ID: 948480780

View in Genome Browser
Species Human (GRCh38)
Location 2:238249008-238249030
Sequence CCCTAAAAGGCTCTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 787}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948480780_948480790 29 Left 948480780 2:238249008-238249030 CCCCATCACAGAGCCTTTTAGGG 0: 1
1: 0
2: 1
3: 30
4: 787
Right 948480790 2:238249060-238249082 ACTGCCACGTCGATGGCTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 44
948480780_948480789 28 Left 948480780 2:238249008-238249030 CCCCATCACAGAGCCTTTTAGGG 0: 1
1: 0
2: 1
3: 30
4: 787
Right 948480789 2:238249059-238249081 TACTGCCACGTCGATGGCTGCGG 0: 1
1: 0
2: 0
3: 5
4: 37
948480780_948480788 22 Left 948480780 2:238249008-238249030 CCCCATCACAGAGCCTTTTAGGG 0: 1
1: 0
2: 1
3: 30
4: 787
Right 948480788 2:238249053-238249075 TGAGCTTACTGCCACGTCGATGG 0: 1
1: 0
2: 0
3: 0
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948480780 Original CRISPR CCCTAAAAGGCTCTGTGATG GGG (reversed) Intronic
900094025 1:933098-933120 CCCTGAGAGTCTCTGTGGTGGGG - Intronic
900201633 1:1410221-1410243 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
900234445 1:1580757-1580779 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
901137373 1:7006733-7006755 CCCTCAGAGGCTCTGGGTTGGGG - Intronic
901601593 1:10427076-10427098 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
902248205 1:15135859-15135881 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
902281715 1:15379548-15379570 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
904269251 1:29338610-29338632 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
904272532 1:29359740-29359762 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
905618200 1:39416011-39416033 CCCTGAAAGGCTCTGCAGTGAGG - Exonic
905762575 1:40572441-40572463 CCCGTAAAGGGTCTGTGTTGAGG + Intergenic
906404186 1:45528515-45528537 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
906498225 1:46320706-46320728 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
906499347 1:46329958-46329980 CCCGTAAAGGTTCTGTGCTGAGG + Intergenic
906508362 1:46396411-46396433 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
907120834 1:52006658-52006680 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
907465898 1:54636647-54636669 CCCATAAAGGGTCTGTGCTGAGG - Exonic
908153009 1:61324032-61324054 ACCTAAAATGTTCTGTGTTGGGG + Intronic
909023795 1:70460962-70460984 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
909234101 1:73129828-73129850 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
909413198 1:75377500-75377522 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
909413849 1:75382905-75382927 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
909475043 1:76073086-76073108 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
909607176 1:77519257-77519279 CCATGATAGGCTCTGTAATGAGG + Intronic
909651775 1:77983401-77983423 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
909793452 1:79702756-79702778 CCCCTAAAGGGTCTGTGCTGTGG + Intergenic
909966735 1:81922061-81922083 CCCTCAAAGGCTCTGTAGTCTGG + Intronic
910604369 1:89067394-89067416 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
911010642 1:93277313-93277335 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
911595454 1:99794117-99794139 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
912450902 1:109767033-109767055 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
912642426 1:111360252-111360274 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
912814380 1:112817336-112817358 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
913246865 1:116877825-116877847 CCCTAAAAGGCTCTGCAGTATGG + Intergenic
913601445 1:120425166-120425188 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
914085602 1:144451429-144451451 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
914191494 1:145415408-145415430 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
914252459 1:145932847-145932869 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
914358288 1:146907760-146907782 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
914362632 1:146948726-146948748 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
914393201 1:147240510-147240532 CCCATAAAGGGTCTGTGCTGAGG + Intronic
914489036 1:148138368-148138390 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
914495137 1:148189247-148189269 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
914589422 1:149093412-149093434 CCCATAAAGGGTCTGTGCTGAGG - Intronic
914765609 1:150635327-150635349 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
914830986 1:151170719-151170741 TCCCAAAGGGGTCTGTGATGTGG - Intronic
914924535 1:151872919-151872941 CCCGCAAAGGGTCTGTGCTGAGG + Intergenic
914985734 1:152455644-152455666 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
915052338 1:153088809-153088831 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
915401791 1:155627197-155627219 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
915402696 1:155635409-155635431 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
915480247 1:156179637-156179659 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
915480577 1:156181875-156181897 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
915890422 1:159768210-159768232 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
916009400 1:160691200-160691222 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
916010292 1:160699463-160699485 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
916034959 1:160913570-160913592 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
916039140 1:160947459-160947481 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
916039384 1:160949354-160949376 CCCACAAAGGGTCTGTGCTGAGG - Intronic
916103532 1:161413070-161413092 CCCTTAAAGGGTCTGTGATGAGG + Intergenic
916106205 1:161434345-161434367 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
916177857 1:162057528-162057550 CCCTAAAAGGCTTTTTGAGAGGG + Intergenic
916842063 1:168610679-168610701 CACTAACATGCTTTGTGATGTGG + Intergenic
918784856 1:188751767-188751789 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
919326105 1:196109267-196109289 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
920796393 1:209141597-209141619 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
922022331 1:221717332-221717354 GCCTAAGAGGCCCTGTGAGGAGG - Intronic
922305424 1:224340245-224340267 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
922398542 1:225227152-225227174 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
922682001 1:227606586-227606608 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
922715511 1:227868871-227868893 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
922755872 1:228096720-228096742 CCCTGGAAGGTTCTGTGTTGGGG + Intronic
923671094 1:236042083-236042105 TCCTACAAGGCTCTGAGAAGGGG - Exonic
923936169 1:238762851-238762873 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
924666976 1:246083099-246083121 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
924764164 1:247016314-247016336 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1063306236 10:4903512-4903534 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1063530320 10:6824711-6824733 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1063531244 10:6833205-6833227 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1064821531 10:19340373-19340395 CCCCACAAGGTTCTGTGATTCGG + Intronic
1065453390 10:25881662-25881684 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1065553754 10:26893884-26893906 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1065809352 10:29427156-29427178 CCCTTAAAGGGTCTGTGCTGAGG + Intergenic
1066175072 10:32894901-32894923 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1066927273 10:41713600-41713622 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1067101449 10:43337617-43337639 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1067281222 10:44874726-44874748 CCCTTAAGAGCTCTGTGATCTGG + Intergenic
1069184824 10:65409761-65409783 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1069452096 10:68526083-68526105 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1069590116 10:69636193-69636215 CCCTGAAAGGCTCTGAGAGGCGG - Intergenic
