ID: 948480792

View in Genome Browser
Species Human (GRCh38)
Location 2:238249064-238249086
Sequence CCACGTCGATGGCTGCGGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948480787_948480792 -9 Left 948480787 2:238249050-238249072 CCGTGAGCTTACTGCCACGTCGA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 948480792 2:238249064-238249086 CCACGTCGATGGCTGCGGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 60
948480784_948480792 20 Left 948480784 2:238249021-238249043 CCTTTTAGGGCCATATCAGAAAT 0: 1
1: 0
2: 1
3: 14
4: 113
Right 948480792 2:238249064-238249086 CCACGTCGATGGCTGCGGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 60
948480785_948480792 10 Left 948480785 2:238249031-238249053 CCATATCAGAAATCGAGTCCCGT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 948480792 2:238249064-238249086 CCACGTCGATGGCTGCGGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 60
948480786_948480792 -8 Left 948480786 2:238249049-238249071 CCCGTGAGCTTACTGCCACGTCG 0: 1
1: 0
2: 0
3: 2
4: 25
Right 948480792 2:238249064-238249086 CCACGTCGATGGCTGCGGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948480792 Original CRISPR CCACGTCGATGGCTGCGGGC AGG Exonic
902215065 1:14929625-14929647 CCAGGGCGATGGCTTCGGCCGGG - Intronic
902260288 1:15219857-15219879 CCATTTGGATGGCGGCGGGCGGG + Exonic
912414179 1:109497076-109497098 CCAAGCCGAAGGCTGCTGGCTGG + Intronic
915362717 1:155295478-155295500 CCAGGGCGATGGCCACGGGCCGG + Exonic
923631135 1:235650043-235650065 TGACGTCGGTGGCAGCGGGCGGG - Intronic
1064458290 10:15508747-15508769 CCATGGCGATGTCTGTGGGCAGG + Intergenic
1070577159 10:77687827-77687849 CCAGGTGGATGGCAGGGGGCAGG - Intergenic
1073491554 10:103855905-103855927 CCAGGCCGCTGGCTGCGCGCTGG - Intergenic
1076140883 10:128077792-128077814 CCACCTGGAGGGCTTCGGGCTGG - Intronic
1077421211 11:2450890-2450912 CCACGTGGGTGGGTGCTGGCTGG + Intronic
1097191551 12:57221774-57221796 CCACCTCCATGGCTGAGGGTGGG - Intronic
1104619512 12:130300887-130300909 CCACGTCTGTGGATGTGGGCAGG - Intergenic
1108810397 13:54216371-54216393 CTACATTGATGGCTGCTGGCAGG + Intergenic
1123684490 15:22787180-22787202 CCACGGCGAGGGCTGCCGGGCGG - Intronic
1124252711 15:28117447-28117469 CCACGTCCACAGCTGCGGCCCGG + Intronic
1124640230 15:31392347-31392369 CCACCTCTTTGGCCGCGGGCTGG + Intronic
1126048098 15:44663285-44663307 CCACCTCTATGGCTGCAGGGAGG + Intronic
1129939058 15:79478127-79478149 CCACGTGGATGGCAGGAGGCTGG - Intergenic
1132503822 16:297025-297047 CCACGAGGCTGGCTGCGTGCGGG + Intronic
1133221251 16:4320034-4320056 CCAGTTCGATGGCTGGGGGGCGG + Intronic
1139261170 16:65595695-65595717 CCAGGTGGATGGCTACAGGCAGG - Intergenic
1141700203 16:85638867-85638889 CCCCGTCAATGGCTCTGGGCCGG + Intronic
1151897031 17:76987417-76987439 CCACGTGGACTCCTGCGGGCTGG - Intergenic
