ID: 948483778

View in Genome Browser
Species Human (GRCh38)
Location 2:238267314-238267336
Sequence CTTGAAGCTCAGAGGTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 193}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948483778_948483780 1 Left 948483778 2:238267314-238267336 CCTTGTAACCTCTGAGCTTCAAG 0: 1
1: 0
2: 0
3: 8
4: 193
Right 948483780 2:238267338-238267360 GAAGAGCCCAGATATTATTTTGG 0: 1
1: 0
2: 0
3: 13
4: 161
948483778_948483783 4 Left 948483778 2:238267314-238267336 CCTTGTAACCTCTGAGCTTCAAG 0: 1
1: 0
2: 0
3: 8
4: 193
Right 948483783 2:238267341-238267363 GAGCCCAGATATTATTTTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 194
948483778_948483788 9 Left 948483778 2:238267314-238267336 CCTTGTAACCTCTGAGCTTCAAG 0: 1
1: 0
2: 0
3: 8
4: 193
Right 948483788 2:238267346-238267368 CAGATATTATTTTGGGGGTGGGG 0: 1
1: 0
2: 6
3: 49
4: 429
948483778_948483782 3 Left 948483778 2:238267314-238267336 CCTTGTAACCTCTGAGCTTCAAG 0: 1
1: 0
2: 0
3: 8
4: 193
Right 948483782 2:238267340-238267362 AGAGCCCAGATATTATTTTGGGG 0: 1
1: 0
2: 0
3: 69
4: 238
948483778_948483781 2 Left 948483778 2:238267314-238267336 CCTTGTAACCTCTGAGCTTCAAG 0: 1
1: 0
2: 0
3: 8
4: 193
Right 948483781 2:238267339-238267361 AAGAGCCCAGATATTATTTTGGG 0: 1
1: 0
2: 3
3: 18
4: 256
948483778_948483787 8 Left 948483778 2:238267314-238267336 CCTTGTAACCTCTGAGCTTCAAG 0: 1
1: 0
2: 0
3: 8
4: 193
Right 948483787 2:238267345-238267367 CCAGATATTATTTTGGGGGTGGG 0: 1
1: 0
2: 1
3: 35
4: 294
948483778_948483789 28 Left 948483778 2:238267314-238267336 CCTTGTAACCTCTGAGCTTCAAG 0: 1
1: 0
2: 0
3: 8
4: 193
Right 948483789 2:238267365-238267387 GGGGTAGCCAGAAGAGCTAATGG 0: 1
1: 0
2: 0
3: 13
4: 151
948483778_948483785 7 Left 948483778 2:238267314-238267336 CCTTGTAACCTCTGAGCTTCAAG 0: 1
1: 0
2: 0
3: 8
4: 193
Right 948483785 2:238267344-238267366 CCCAGATATTATTTTGGGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948483778 Original CRISPR CTTGAAGCTCAGAGGTTACA AGG (reversed) Intronic
900647069 1:3713787-3713809 CGTGAGGCTCAGAGATTACGTGG + Intronic
902784949 1:18726923-18726945 TTGGAAGCTCAGAGGATACGTGG - Intronic
903201786 1:21746353-21746375 CTTGTAGCTGGGAGGCTACAAGG - Intronic
905646844 1:39630838-39630860 CCTGAAGATCAGAGGCTCCATGG + Intronic
907074987 1:51570039-51570061 CTTGAAAATCAGAGGTAGCATGG - Intergenic
908590508 1:65627137-65627159 TTTGAACCACAGATGTTACATGG - Intronic
910901438 1:92125572-92125594 GTTAAAGATCAGAGGTGACAAGG + Intronic
911394883 1:97293088-97293110 CATGAAGCACAGAGGTTAATAGG + Intronic
912406521 1:109443196-109443218 CATGAAACTCAGAGGGCACAGGG + Intergenic
916405391 1:164492992-164493014 CCTGAAGGTGAGAGGGTACATGG - Intergenic