1070998321 10:80806326-80806348 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1071637168 10:87267227-87267249 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1071658077 10:87470727-87470749 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1072410500 10:95197755-95197777 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1072541778 10:96403684-96403706 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1072669268 10:97417362-97417384 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1072708581 10:97700262-97700284 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1072947287 10:99821368-99821390 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1073106293 10:101034095-101034117 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1073286370 10:102391860-102391882 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1073298330 10:102454901-102454923 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1074489847 10:113929842-113929864 CCTCCAAAGGCTATGTGATGTGG + Intergenic
1074999609 10:118785763-118785785 GCCTTGAATGCTCTGTGATGTGG - Intergenic
1075370458 10:121930476-121930498 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1075598807 10:123752141-123752163 GCATGAAAGGCTGTGTGATGTGG - Intronic
1075663312 10:124213369-124213391 CTCTAAAAGTCTCAGTGATCTGG + Intergenic
1076344503 10:129771230-129771252 CCCGACAAGGATCTGTAATGGGG + Intergenic
1076622175 10:131797657-131797679 TCCTCAGAGGCTCTGTGGTGGGG - Intergenic
1076940167 10:133599946-133599968 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077481205 11:2815529-2815551 CTCTCAAAGGCTCTGGGATGGGG - Intronic
1077577424 11:3395114-3395136 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1077586336 11:3456512-3456534 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1078216908 11:9319292-9319314 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1078327398 11:10391840-10391862 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1079141839 11:17816095-17816117 CCCTAAAAGGGGCTGTGCTCAGG + Intronic
1079262881 11:18900527-18900549 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1079664914 11:23093065-23093087 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1079769988 11:24446500-24446522 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1079851459 11:25541146-25541168 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1080743924 11:35090885-35090907 CACAAAAAGGCTTTGTGCTGTGG + Intergenic
1081014525 11:37859348-37859370 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1081482057 11:43498783-43498805 CCCTAAAAGATTGTGAGATGTGG - Intergenic
1082621721 11:55431409-55431431 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1082706874 11:56503133-56503155 CCCGTAAAGGGTCTGTGATGAGG - Intergenic
1083040584 11:59681573-59681595 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1083060308 11:59863190-59863212 CTCTAAAAGGCTCTGCTTTGAGG - Intronic
1083139952 11:60713699-60713721 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1083146029 11:60759524-60759546 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1083285393 11:61655540-61655562 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1083372805 11:62195075-62195097 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1083393034 11:62369017-62369039 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1083394755 11:62382637-62382659 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1083543110 11:63528502-63528524 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1083770553 11:64864566-64864588 CCATAAAAGGCTGTGGGCTGCGG - Intronic
1084207398 11:67603885-67603907 CCCGTAAAGGGTCTGTGCTGAGG - Exonic
1084247388 11:67868495-67868517 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1084259822 11:67968810-67968832 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1084766612 11:71313285-71313307 GCCAGAAAGGCTCTGTGATTTGG + Intergenic
1084812954 11:71626442-71626464 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1084819388 11:71674222-71674244 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1084830769 11:71767476-71767498 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1084845923 11:71899798-71899820 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1084880102 11:72164788-72164810 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1085040582 11:73324199-73324221 ACCTCTAAGGCTCTGGGATGTGG + Intronic
1085403483 11:76248123-76248145 CCCTGAGAGGCTCCATGATGGGG + Intergenic
1087572375 11:99945149-99945171 CCTTAAATGGCTCTCTGATATGG - Intronic
1087723736 11:101695477-101695499 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1087724667 11:101703975-101703997 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1088561812 11:111122833-111122855 CCCTAAAAGGCTATCTGTTATGG + Intergenic
1088843507 11:113646186-113646208 TCCAAAGAGGCTCTGTGATTTGG + Intergenic
1088858393 11:113777482-113777504 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1089472103 11:118729737-118729759 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1089517047 11:119039800-119039822 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1089852491 11:121512377-121512399 CTCTAAAATGCAATGTGATGTGG + Intronic
1090039741 11:123280126-123280148 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1091907441 12:4200419-4200441 CCCTAAAAGACTCCCTAATGGGG - Intergenic
1091963862 12:4721763-4721785 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1092059573 12:5537432-5537454 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1092142246 12:6191832-6191854 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1092234514 12:6797948-6797970 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1092249680 12:6886385-6886407 CCCGTAAAGGTTCTGTGCTGAGG - Intronic
1092405684 12:8220622-8220644 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1092412571 12:8265246-8265268 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1092431116 12:8409780-8409802 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1092434018 12:8431969-8431991 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1092437538 12:8462346-8462368 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1092455108 12:8636078-8636100 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1092559838 12:9600880-9600902 CCCGTAAAGGTTCTGTGCTGAGG + Intronic
1093509094 12:19904521-19904543 CCCTCACAGGGTGTGTGATGGGG - Intergenic
1094389351 12:29932585-29932607 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1094623222 12:32099925-32099947 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1095374075 12:41505426-41505448 CGCTAAAAGGCTGTGTTATCAGG + Intronic
1095456143 12:42388132-42388154 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1096125449 12:49116089-49116111 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1096420682 12:51454818-51454840 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1096940058 12:55333845-55333867 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1097076791 12:56400892-56400914 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1097132453 12:56822553-56822575 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1097149919 12:56969153-56969175 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1097330512 12:58327990-58328012 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1097331447 12:58336479-58336501 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1097399164 12:59108636-59108658 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1100004925 12:89883462-89883484 ACCTAAAAGGGTCTTTAATGTGG - Intergenic
1100276306 12:93074816-93074838 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1100727221 12:97421410-97421432 CCCCAGAAGTGTCTGTGATGGGG - Intergenic
1101520644 12:105479091-105479113 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1101798241 12:107997598-107997620 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1102135460 12:110570452-110570474 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1103092372 12:118106390-118106412 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1103243996 12:119439731-119439753 CACTAAGAGTCTCTGGGATGGGG - Intronic
1104276930 12:127337628-127337650 TACAAAAGGGCTCTGTGATGAGG - Intergenic
1104510020 12:129368779-129368801 ACCCAAAAGGCTCTGACATGAGG + Intronic
