGGTGCAGGCAGG - Intronic
1021100833 7:16585015-16585037 GACTCTGTCTTGGAGGAGACGGG + Intergenic
1021621734 7:22555914-22555936 GCCTCAGCCCTGGTGCAGGGAGG + Intronic
1024817955 7:53293570-53293592 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1025142636 7:56478705-56478727 TTCCCATCCTTGGTGCAGACAGG - Intergenic
1025237703 7:57245717-57245739 TTCTCAGCCCTGGTGCAGGCTGG + Intergenic
1025474062 7:60897575-60897597 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1025488693 7:61084119-61084141 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1025512940 7:61592299-61592321 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1025557486 7:62327346-62327368 GAATCAGCTTTGATGCAGCCAGG + Intergenic
1025708696 7:63889307-63889329 TCCCCATCCTTGGTGCAGACAGG - Intergenic
1025885749 7:65589738-65589760 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1034552710 7:151831818-151831840 GCCCCAGCCTCGGTGCAGGCAGG - Intronic
1035633244 8:1124822-1124844 CACTCAGCCATCCTGCAGACTGG - Intergenic
1041647619 8:60269767-60269789 GATCCAGCCTTGGTGTTGACTGG + Intronic
1041805004 8:61840407-61840429 GAATCAGCATTGATGCAGCCAGG + Intergenic
1044809143 8:96039370-96039392 AACTCAGCCTTGGTACAGTGTGG - Intergenic
1049601886 8:143511777-143511799 GAGTGGGCCCTGGTGCAGACGGG + Intronic
1049712034 8:144069211-144069233 CACTCAGCCTGGGTGCAGCCTGG - Intergenic
1050706523 9:8405046-8405068 GACTCAGCTTAGGTCCAGATAGG - Intronic
1051875485 9:21788618-21788640 GATTCAGCCTTGGTGAAAACAGG + Intergenic
1053699012 9:40668586-40668608 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1053945019 9:43298827-43298849 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1054310301 9:63467987-63468009 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1054409090 9:64792136-64792158 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1054442250 9:65275953-65275975 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1054488031 9:65745544-65745566 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1055183247 9:73416717-73416739 GACTCTGACTTTGTGCAGACAGG + Intergenic
1056449774 9:86705624-86705646 GAGTAAGCCTTGGAGGAGACTGG - Intergenic
1059811576 9:117861040-117861062 CACTTAGCCCTGGTGCTGACTGG - Intergenic
1060432287 9:123560917-123560939 GAGTCAGCCTGGGTGCTGAGTGG - Intronic
1060792701 9:126496958-126496980 GACCCAGGCTTGGAGGAGACAGG + Intronic
1061322757 9:129841612-129841634 TTCTCAGCCTTGGTGGAGAAAGG + Intronic
1062702755 9:137916611-137916633 GACTCAGCCACTGTGCAGTCTGG - Intronic
1203581151 Un_KI270746v1:6309-6331 GAATCAGCCTTGATGCAGCCAGG - Intergenic
1203588154 Un_KI270747v1:27405-27427 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1203615180 Un_KI270749v1:55318-55340 GAGTCTGCCTTGATGCAGCCAGG - Intergenic
1192296336 X:69852741-69852763 GTCTCAGTCTTGGTGCTGACTGG + Intronic
1192706716 X:73533859-73533881 GACTCAGCCTGCCTGCAGCCAGG + Intergenic
1193942093 X:87688728-87688750 GACTCAGCCTGCCTGCAGCCAGG + Intergenic
1195130509 X:101846284-101846306 CACTCAGCCTTGTGACAGACAGG + Intronic
1195175753 X:102313970-102313992 CACTCAGCCTTGTGACAGACAGG - Intronic
1195183111 X:102373123-102373145 CACTCAGCCTTGTGACAGACAGG + Intronic
1198145236 X:133849644-133849666 GCCTGATCCTTGCTGCAGACAGG + Intronic