916602084 1:166303074-166303096 CTTGAAGTTCTTAGGTTACCAGG + Intergenic
920844836 1:209585009-209585031 ATTGAAGCTTAGAAGTTAAAGGG + Intronic
921251887 1:213305872-213305894 CTAGATTCTCAGAAGTTACAGGG - Intergenic
922589182 1:226760579-226760601 TTTGAAGCTCAGTGATTTCAGGG + Intergenic
923309741 1:232724967-232724989 CTCAAAGTTCTGAGGTTACAAGG - Intergenic
924470720 1:244340441-244340463 ATTGAAGCTCAGAGATGATAAGG + Intergenic
1062931392 10:1354914-1354936 CATGGAGCTCAGAGGCTAGAGGG - Intronic
1063123594 10:3122080-3122102 CTCAAAGCACAGGGGTTACAGGG + Intronic
1066100543 10:32114262-32114284 CTTGAACCTGAGAGGTTGCGTGG - Intergenic
1067554107 10:47255787-47255809 CTTGGAGCTCAGAGGAGAAAAGG + Intergenic
1067563080 10:47317553-47317575 CTTGGAACACAGAGGTTGCATGG + Intergenic
1068686173 10:59872039-59872061 GTGTAAGCACAGAGGTTACAAGG - Intronic
1072596698 10:96879302-96879324 CTTGAAGCACTGAGGTTCAAGGG - Intronic
1074617953 10:115089189-115089211 CTTGCAGATGAGAGGTGACAAGG - Intergenic
1075870592 10:125770176-125770198 CTGGAAGCTCTGAGGGCACAAGG - Intronic
1076513788 10:131031734-131031756 TTAGAAACTCAGAGGTTAAAAGG - Intergenic
1077831795 11:5880608-5880630 CTTGTTGCTCAGAGGCTTCAAGG + Intronic
1077936516 11:6793764-6793786 ATTGTAGCTCATATGTTACATGG - Intergenic
1078214713 11:9301783-9301805 CTTGGAGCTAAAAGGTTAAATGG + Intronic
1080674863 11:34416340-34416362 CTTGAATCTGAGAGGATGCAAGG - Intergenic
1082813566 11:57493680-57493702 CAATAAGCTCAGAGGTTGCAAGG + Intronic
1083585820 11:63858433-63858455 CTTGAACCTGGGAGGTTGCAGGG - Intronic
1085823072 11:79813914-79813936 CTTGAAGTCCTGAGGATACATGG - Intergenic
1086222898 11:84471248-84471270 CTGACAGCTCAGAGATTACAAGG + Intronic
1087534048 11:99421197-99421219 CTATAAGCTCAGGGGATACATGG + Intronic
1088823198 11:113474221-113474243 CTTGAAGAGCAGAGGTAAGAGGG - Intronic
1090261657 11:125325329-125325351 CTGGAAGCTCAGAGCTTAGTGGG + Intronic
1090547782 11:127784409-127784431 CCAAAAGCTCAGTGGTTACAGGG + Intergenic
1091436472 12:477206-477228 CGTGAAACTCAGATGTTAAAAGG - Intronic
1091956809 12:4651419-4651441 CATGAAGCTCACAGTTTAAAGGG - Intronic
1092414094 12:8276671-8276693 CTTTAAGATCAGGGGATACAAGG - Intergenic
1092466559 12:8738258-8738280 CTTGAACCTCAGGAGTTCCAAGG - Intronic
1092533602 12:9365685-9365707 CTTCATGCACAGAAGTTACAGGG - Intergenic
1092810187 12:12266026-12266048 CGTGAATACCAGAGGTTACAAGG + Intronic
1093062572 12:14623050-14623072 CTGGAAGCTGGGAGGTTCCACGG + Intronic
1093399213 12:18723733-18723755 CTTGAAACCCAGTGGTTATAGGG + Intronic
1094608145 12:31967278-31967300 CTTGCAGCACAGTGGTTAGAAGG - Intronic
1096718787 12:53506275-53506297 CTTGAAGCTGAGAAGGCACAGGG + Exonic