1105055608 12:133096029-133096051 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1105349138 13:19600632-19600654 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1106376240 13:29190973-29190995 CCCAAAAAGGCTCTCTTATAAGG - Intronic
1107000734 13:35541638-35541660 CAGTAAAAGGCTATGTGCTGTGG + Intronic
1107667850 13:42711219-42711241 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1108158905 13:47618033-47618055 CCCTATAAGGGCCTGTGCTGAGG + Intergenic
1108352435 13:49599437-49599459 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1109088468 13:58007732-58007754 CCTTAAAGTGCTCTGTAATGTGG - Intergenic
1111633638 13:90875152-90875174 TCCTAACAGGCCCAGTGATGGGG + Intergenic
1112367127 13:98764767-98764789 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1113597424 13:111543528-111543550 CCCTGTTAAGCTCTGTGATGGGG - Intergenic
1114006561 14:18319893-18319915 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1114438136 14:22725216-22725238 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1114607601 14:24010253-24010275 CCCATAAAGGGTCTGTGCTGCGG - Intergenic
1114608211 14:24015615-24015637 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1115898535 14:38118514-38118536 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1116883006 14:50190973-50190995 CTCTAAAAGGGTCTCTGGTGGGG - Intronic
1117335405 14:54753155-54753177 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1117365637 14:55024950-55024972 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1118352030 14:64979119-64979141 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1118929402 14:70226000-70226022 CCCTAGAAGGGTGTGCGATGGGG - Intergenic
1119465597 14:74855695-74855717 CCCTAAAAGGCAGTGGAATGAGG - Intronic
1119826609 14:77661929-77661951 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1120641639 14:87020553-87020575 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1120733126 14:88024755-88024777 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1120830105 14:88990302-88990324 CCATCACAGACTCTGTGATGAGG - Intergenic
1121200277 14:92111110-92111132 GCCTGAAAAGCTCTGTGATCTGG + Intergenic
1121527077 14:94626565-94626587 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1121917455 14:97848817-97848839 AGCTAACAGGCTCTGTGATAGGG - Intergenic
1122232232 14:100312321-100312343 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1122689548 14:103525468-103525490 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1123136448 14:106031791-106031813 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1202919334 14_KI270723v1_random:16529-16551 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1202925297 14_KI270724v1_random:18465-18487 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1124354405 15:28984347-28984369 CCCTATAAGCCTATGTCATGGGG - Intronic
1124968751 15:34463186-34463208 CCCCAAAACGCTCAGTGATGAGG + Intergenic
1127423622 15:58833861-58833883 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1128131003 15:65227073-65227095 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1129485857 15:75871385-75871407 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1130060719 15:80567946-80567968 TCCTTAAATGCTCTGTGCTGAGG + Intronic
1130461678 15:84163967-84163989 CCCATAAAGGGTCTGTGTTGAGG - Intergenic
1130728731 15:86467684-86467706 CCCTGAAATACTGTGTGATGAGG - Intronic
1130944519 15:88540966-88540988 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1131194808 15:90347123-90347145 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1132190518 15:99852212-99852234 TCCTAAAACCCTCAGTGATGGGG - Intergenic
1132342413 15:101086842-101086864 CCCGAGAAGGCTCTGCGAGGTGG + Intergenic
1132362330 15:101226924-101226946 ACCTAAAAGCATCTGTTATGGGG - Intronic
1132440583 15:101860508-101860530 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1132756989 16:1490336-1490358 CCCTCGAAGGCTCTGGGCTGGGG - Intergenic
1133432994 16:5754919-5754941 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1133687416 16:8179292-8179314 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1134007842 16:10830018-10830040 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1134190093 16:12114306-12114328 CCCTGAAGGGCTCTGTTAGGAGG + Intronic
1134410605 16:14000526-14000548 CACTAAAAAGCTGTGTGATTTGG - Intergenic
1134483291 16:14636670-14636692 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1135577867 16:23599890-23599912 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1135707454 16:24687029-24687051 CCTCAAAAAGCTCTGTGAAGTGG - Intergenic
1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG + Intergenic
1136930359 16:34412588-34412610 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1136974215 16:34999220-34999242 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1137042844 16:35629224-35629246 CCCATAAAGGCTCTGTGCTGAGG + Intergenic
1137075474 16:35956086-35956108 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1137263262 16:46848082-46848104 CCTTAAAAGGCTCATTGATAGGG - Intergenic
1137366600 16:47864873-47864895 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1138162366 16:54766359-54766381 CCATAAAAGGCTCAGTCTTGAGG + Intergenic
1139208952 16:65057406-65057428 CCCTAAGAGGCTTAGTGCTGTGG - Intronic
1139394337 16:66628289-66628311 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1140418879 16:74799924-74799946 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1140546606 16:75815826-75815848 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1140696643 16:77541208-77541230 CCATTAAGGCCTCTGTGATGAGG + Intergenic
1142534660 17:605836-605858 CCACAAAAGGCTGCGTGATGGGG - Intronic
1143022105 17:3922087-3922109 CTCAAAAACGCTCTGTGCTGGGG + Intergenic
1143129055 17:4664627-4664649 CCCTAAAATGTGGTGTGATGTGG + Intergenic
1143195759 17:5075210-5075232 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1143459057 17:7088738-7088760 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1143468974 17:7159484-7159506 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1143794536 17:9326064-9326086 CACTAGATGGGTCTGTGATGAGG + Intronic
1143852798 17:9825333-9825355 CCATAAAAGGGTCTGTCAGGTGG + Intronic
1144571230 17:16400547-16400569 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1144624020 17:16835418-16835440 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1144882408 17:18437298-18437320 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1145031033 17:19505485-19505507 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1145033096 17:19520119-19520141 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1145149826 17:20507088-20507110 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1146161764 17:30563725-30563747 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1146166656 17:30594997-30595019 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1146181417 17:30700572-30700594 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1147329290 17:39687473-39687495 CCCTGAAAGACTCTTTGATTAGG - Intronic
1147838773 17:43355360-43355382 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1148273706 17:46284145-46284167 CCCTTAAAGGGTCTGTGCTGAGG - Intronic
1149202366 17:54201988-54202010 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1149767360 17:59290467-59290489 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1149882656 17:60308415-60308437 CCCTCACAGGGTGTGTGATGGGG - Intronic
1150205960 17:63407690-63407712 CCCTCAAAGGGTCTATAATGTGG + Intronic
1150278343 17:63914055-63914077 GGCTAAAAGGCCCTGTCATGGGG - Intronic
1150409354 17:64930436-64930458 CCCTTAAAGGGTCTGTGCTGAGG + Intergenic
1150686780 17:67327378-67327400 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1150840909 17:68604523-68604545 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1152480897 17:80551739-80551761 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1152962943 18:90763-90785 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1152985241 18:315108-315130 TCCTAAATGGCAGTGTGATGGGG - Intergenic
1153143453 18:2001345-2001367 CCCTTAAAGGGTCTGTGCTGAGG - Intergenic
1153422079 18:4917811-4917833 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1155472111 18:26202365-26202387 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1155942230 18:31810916-31810938 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1156806117 18:41184283-41184305 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1157777169 18:50404740-50404762 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1158180709 18:54712547-54712569 CCCTAGCAGGGTGTGTGATGGGG + Intergenic