1152110914 17:78357415-78357437 CCACTTCCCTGGCTGTGGGCTGG + Exonic
1152895506 17:82908704-82908726 CCACGTTCATGGCTGCTGCCCGG - Intronic
1160349599 18:78165254-78165276 GCACGTCGATGCCAGCAGGCTGG - Intergenic
1161323920 19:3653874-3653896 CCAGGGCGATGTCTGTGGGCAGG - Intronic
1165940747 19:39413631-39413653 CCCCGCCGAGGGCTGCGCGCTGG - Intronic
1168315224 19:55482078-55482100 CCGCTGCGATGGCTGCGAGCAGG + Exonic
925238450 2:2299374-2299396 CCCCATGGATGCCTGCGGGCTGG + Intronic
928460948 2:31472047-31472069 CCACGTCTATGTCTGAAGGCAGG + Intergenic
934529158 2:95074443-95074465 CCACGTGGCTTCCTGCGGGCAGG + Intergenic
935059354 2:99593992-99594014 CCACGGCCACGGCCGCGGGCGGG + Exonic
935599616 2:104909604-104909626 CCAGGGCACTGGCTGCGGGCTGG + Intergenic
946395570 2:219442210-219442232 CCCCGCCGAGGGCGGCGGGCCGG + Intronic
948115602 2:235493095-235493117 CCACGCCGATGGCTGGGGGCAGG + Intergenic
948480792 2:238249064-238249086 CCACGTCGATGGCTGCGGGCAGG + Exonic
1168785329 20:534510-534532 CCACCTTGCTGGCTGGGGGCTGG + Intronic
1171811062 20:29744315-29744337 CCACTTCGATGTCTGCGAGTGGG - Intergenic
1177331377 21:19668402-19668424 TCATGTTGATGGCTGCGGACTGG + Intergenic
1183952671 22:41360401-41360423 CCACGTGGAAGGCTGAGAGCAGG - Intergenic
954909121 3:54088103-54088125 CCACGTCGGTGGCTTCCGCCAGG + Intergenic
957783051 3:84844621-84844643 CCAAGTGGATGGCTGCTGACTGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
982033649 4:151325338-151325360 CCTCGCCCATGGCTGAGGGCCGG - Intronic
985578062 5:682790-682812 CCATGTGGATGGCTGTGGGGTGG + Intronic
985592989 5:774931-774953 TCACGTGGATGGCTGTGGGGTGG + Intergenic
997443796 5:133926821-133926843 CCACGTGGGTGGGTGCTGGCTGG + Intergenic
997593592 5:135091458-135091480 CCATGTCCATGGCTGCTGTCTGG - Intronic
1001396201 5:171420753-171420775 ACCCCTCGCTGGCTGCGGGCAGG - Intronic
1006193040 6:32221070-32221092 CCACGTTGTGAGCTGCGGGCAGG - Exonic
1007764808 6:44154205-44154227 GCAGGCGGATGGCTGCGGGCAGG + Intronic
1020256040 7:6503676-6503698 CCAAGAGGATGGCTGCGGGCGGG + Exonic
1024549485 7:50550201-50550223 CCATGTCGATGGCTGCTGACTGG - Intronic
1025174117 7:56788328-56788350 TCACTTCGACGGCTGCTGGCAGG + Intergenic
1025697679 7:63788097-63788119 TCACTTCGACGGCTGCTGGCAGG - Intergenic
1030426109 7:109380910-109380932 CCATGTTGATGGCTGCTGACAGG - Intergenic
1032005984 7:128302271-128302293 ACACGCGGCTGGCTGCGGGCAGG + Exonic
1035302998 7:157909644-157909666 CCATGCAGATGGCTGCAGGCAGG - Intronic
1048468284 8:134685400-134685422 CCATGACGCTGGCTGTGGGCTGG - Intronic
1049488108 8:142876874-142876896 CCAAGTTGCTGGCTGCGGGGAGG + Exonic
1061949595 9:133929037-133929059 CCATGCCGAGGGCTGTGGGCGGG - Intronic
1189859659 X:45259447-45259469 CAAGGTCAATGGCTGAGGGCAGG + Intergenic
1199500396 X:148500751-148500773 CCGCCTGGCTGGCTGCGGGCCGG - Exonic