1097705935 12:62868301-62868323 GTTCAGGCTCAGATGTTACATGG - Intronic
1101968054 12:109294294-109294316 CACGCAGCTCAGGGGTTACAAGG - Intronic
1102589433 12:113946320-113946342 GTTGGAGCTCAGTGGTTTCAGGG + Intronic
1102960991 12:117093163-117093185 CCAGAAGCTCAGGGGTTCCAGGG - Intronic
1107482771 13:40798706-40798728 GCTGAGGCTCAGAAGTTACATGG + Intronic
1111484385 13:88877074-88877096 CTGGAAGCTGAGATGCTACAGGG + Intergenic
1112192664 13:97193052-97193074 TTTTTAGCTCAGTGGTTACATGG + Intergenic
1113352958 13:109547520-109547542 TTAGCAGCTCAGAGGTGACAAGG - Intergenic
1113367766 13:109692668-109692690 CTTGAAGCTCTGAGTTTTCTGGG - Intergenic
1115368805 14:32589006-32589028 CTTGAAGTTAAGAGATGACAGGG + Intronic
1118827827 14:69399771-69399793 TTTGATTCTCAGAGGTTTCATGG + Intronic
1119152306 14:72372906-72372928 CTTGAGGCTAAGAGGCTGCATGG + Intronic
1119986877 14:79148219-79148241 CTGGAAGCTCAGAGGGTTCATGG + Intronic
1120145229 14:80971756-80971778 CTTGAAGATCATTGGATACAAGG - Intronic
1120698323 14:87669377-87669399 CTCGAACCTCAGAGTTAACAGGG + Intergenic
1122323443 14:100868832-100868854 CTTGACCCTCAGAGGTTTCCAGG + Intergenic
1123797958 15:23792990-23793012 CTTGCAGCTCAGAAGTGCCATGG - Intergenic
1124342534 15:28899441-28899463 CATGAAGCTGAGTGGTTACGAGG - Intronic
1128068542 15:64779179-64779201 CGAGAAGCTCAGAGGTGATATGG - Intergenic
1128457202 15:67838186-67838208 CTAGAAGCACAGAGGTTGGAAGG + Intergenic
1129892695 15:79081999-79082021 GTGTAAGCTCAGAGCTTACAGGG - Intronic
1130381527 15:83376190-83376212 CTTCAAGCTCCGAGGTTCCCAGG - Intergenic
1132344543 15:101100473-101100495 ATTGAAGCTCAGAGGCTAAGAGG + Intergenic
1132833498 16:1941241-1941263 CTTGAAGGTGAGAGGCCACAGGG - Exonic
1133236023 16:4387809-4387831 CTGGAAGCTCCGGGGGTACAGGG + Intronic
1133355282 16:5131907-5131929 CTTTAAGATCAGGGGATACAAGG - Intergenic
1133867535 16:9658181-9658203 CCTGAAGCTCAGTGGAGACATGG - Intergenic
1134790034 16:16981516-16981538 CGTGAAGCTCAGTTGTGACAAGG + Intergenic
1137859589 16:51832820-51832842 ATTGAGGCTCAGAGATTACATGG - Intergenic
1138958834 16:62005389-62005411 TGTGAAGCTCAGAGGTCACAAGG + Intronic
1143601964 17:7952886-7952908 CTTGAAGCTCAGGTTTCACAGGG + Intergenic
1145967707 17:28932064-28932086 CTTGAAGCAGAGAGGAAACATGG - Intronic
1146998860 17:37345596-37345618 CTTGAAGAAAAGAGATTACAGGG + Intronic
1147566095 17:41537268-41537290 CTTGAAGCCCAGAGTCTAGAAGG - Intergenic
1150004137 17:61459242-61459264 CTTGTAGCTCAGTGGTGTCAGGG + Intronic
1152334618 17:79693390-79693412 CTTGGAACTCACAGCTTACAGGG - Intergenic
1152737309 17:82003904-82003926 ATTGAAGCTCAGAGCCTCCAGGG + Intronic
1155211767 18:23608133-23608155 CATGAAGCTCAGAGTTTAGTGGG - Intronic