1159484920 18:69043383-69043405 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1159606465 18:70479566-70479588 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160675187 19:387086-387108 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1161218102 19:3104808-3104830 CCCTCAAAGGGCCTGTGCTGTGG + Intronic
1162096855 19:8315263-8315285 CCGGTAAAGGGTCTGTGATGAGG + Intronic
1162291528 19:9784600-9784622 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1162292381 19:9789890-9789912 CCCCTAAAGGGTCTGTGCTGAGG - Intronic
1162414184 19:10524502-10524524 TTCTAAAAGGCTCTGAGATGAGG - Intergenic
1162626696 19:11890171-11890193 CCCCTAAAGGGTCTGTGCTGAGG - Intronic
1162668125 19:12232354-12232376 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1163203243 19:15783162-15783184 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1163885594 19:19962007-19962029 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1163898828 19:20082753-20082775 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1163907049 19:20156863-20156885 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1163919711 19:20277000-20277022 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1163937907 19:20466741-20466763 CCCATAAAGGGTCTGTGCTGGGG + Intergenic
1163986898 19:20961973-20961995 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1164122854 19:22283950-22283972 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1164154367 19:22581206-22581228 CCCGTAAAGGGTCTGTGATGAGG + Intergenic
1164276600 19:23724172-23724194 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1164370345 19:27638121-27638143 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1164489011 19:28689843-28689865 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1165295131 19:34920593-34920615 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1165506438 19:36233895-36233917 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1165508075 19:36247496-36247518 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1165523522 19:36332697-36332719 CCCGAAAAGGGTCTGTGCTGAGG - Intergenic
1165574166 19:36799969-36799991 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1165595107 19:37006573-37006595 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1165606237 19:37107151-37107173 CCCGAAAAGGGTCTGTGCTGAGG - Intronic
1165607175 19:37115728-37115750 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1165621613 19:37252921-37252943 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1165634820 19:37331819-37331841 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1165652330 19:37502280-37502302 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1165655698 19:37530334-37530356 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1165666199 19:37630476-37630498 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1165691417 19:37866591-37866613 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1165814233 19:38631664-38631686 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1165952055 19:39479899-39479921 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1166013263 19:39959760-39959782 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1166157209 19:40922757-40922779 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1166172186 19:41036606-41036628 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1166248045 19:41545023-41545045 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1166653655 19:44594510-44594532 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1167336588 19:48890050-48890072 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167336908 19:48892153-48892175 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1167814641 19:51869124-51869146 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1167818614 19:51906107-51906129 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167818953 19:51908721-51908743 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1167819054 19:51909409-51909431 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167820283 19:51921566-51921588 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1167831305 19:52024907-52024929 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167833132 19:52043547-52043569 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167834069 19:52052137-52052159 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1167867379 19:52339296-52339318 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1167876910 19:52421488-52421510 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1167883821 19:52484381-52484403 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1167893205 19:52559109-52559131 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167910510 19:52698270-52698292 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1167913744 19:52724110-52724132 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1167916125 19:52741457-52741479 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1167997845 19:53420937-53420959 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1168006975 19:53498054-53498076 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1168052371 19:53839040-53839062 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1168235440 19:55060117-55060139 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1168358527 19:55718308-55718330 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1168477398 19:56686566-56686588 CCCTTAAAGGGTCTGTGCTGAGG - Intergenic
1168614849 19:57829369-57829391 CCCTTAAAGGGTCTGTGCTGAGG + Intronic
925037647 2:703111-703133 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
926139333 2:10359129-10359151 CCCTCAAAGGGCATGTGATGGGG - Intronic
926961634 2:18364282-18364304 CCCTCACAGGGTGTGTGATGGGG + Intergenic
927188811 2:20501731-20501753 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
927891143 2:26750276-26750298 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
927992848 2:27460393-27460415 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
928279462 2:29931400-29931422 CCCTAGAATGTTCTGTGATATGG - Intergenic
928355857 2:30614003-30614025 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
928540011 2:32276113-32276135 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
928990248 2:37225732-37225754 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
929097531 2:38278206-38278228 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
929208114 2:39321575-39321597 CCCATAAAGGGTCTGTAATGAGG + Intronic
929597301 2:43184278-43184300 CCATTAAAGGCTCTGAGAAGGGG - Intergenic
932798694 2:74720394-74720416 CCCGTAAAGGGTCTGTGTTGAGG + Intergenic
933249694 2:80015450-80015472 CCCTGAAGCGCTCTCTGATGGGG + Intronic
933863979 2:86499481-86499503 CCCTAGAAGGCGTTATGATGTGG - Intergenic
934489009 2:94745193-94745215 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
934542985 2:95191785-95191807 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
934554680 2:95281115-95281137 CCTCTAAAGGCTCTGTGCTGGGG + Intronic
934897352 2:98130399-98130421 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
934919749 2:98333204-98333226 CCCTAAAAAGGTTGGTGATGTGG - Exonic
935180458 2:100685281-100685303 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
935656169 2:105425472-105425494 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
936107479 2:109637398-109637420 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
936157278 2:110056486-110056508 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
936187416 2:110314958-110314980 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
936378507 2:111963373-111963395 CCCGTAAAGGATCTGTGCTGAGG - Intronic
936487016 2:112934669-112934691 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
937970156 2:127543107-127543129 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
938235381 2:129701795-129701817 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
938270100 2:129962496-129962518 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
938530000 2:132175579-132175601 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
941007507 2:160262945-160262967 CCCTATCTGGTTCTGTGATGAGG + Intronic
943327734 2:186521936-186521958 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
943732807 2:191320968-191320990 CCCTAGAAAGCACTGTGCTGGGG - Intronic
943838212 2:192542472-192542494 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
943880936 2:193142836-193142858 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
943977674 2:194504843-194504865 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
944581997 2:201139416-201139438 CCCATAAAGGGTCTGTGCTGAGG + Intronic
944869976 2:203900267-203900289 CCCTAAAAGAATCTGTATTGAGG + Intergenic
945175223 2:207037240-207037262 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
945299178 2:208199972-208199994 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
945374271 2:209061103-209061125 CCCTAAAGAGCTCTGGGATAGGG + Intergenic
945774195 2:214083997-214084019 CACTGAAAGTCTCGGTGATGTGG - Intronic
945832400 2:214803299-214803321 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
946234093 2:218311790-218311812 CCCATAAAGGGTCTGTGCTGAGG - Intronic
946780687 2:223190892-223190914 CCCATAAAGGGTCTGTGCTGAGG + Intronic
947273403 2:228364173-228364195 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
947520735 2:230844168-230844190 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
948480780 2:238249008-238249030 CCCTAAAAGGCTCTGTGATGGGG - Intronic
948843470 2:240671790-240671812 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1168825730 20:812385-812407 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1169658870 20:7956614-7956636 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1171256807 20:23694889-23694911 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1171276573 20:23861129-23861151 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1171291033 20:23983057-23983079 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1171450745 20:25234369-25234391 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1171451900 20:25241663-25241685 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1172352304 20:34252677-34252699 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1172479494 20:35262655-35262677 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1172716509 20:36968249-36968271 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1173123233 20:40313194-40313216 TTATAAGAGGCTCTGTGATGTGG - Intergenic
1173319076 20:41971310-41971332 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1173421672 20:42906719-42906741 CCCTCACAGGGTGTGTGATGGGG - Intronic
1176424426 21:6539346-6539368 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1176838771 21:13820295-13820317 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1177249103 21:18569208-18569230 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1178379963 21:32099570-32099592 CCCTAAAAAGCAGTGTGAGGTGG + Intergenic
1178483019 21:32996705-32996727 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1179123768 21:38573298-38573320 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1179444443 21:41421400-41421422 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1179699919 21:43147661-43147683 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1180333029 22:11550077-11550099 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1180431070 22:15250704-15250726 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1180606033 22:17059578-17059600 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1180837743 22:18939088-18939110 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1181019363 22:20090917-20090939 CCCTAGAAGAGCCTGTGATGGGG + Intronic
1181400932 22:22649882-22649904 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1181534892 22:23536476-23536498 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1181535168 22:23538153-23538175 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1181642601 22:24211420-24211442 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1181702910 22:24630974-24630996 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1183627249 22:39012068-39012090 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1203287834 22_KI270734v1_random:164387-164409 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
949547158 3:5082127-5082149 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
949804689 3:7942119-7942141 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
950031085 3:9854160-9854182 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
950135989 3:10581302-10581324 CCCCACAAGGCTCTGGGAAGAGG + Intronic
950387932 3:12674531-12674553 CCTTTAAAGGGTCTGTGCTGAGG + Intergenic
950607104 3:14091716-14091738 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
950629553 3:14273258-14273280 CCCTTAAAGGGTCTGTGCTGAGG + Intergenic
950753045 3:15146083-15146105 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
950792984 3:15488129-15488151 CACTAAGAGGCTCTGTGCAGTGG + Intronic
951123435 3:18956354-18956376 CCCTTGACAGCTCTGTGATGTGG - Intergenic
951514641 3:23545194-23545216 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
952685364 3:36141640-36141662 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
952810879 3:37401565-37401587 CCCTTAAAGCCTCTCTGATCAGG + Intronic
952905255 3:38135855-38135877 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
953428007 3:42811605-42811627 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
953481869 3:43258835-43258857 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
953960096 3:47259948-47259970 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
954440679 3:50520296-50520318 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
954896287 3:53978045-53978067 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
955267457 3:57460249-57460271 CTCTATAATTCTCTGTGATGGGG - Intronic
955509531 3:59665509-59665531 TCCTAAAAGGCTTTGGGATGAGG + Intergenic
957045947 3:75374726-75374748 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
957069897 3:75559414-75559436 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
957074769 3:75593233-75593255 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
958937538 3:100273024-100273046 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
958943246 3:100336857-100336879 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
958975763 3:100666671-100666693 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
959069883 3:101692308-101692330 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
959070789 3:101700462-101700484 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
959071291 3:101704364-101704386 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
960027423 3:113024808-113024830 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
960028336 3:113033007-113033029 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
960510181 3:118540401-118540423 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
960515169 3:118595413-118595435 CCCTCACAGGGTGTGTGATGGGG + Intergenic
960809124 3:121611666-121611688 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
961279334 3:125753477-125753499 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
961296756 3:125890865-125890887 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
961297574 3:125899199-125899221 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
961429126 3:126867962-126867984 GCCTACAGGGCTCTGTGATCTGG + Intronic
961512584 3:127412193-127412215 CCCTTAAAGGGTCTGTGCTGAGG - Intergenic
961557959 3:127709603-127709625 CCCTAAAGGGCCCTGGGAAGTGG - Intronic
961878003 3:130038849-130038871 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
961890135 3:130123898-130123920 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
962334662 3:134516464-134516486 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
963216311 3:142752607-142752629 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
963969370 3:151412786-151412808 CCTTAAAGGGCTCTCTGGTGGGG + Intronic
963979922 3:151526054-151526076 CACTAAGATGCTCAGTGATGAGG - Intergenic
965473205 3:169120989-169121011 CCCCAAAAGGCACTGTGACCAGG - Intronic
966073347 3:175906081-175906103 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
966733578 3:183170423-183170445 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
966904049 3:184508938-184508960 CCCTAAGAGCCTCTGTGATCAGG - Intronic