1155983034 18:32200683-32200705 CTTGAACTTCAGATGTTACCTGG + Intronic
1156432507 18:37091581-37091603 CTTGAGTCTCAGTGGGTACATGG - Intronic
1157057462 18:44247659-44247681 CCTGAAGCTCAGAGGGGATAAGG - Intergenic
1160229830 18:77039415-77039437 GTTGAAGCTCTGAGGCTAGAGGG + Intronic
1160492893 18:79352646-79352668 CTTGAAACACAGAGGTTTCGAGG - Intronic
1165204927 19:34175304-34175326 CTTGGAAGGCAGAGGTTACAGGG - Intronic
926345347 2:11939909-11939931 CAGGAAGCTCAGATGTTACCAGG + Intergenic
927242781 2:20933093-20933115 CATGAAGCTCAGAGGTGTGAAGG + Intergenic
928358662 2:30645210-30645232 CTTGAACCTGAGAGGATGCAGGG - Intergenic
936388650 2:112053939-112053961 CTTAAAGCTCAGAGGGGTCAGGG - Intergenic
938724051 2:134091251-134091273 TTTGATGCTCACAGGTTCCAGGG - Intergenic
939725967 2:145721954-145721976 CTTGGATCTCAGAGTTTACTAGG - Intergenic
939767215 2:146265876-146265898 CTTGCTGCTCAGAAGTTATAAGG + Intergenic
939825818 2:147014544-147014566 CTAGGAACTCAGAGGTTACAGGG - Intergenic
940600344 2:155850752-155850774 CTTCTAGCTCAGAGCTTCCAAGG + Intergenic
940779797 2:157920571-157920593 CTGGAAGCTCAGAGCCTACTTGG - Intronic
941403157 2:165056585-165056607 CTTGAAGCTCAGGGTTTTTATGG - Intergenic
943027091 2:182642984-182643006 ATGGAAAATCAGAGGTTACAAGG + Intergenic
943501514 2:188695017-188695039 CTTGAAGTTGAGAGAGTACAGGG - Intergenic
944084614 2:195830829-195830851 CATGAAGCTTATAGGTTAAAGGG - Intronic
944527721 2:200636928-200636950 CTTGAAGCTCCCAGCTAACAAGG + Exonic
944681953 2:202085263-202085285 CTGGGACCTGAGAGGTTACAGGG + Intronic
948483778 2:238267314-238267336 CTTGAAGCTCAGAGGTTACAAGG - Intronic
948656302 2:239478680-239478702 CTTGAAGTACTGAGATTACAGGG - Intergenic
1168860250 20:1041057-1041079 GTTGAAACTCAGAAGATACAAGG - Intergenic
1172856105 20:38003802-38003824 CTTGAAGCTGGGAAGTTCCATGG + Intronic
1174634899 20:51990545-51990567 CCTAAGGCTCAGAGGTTAGATGG - Intergenic
1174963923 20:55189341-55189363 TTTGGAGATCTGAGGTTACAAGG + Intergenic
1175191987 20:57217448-57217470 CTGAAAGCCCAGGGGTTACAAGG + Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1178166602 21:29985293-29985315 CTTGAAGGTCAGATTTTACTGGG - Intergenic
1179620100 21:42608530-42608552 CTTGAAGCTCAGGGGTTGGGTGG + Intergenic
1179910161 21:44443212-44443234 CTTGAAGCTCAGAGGCAGCAGGG + Intergenic
1180247628 21:46558527-46558549 CTTGAAGCTAAAATGTTACATGG - Intronic
1181775138 22:25153926-25153948 CTTGAAGGTCACAGGATTCATGG - Intronic
1183517713 22:38276839-38276861 CTTGAACCTGGGAGGTTGCAGGG - Intergenic
1184850188 22:47115415-47115437 CTTGAATCTCAGTGGCTAAAGGG - Intronic
1185028268 22:48427820-48427842 CTTGAAGCTCACTGGGTCCAGGG - Intergenic
950486468 3:13276821-13276843 CTTGAAGCTCTGAGGTAGCAAGG - Intergenic