967025855 3:185563079-185563101 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
967026764 3:185571291-185571313 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
967179092 3:186887405-186887427 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
967179744 3:186893634-186893656 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
967418895 3:189251902-189251924 CCCATAAAGGGTCTGTGCTGAGG - Intronic
968034291 3:195533054-195533076 GCTTAAAATGCTCTATGATGCGG + Intronic
968061388 3:195728661-195728683 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
968095602 3:195928056-195928078 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
968281584 3:197481153-197481175 CAAAAAAAGACTCTGTGATGAGG + Intergenic
968387232 4:152273-152295 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
968393021 4:208329-208351 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
968396281 4:241613-241635 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
968430345 4:554798-554820 CCTTGAAAGGCTCAGTGAGGCGG - Intergenic
968992809 4:3926055-3926077 CCCGTAAAGGGTCTGTGCTGGGG + Intergenic
969000606 4:3977886-3977908 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
969001530 4:3986463-3986485 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
969618690 4:8268282-8268304 CCCTAAAAGGCCCTTTGACAAGG - Intergenic
969753410 4:9130787-9130809 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
969786918 4:9465640-9465662 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
969812387 4:9658397-9658419 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
969813312 4:9666969-9666991 ACCTTAAAGGGTCTGTGCTGAGG + Intergenic
969822665 4:9732306-9732328 CCCATAAAGGGTCTGTGCTGGGG - Intergenic
969825099 4:9751483-9751505 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
969928535 4:10608584-10608606 TCCTAAAAGGCTCTGTGTCTGGG + Intronic
970440449 4:16077079-16077101 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
970582585 4:17487107-17487129 CCCTCATAGGCACTGAGATGAGG + Exonic
970697506 4:18695856-18695878 CCCTCACAGGGTGTGTGATGGGG + Intergenic
971720055 4:30233446-30233468 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
972846924 4:43002194-43002216 CCCATAAAGGGTCTGTGCTGAGG - Intronic
973273572 4:48285894-48285916 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
973343439 4:49029517-49029539 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
974517969 4:62941292-62941314 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
974766930 4:66359289-66359311 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
974924631 4:68281989-68282011 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
974945901 4:68528684-68528706 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
974960522 4:68693882-68693904 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
975246826 4:72129755-72129777 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
977820582 4:101467866-101467888 CCCTTATAAGCTCTGAGATGTGG + Intronic
978048933 4:104171412-104171434 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
978342049 4:107729262-107729284 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
979141663 4:117183527-117183549 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
979302459 4:119102371-119102393 CCCTGTAAGGTTCTGTGAAGGGG + Intergenic
979322724 4:119343065-119343087 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
979497212 4:121396970-121396992 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
979501594 4:121446580-121446602 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
979949886 4:126878755-126878777 CCCTCAATTGCTCTGTGATAAGG - Intergenic
979996708 4:127440033-127440055 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
981054927 4:140350886-140350908 TCCTAAAAGGCTCTGAGATCTGG + Intronic
982512840 4:156305293-156305315 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
982823775 4:159977018-159977040 CCCTTAAAGGGTCTGTGCAGAGG - Intergenic
982876604 4:160659200-160659222 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
983205447 4:164906045-164906067 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
983212764 4:164975800-164975822 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
983214509 4:164990796-164990818 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
983215187 4:164996100-164996122 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
983215906 4:165002364-165002386 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
984423420 4:179553707-179553729 CCCCTAAAGGGTCTGTGCTGAGG - Intergenic
984802359 4:183726821-183726843 CCTGAAAAGGGTCTGTGCTGAGG - Intergenic
985057812 4:186050464-186050486 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
985461660 4:190113104-190113126 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
986484073 5:8217643-8217665 CCCTCACAGGGTGTGTGATGGGG - Intergenic
986549633 5:8938155-8938177 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
987490865 5:18578869-18578891 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
988379978 5:30487184-30487206 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
988380900 5:30495680-30495702 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
988850612 5:35176800-35176822 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
988985917 5:36618912-36618934 CCAAAAAAGGCTATGTGAAGTGG - Intronic
989274469 5:39571026-39571048 CCTTATAAGGCTCTGGGATAGGG + Intergenic
989296119 5:39828603-39828625 CCCGTAAAGGGTCTGTGTTGAGG - Intergenic
989583816 5:43058552-43058574 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
989640764 5:43580835-43580857 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
989737911 5:44731018-44731040 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
989836519 5:46000570-46000592 CCCATAAAGGCTCTGTGCTGAGG - Intergenic
989837399 5:46009466-46009488 CCCATAAAGGCTCTGTGCTGAGG - Intergenic
990058668 5:51618911-51618933 CCGGAAAGGGCTCTCTGATGAGG + Intergenic
990414299 5:55571486-55571508 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
990789757 5:59464201-59464223 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
990875140 5:60475855-60475877 CCCTGCAACGCTATGTGATGCGG - Intronic
990982732 5:61616236-61616258 CCCCAGAGGGCTCTGTGAAGTGG + Intergenic
991580747 5:68152616-68152638 CCCTACTGGGCTCTGAGATGGGG - Intergenic
992320198 5:75606364-75606386 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
992364111 5:76074265-76074287 CCCCACAATGCTGTGTGATGCGG + Intergenic
993030916 5:82704750-82704772 TCCTAAAAGCCTCATTGATGTGG + Intergenic
993889555 5:93457141-93457163 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
994429638 5:99641778-99641800 ACCTGATAGGCTTTGTGATGAGG - Intergenic
994531987 5:100983565-100983587 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
994936507 5:106259700-106259722 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
995740071 5:115346991-115347013 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
995878863 5:116821545-116821567 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
996163405 5:120195215-120195237 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
997871675 5:137511189-137511211 CCATAAAAGGCAATGTAATGTGG + Intronic
999295070 5:150454286-150454308 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
999419240 5:151426701-151426723 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
999823375 5:155250720-155250742 ACCTGAAAGGCTCTGTGCTCAGG + Intergenic
999989276 5:157034550-157034572 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1000026589 5:157363976-157363998 CCCTGAGAGGCTCTGAAATGGGG + Intronic
1000254850 5:159527730-159527752 CCCTAGAAGGCTCTTTTGTGTGG - Intergenic
1000527023 5:162370547-162370569 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1001232098 5:169997406-169997428 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1001779673 5:174357209-174357231 CCCTGAAAGACTCTGTGGAGAGG - Intergenic
1001855284 5:175005284-175005306 CCCCAAAGAGCCCTGTGATGGGG + Intergenic
1002377471 5:178798491-178798513 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1002482792 5:179514494-179514516 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1002666252 5:180827680-180827702 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1003066601 6:2909078-2909100 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1004716966 6:18227154-18227176 CCCTTAAAGGGTCTGTGCTGAGG + Intronic
1005293391 6:24400583-24400605 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1005321719 6:24662232-24662254 CCCAAAAAGGGTCTGTGTTGAGG + Intronic
1005453804 6:25999644-25999666 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1005525318 6:26641905-26641927 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1005618398 6:27597284-27597306 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1005729444 6:28682791-28682813 CCCACAAAGGGTCTGTGCTGAGG + Intergenic
1005730010 6:28687779-28687801 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1006238551 6:32657657-32657679 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1006250397 6:32778598-32778620 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1006289325 6:33122489-33122511 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1006399772 6:33810491-33810513 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1006538450 6:34719991-34720013 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1007089467 6:39173118-39173140 CCCTTAAAAGCTCTGCTATGTGG - Intergenic
1007793521 6:44328573-44328595 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1008563896 6:52748838-52748860 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1008578462 6:52883679-52883701 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1008582994 6:52923086-52923108 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1008585857 6:52948260-52948282 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1008646917 6:53523729-53523751 CCCTTAATGTTTCTGTGATGAGG - Intronic
1009193318 6:60655428-60655450 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1009193732 6:60660399-60660421 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1009540178 6:64944636-64944658 CCCTTAAAGGGTCTGTGCTGAGG + Intronic
1010260090 6:73805555-73805577 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1010591451 6:77717476-77717498 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1010592389 6:77725938-77725960 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1010686423 6:78859202-78859224 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1010839741 6:80635086-80635108 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1011536562 6:88382002-88382024 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1012120588 6:95361762-95361784 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1012458150 6:99429785-99429807 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1013555779 6:111255629-111255651 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1014693865 6:124594962-124594984 CCCTGAAGGGCTCAGTGAAGTGG + Intronic
1015285233 6:131479073-131479095 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1015330215 6:131969066-131969088 CACTTATTGGCTCTGTGATGTGG - Intergenic
1015574774 6:134659641-134659663 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1015865923 6:137726434-137726456 CCCTACAACAATCTGTGATGTGG + Intergenic
1015878142 6:137844884-137844906 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1016532723 6:145076160-145076182 CCCTCACAGGATGTGTGATGGGG + Intergenic
1016539268 6:145145270-145145292 CCCTACAAGGCCTTGTGATGTGG + Intergenic
1017171105 6:151455741-151455763 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1017232998 6:152092682-152092704 CCCTGCAAGGCGCTGTGATTAGG + Intronic
1017785390 6:157752744-157752766 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1018024667 6:159795262-159795284 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1018060100 6:160083474-160083496 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1018597673 6:165500666-165500688 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1019071234 6:169346816-169346838 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1019237097 6:170626859-170626881 CCCTAGTGGGCTCTGTGTTGGGG - Intergenic
1019520266 7:1457775-1457797 CCCGAAAAGCCTCTGGGGTGGGG - Intronic
1019687527 7:2389936-2389958 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1019927826 7:4204945-4204967 GCCTAAATGGCTGTGTGGTGAGG + Intronic
1019968041 7:4516344-4516366 GCCTACAAAGCTCTGTGATCAGG - Intergenic
1019976125 7:4582957-4582979 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1019977059 7:4591461-4591483 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1019977995 7:4599964-4599986 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1020313054 7:6883936-6883958 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1020329371 7:7002304-7002326 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1021067791 7:16198136-16198158 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1021671599 7:23040270-23040292 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1021747543 7:23757742-23757764 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1023248339 7:38231404-38231426 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1024313267 7:47990087-47990109 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1024686418 7:51750819-51750841 CCATAAGAGGCCCAGTGATGAGG - Intergenic
1024932215 7:54675741-54675763 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1025075958 7:55943438-55943460 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1026736411 7:72951617-72951639 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1026855379 7:73750248-73750270 CCAAAAAAGGGTCTGTGCTGAGG - Intergenic
1027107322 7:75413445-75413467 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1029280461 7:99432182-99432204 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1029534756 7:101150384-101150406 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1029966727 7:104748335-104748357 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1030760295 7:113342048-113342070 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1031230608 7:119100773-119100795 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1031606994 7:123781051-123781073 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1031724588 7:125221701-125221723 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1031779113 7:125940118-125940140 CCCATAAAAGGTCTGTGATGAGG + Intergenic
1031795434 7:126168574-126168596 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1032316233 7:130841617-130841639 CCCTCACAGGGTGTGTGATGGGG + Intergenic
1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG + Intergenic
1033349867 7:140553508-140553530 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1035349668 7:158237205-158237227 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1035564576 8:632931-632953 GCCTAAACGGCTCTTTGCTGTGG - Intronic
1036217788 8:6895233-6895255 CCCAAAACAACTCTGTGATGTGG + Intergenic
1036247140 8:7127541-7127563 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1036261135 8:7241216-7241238 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1036291673 8:7498406-7498428 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1036292605 8:7506909-7506931 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1036305470 8:7598331-7598353 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1036313174 8:7699760-7699782 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1036356320 8:8046328-8046350 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1036375704 8:8197623-8197645 CCCATAAAGGGTCTGTGGTGAGG + Intergenic
1036376621 8:8206118-8206140 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1036852916 8:12217020-12217042 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1036853826 8:12225521-12225543 CCCATAAAGGGTCTGTGGTGAGG - Intergenic
1036874289 8:12459542-12459564 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1036875201 8:12468031-12468053 CCCATAAAGGGTCTGTGGTGAGG - Intergenic
1037429457 8:18794363-18794385 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1037761125 8:21742402-21742424 TCCATAAAGGCCCTGTGATGAGG - Intronic
1039392637 8:37193899-37193921 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1039880064 8:41620036-41620058 CTCTAAAAGTCTGTGAGATGTGG - Intronic