953212181 3:40885761-40885783 AATGAAGGACAGAGGTTACATGG - Intergenic
954772769 3:52987619-52987641 CTTGGAGCTCAGAGAATACAAGG + Intronic
955171093 3:56566081-56566103 ACTGAAGCCCAGAGGTTAAATGG - Intronic
957059126 3:75467542-75467564 CTTTAAGATCAGGGGATACAAGG - Intergenic
961294327 3:125872183-125872205 CTTTAAGATCAGGGGATACAAGG + Intergenic
962339016 3:134565698-134565720 TCTGAAGCTCAGAGGTAACTTGG - Intronic
965178551 3:165367965-165367987 CTTGAAGGTCAGTGTTTACCAGG + Intergenic
965245320 3:166259018-166259040 CATGATACTCAGAGGTGACAGGG - Intergenic
966264568 3:178023571-178023593 CTTGAGGATCAGTGGTAACAGGG + Intergenic
966549036 3:181183528-181183550 ATTGAAACTGAGAGGTGACAGGG - Intergenic
966827418 3:183976702-183976724 CTTGAAGCTCACATGTTTGAGGG - Intronic
967050791 3:185782747-185782769 CATGAAACTCACAGGGTACAAGG + Intronic
967773000 3:193355629-193355651 CTTGAACCTCAGTGTTTTCATGG - Intronic
969003034 4:3997737-3997759 CTTTAAGATCAGGGGATACAAGG - Intergenic
969429772 4:7147385-7147407 CTGGAAGCTCAGTGGGTGCAGGG + Intergenic
969810899 4:9647080-9647102 CTTTAAGATCAGGGGATACAAGG + Intergenic
970759297 4:19464959-19464981 CTTGAAGCTCAGGGAGAACAAGG - Intergenic
972011937 4:34193908-34193930 GTTAAAGCTCAGAGGATATAGGG + Intergenic
975663524 4:76710434-76710456 ATAGAAGCTCAGAGTTTAGAAGG + Intronic
976608399 4:87004177-87004199 CTAGGTGCTAAGAGGTTACATGG + Intronic
977923693 4:102673914-102673936 CTTACAACTCAGAGGTTACTCGG + Exonic
978878738 4:113674490-113674512 CTTGATGCCCACAGTTTACAAGG + Intronic
981590752 4:146357809-146357831 CTTGAAGCTGAGAGGCTGGAAGG + Intronic
984256305 4:177393575-177393597 CCTGAACCTCAGAGGATACGTGG + Intergenic
984794829 4:183649830-183649852 GTTGAAGATCTGAGGTTCCAAGG + Intronic
985382770 4:189412855-189412877 CTTGAAGACCTGAGGTCACAGGG - Intergenic
987864582 5:23523038-23523060 TTTAGAGATCAGAGGTTACATGG + Intronic
991407758 5:66318451-66318473 CTTGAATCTCAGAGGTACAAGGG - Intergenic
993478991 5:88399547-88399569 TTTGAAGCTAAGATGTAACAGGG + Intergenic
994061431 5:95482346-95482368 CTTGAAACTGAGAGATAACATGG + Intronic
995135195 5:108673049-108673071 CTCTAATCTCAGAGGTTTCAGGG - Intergenic
996569743 5:124919777-124919799 CTTATAGCTCAGAGGTTCAAAGG - Intergenic
998071297 5:139199820-139199842 CTAGAAGCTCATAGAGTACATGG - Intronic
999122816 5:149222681-149222703 TTTTTAGCTCAGAGGATACAAGG + Intronic
1001644277 5:173268754-173268776 CTGGAAGCTCAGAATTTTCATGG + Intergenic
1003608576 6:7588125-7588147 CATGAAGCTCTGAGATGACATGG + Intergenic
1003734622 6:8864682-8864704 CTTGAAGGTCAAAGGTCATAAGG + Intergenic
1003939205 6:11007523-11007545 CTAGAACCTCAGAGGGAACAAGG + Intronic
1004965445 6:20844433-20844455 TTTGAATCTCAGCTGTTACATGG + Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1015149898 6:130025268-130025290 CTTGAAGTTCAGCGGATCCATGG + Intronic
1016407444 6:143745323-143745345 ATTGATGCGCAGAAGTTACAGGG + Intronic
1019634330 7:2067418-2067440 CTGGAAGCTCAGAGCTTCCTGGG - Intronic
1020321981 7:6945856-6945878 CTTTAAGATCAGGGGATACAAGG - Intergenic
1022643034 7:32206136-32206158 CTTGACCCCCAGAGCTTACATGG + Intronic
1022755025 7:33278083-33278105 CTTGAAGGTTAGAGGCTAGAGGG + Intronic
1024035457 7:45504295-45504317 CTTGCTGCTCAGAAGTCACATGG + Intergenic
1026518412 7:71093422-71093444 CTAGGAGCTCAGAGTTTAAATGG + Intergenic
1028364006 7:90005925-90005947 CTTGAAGCTCTGAGGTGAAGAGG - Intergenic
1030111988 7:106034696-106034718 ATTGAAGCTGAGAGCTTCCAAGG - Intergenic
1032002635 7:128275424-128275446 CTCTAAGCTAAGAGGTGACATGG + Intergenic
1032116514 7:129122218-129122240 TTTGAAGCTCTGAGGTTTTATGG - Intergenic
1032434327 7:131887795-131887817 CTTGGAGCTCACAGTCTACAAGG + Intergenic
1032684674 7:134220951-134220973 ATTGATGCTAAGAGGTCACAGGG - Intronic
1034309803 7:150077404-150077426 CTTTAACCACAGAGGTCACATGG - Intergenic
1035955447 8:4072795-4072817 TATGAAGCTCATAGGTTTCAAGG + Intronic
1038086615 8:24204872-24204894 CTTGCAGCTTAGAGGAAACAGGG - Intergenic
1041672110 8:60502116-60502138 CTTGAAGCTCACTGGCTGCATGG - Intergenic
1042604755 8:70534232-70534254 CTTGAGGCTCAGAGGTTCTCAGG - Intergenic
1045135676 8:99214876-99214898 TGAGAAGCTCAGAGGTTACTGGG - Intronic
1045362107 8:101442321-101442343 CTTGGAGCTCAGAGGAGAGAAGG + Intergenic
1046530979 8:115444589-115444611 CTAGAAGCTCATAGGTTAGTGGG - Intronic
1047625042 8:126647726-126647748 CTTCATGCCCAGAGGATACATGG - Intergenic
1047916592 8:129590648-129590670 CTTGAGGCTCAGAGGGCTCAAGG - Intergenic
1051958902 9:22734333-22734355 CTGGAAGCTCATAGGCTTCACGG - Intergenic
1055828628 9:80356276-80356298 CTTGATGCTCAGACTTCACACGG + Intergenic
1056225638 9:84492585-84492607 CCTGAAGTGCAGAGGTTCCAGGG - Intergenic
1059052615 9:110943220-110943242 CTTGAAGCTCTAAGTTTACCTGG + Intronic
1195164048 X:102199781-102199803 GTTGAAGCACAGAGGTCACTTGG + Intergenic
1195194813 X:102487314-102487336 GTTGAAGCACAGAGGTCACTTGG - Intergenic
1195621465 X:106960054-106960076 CTTAGAGCTTAGAGGTTGCAAGG - Intronic
1196929710 X:120669330-120669352 CTACAAGCTCAGAGGTCTCAGGG - Intergenic
1197238098 X:124090847-124090869 CTTGAAGCACGCAGGTAACATGG + Exonic
1198273605 X:135079792-135079814 ATTGTGGCTCAGAGGTTAAATGG - Intergenic
1198436362 X:136620532-136620554 CTTGGAGATGAGAGGTCACAGGG - Intergenic
1199516487 X:148682423-148682445 CCTGAGTCTCACAGGTTACATGG + Intronic
1201400252 Y:13597175-13597197 ATTGCAGCTCAGGGGTTAAAGGG - Intergenic