1040126150 8:43740070-43740092 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1040317329 8:46271593-46271615 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1040339163 8:46431538-46431560 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1040340932 8:46440478-46440500 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1040343222 8:46456068-46456090 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1040413292 8:47176564-47176586 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1040777288 8:51061156-51061178 CCATAAAAGACTCTGTTAAGAGG - Intergenic
1041015543 8:53590076-53590098 CCCTAATAGGTTCTGTGTGGGGG + Intergenic
1041060737 8:54032212-54032234 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1041205644 8:55495544-55495566 CCCTGGAAGCCACTGTGATGGGG - Intronic
1041374532 8:57200134-57200156 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1041513052 8:58672272-58672294 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1042204381 8:66313614-66313636 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1044310182 8:90684446-90684468 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1044310314 8:90685293-90685315 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1046032013 8:108793732-108793754 CCCTAAAAGGTCATGTGAAGAGG - Intergenic
1046939554 8:119917709-119917731 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1047225666 8:122953709-122953731 CCCCAAAAAGCTCTGCGAAGAGG + Exonic
1049481943 8:142829255-142829277 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1049557008 8:143287815-143287837 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1049663641 8:143832403-143832425 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1049667106 8:143850234-143850256 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1049725905 8:144146146-144146168 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1049845030 8:144796308-144796330 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1049867733 8:144949871-144949893 CCCGTAAAGGGTCTGTGTTGAGG + Intronic
1049876084 8:145021806-145021828 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1049876763 8:145028386-145028408 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1051471291 9:17445775-17445797 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1051769316 9:20558986-20559008 CACTAAAAGGCTGAATGATGAGG + Intronic
1052279362 9:26715682-26715704 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1052469874 9:28880636-28880658 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1052527810 9:29642275-29642297 CTCTAAAAGACTCTGTTAAGAGG + Intergenic
1052676572 9:31633410-31633432 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1052871887 9:33515398-33515420 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1053668778 9:40339156-40339178 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1053736394 9:41105606-41105628 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1053918577 9:42965429-42965451 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1054322230 9:63682140-63682162 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1054379914 9:64479193-64479215 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1054515833 9:66037138-66037160 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1054691979 9:68325794-68325816 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1054843102 9:69763668-69763690 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1054929015 9:70617303-70617325 CACAGAAAGGTTCTGTGATGTGG - Intronic
1055157940 9:73087738-73087760 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1055168340 9:73223810-73223832 AGCCAAAAGGTTCTGTGATGTGG - Intergenic
1055924052 9:81491899-81491921 CACCATAAGGCTCTGTGATATGG + Intergenic
1056211337 9:84368001-84368023 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1056538086 9:87548321-87548343 CCCTAAATAGCTATGTGACGTGG + Intronic
1057897116 9:98917933-98917955 CTCTAAACGGCTCTGTGGTCTGG - Intergenic
1058814399 9:108670067-108670089 CTCTAAAAGGCTCAGTTTTGGGG - Intergenic
1060167371 9:121429520-121429542 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1060309724 9:122448490-122448512 CCCGTGAAGGGTCTGTGATGAGG - Intergenic
1060376008 9:123115581-123115603 TCTTACCAGGCTCTGTGATGGGG - Intronic
1060831061 9:126716943-126716965 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1061155289 9:128856877-128856899 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1061233376 9:129327992-129328014 CCTTCAAAGGCTCTCTGGTGTGG - Intergenic
1061554260 9:131357125-131357147 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1061829731 9:133283818-133283840 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1061955286 9:133958187-133958209 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1061979501 9:134092967-134092989 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1062494225 9:136824088-136824110 CACTAAAAGGTTCAGTGAGGTGG + Intronic
1062556838 9:137116667-137116689 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1062735201 9:138133365-138133387 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1203443330 Un_GL000219v1:31694-31716 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1203514138 Un_KI270741v1:150603-150625 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1185444732 X:251690-251712 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1185575813 X:1171355-1171377 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1185682502 X:1900035-1900057 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1186645906 X:11507053-11507075 TCCTACAAGGCTCTGTGCTTAGG - Intronic
1187198857 X:17115541-17115563 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1187858570 X:23660395-23660417 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1189079498 X:37955706-37955728 CCCTAAAGGACTCTGTGAATTGG + Intronic
1189889382 X:45583144-45583166 CCCAAAAAGGCTATCTGCTGTGG + Intergenic
1191033321 X:55998301-55998323 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1191228001 X:58065867-58065889 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1192626445 X:72733599-72733621 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1194200772 X:90951030-90951052 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1195031679 X:100932600-100932622 CTCTATAAGGCTCAGGGATGGGG + Intergenic
1197383860 X:125779925-125779947 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1197509548 X:127354366-127354388 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1197598524 X:128496996-128497018 CCCCAAAAGTTGCTGTGATGAGG + Intergenic
1197649689 X:129051272-129051294 CCCTAAGAAGCACTGTGAGGTGG - Intergenic
1198064438 X:133082401-133082423 CACTAAAAGGCTTTAAGATGTGG - Intronic
1198602251 X:138296313-138296335 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1198605633 X:138333901-138333923 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1198696313 X:139342451-139342473 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1199256209 X:145721372-145721394 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1199570516 X:149262732-149262754 CCCTAAATAACTCTGTCATGAGG - Intergenic
1199896199 X:152130033-152130055 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1200245439 X:154521601-154521623 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1200294987 X:154910748-154910770 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1200487071 Y:3782848-3782870 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1200731656 Y:6749302-6749324 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1200752447 Y:6958960-6958982 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1200776107 Y:7171644-7171666 CCCCAAAATTCTCTCTGATGGGG + Intergenic
1200777221 Y:7180290-7180312 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1200817926 Y:7553090-7553112 CCCTGAAAAGCTATCTGATGGGG + Intergenic
1200833641 Y:7711753-7711775 CCTGTAAAGGCTCTGTGCTGAGG + Intergenic
1201074480 Y:10176335-10176357 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1201356699 Y:13104353-13104375 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1201452708 Y:14133617-14133639 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1201962735 Y:19700010-19700032 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1202253145 Y:22893570-22893592 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1202406135 Y:24527319-24527341 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1202464647 Y:25142762-25142784 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic