ID: 948483951

View in Genome Browser
Species Human (GRCh38)
Location 2:238268212-238268234
Sequence ACAGTTCCCAACTTAGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948483951_948483957 19 Left 948483951 2:238268212-238268234 CCACGCTCTAAGTTGGGAACTGT 0: 1
1: 0
2: 0
3: 4
4: 57
Right 948483957 2:238268254-238268276 GTTCTGTTCCCTCCTCACCTGGG 0: 1
1: 0
2: 3
3: 35
4: 274
948483951_948483956 18 Left 948483951 2:238268212-238268234 CCACGCTCTAAGTTGGGAACTGT 0: 1
1: 0
2: 0
3: 4
4: 57
Right 948483956 2:238268253-238268275 TGTTCTGTTCCCTCCTCACCTGG 0: 1
1: 0
2: 4
3: 42
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948483951 Original CRISPR ACAGTTCCCAACTTAGAGCG TGG (reversed) Intronic
901247532 1:7744419-7744441 ACTGTTCCCAGCCTAGACCGGGG + Intronic
902382950 1:16061195-16061217 ACACTCCCCAACTTAGTGGGTGG - Intronic
907579524 1:55558975-55558997 CCAGTGCCCAGCTTAGAGCCTGG + Intergenic
908492707 1:64662368-64662390 ACAGTTCCCAATTAGGAGCCAGG - Intronic
1071225107 10:83519963-83519985 ACATTTTCCTACTTAGAGCTAGG - Intergenic
1075022177 10:118960027-118960049 AGACTTTCCAACTTACAGCGTGG - Intergenic
1076603320 10:131673504-131673526 TCAGCACCCAACTTAGAGAGGGG - Intergenic
1077098352 11:809613-809635 ACAGCTCCCAACATGGAGCGCGG - Intronic
1079427777 11:20360056-20360078 ACAGTTCCCATCTTACAGATAGG + Intergenic
1084916120 11:72430198-72430220 ACAGTTCCCAGCTTAGGGTAAGG + Intronic
1086094266 11:83034757-83034779 ACAGTTCCCATCTCACAGTGAGG - Intronic
1093792014 12:23263204-23263226 ATAGTTCCCAAATCAGAGCTGGG - Intergenic
1097862622 12:64533256-64533278 GCAGTTCCCATCTTCGAGCCCGG - Intergenic
1097863222 12:64538523-64538545 ACAGTTCTCAACTAAAAGGGTGG - Intergenic
1101439863 12:104695562-104695584 ACAGTTCCCAGCTGCAAGCGGGG + Intronic
1103874861 12:124119246-124119268 TCAGTTCCCAAGTGAGAGAGAGG - Intronic
1119925621 14:78490762-78490784 ACAGTACCCACCTTATAGGGTGG - Intronic
1121443047 14:93960926-93960948 CCAGTGCCCAGCTTAGAGCCTGG - Intronic
1136686054 16:31995622-31995644 CCAGTCCCCAGCTTAGAGGGTGG - Intergenic
1136786667 16:32939151-32939173 CCAGTCCCCAGCTTAGAGGGTGG - Intergenic
1136883103 16:33914639-33914661 CCAGTCCCCAGCTTAGAGGGTGG + Intergenic
1137772537 16:51028240-51028262 ACAAAGCCCAACTTAGAGGGAGG - Intergenic
1138203607 16:55108034-55108056 ACAGCTCCAAAGTTAGAGCCAGG - Intergenic
1138523284 16:57585501-57585523 AAAGTTCCAAACTTAGACAGTGG - Intronic
1203088903 16_KI270728v1_random:1200821-1200843 CCAGTCCCCAGCTTAGAGGGTGG - Intergenic
1147147016 17:38491290-38491312 CCAGTCCCCAGCTTAGAGGGTGG - Intronic
1149898023 17:60445818-60445840 ACAGTTACCATCTTAGGGTGTGG + Exonic
1153734097 18:8046524-8046546 TCAGTTCCCAACTTGCAGCAGGG + Intronic
1160560108 18:79750898-79750920 GCAGTTCCCATCTTACAGAGCGG + Intronic
1161526790 19:4760917-4760939 ACAGCTCCTAACTGAGAGCTGGG - Intergenic
1166476960 19:43135001-43135023 ACTGTGCCCAAGTTAGAGAGTGG - Intronic
1167642792 19:50691050-50691072 ACTGTTACGAACTTTGAGCGAGG - Intronic
940553281 2:155188821-155188843 ACAGTTTTCAGCTTACAGCGAGG - Intergenic
943478544 2:188388697-188388719 ACAGTTCCTAGCTTAGTGCCTGG - Intronic
948483951 2:238268212-238268234 ACAGTTCCCAACTTAGAGCGTGG - Intronic
1180186604 21:46143191-46143213 AGACTTCCCAACTTAGGGCTGGG + Intronic
954111271 3:48434766-48434788 ACATTTCCCAAGTCAGAGGGCGG + Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
983914327 4:173275348-173275370 TCAGTTCCCCACTCAGAGCTCGG - Intronic
984206636 4:176793318-176793340 ACATTTCCAAACTTTGAGCAGGG - Intergenic
985664564 5:1175357-1175379 ACAGTTCCCACCTCAGAGGCTGG + Intergenic
985933248 5:3075769-3075791 ACAGTGCTCTACTTAGAGGGTGG + Intergenic
996454325 5:123662612-123662634 ACAGTTCCTAACTGGGAGAGTGG + Intergenic
996964813 5:129295149-129295171 AGAGTTCCCAACTAAGAGCATGG - Intergenic
997188890 5:131911167-131911189 ACAGTTCCTAACTTAATGTGTGG + Intronic
1000006057 5:157186007-157186029 ACAGTTCCTAACTTACAGAGTGG - Intronic
1000070881 5:157740022-157740044 AAAGTTGCCAACTTAGAGACTGG - Exonic
1002183768 5:177444482-177444504 CCAGTTCCCACCATAGAGCTGGG - Intergenic
1010945132 6:81965138-81965160 GCGGTACCCAACATAGAGCGTGG - Intergenic
1013562511 6:111319807-111319829 GGAGTTCCCAACTGAGAGTGAGG - Intronic
1013852573 6:114534247-114534269 ACAGCCCCCAGCCTAGAGCGAGG - Intergenic
1015552262 6:134423975-134423997 ACAGTTCCCAACTTACAAAATGG + Intergenic
1018703266 6:166444780-166444802 ACAGTGCCCAGCTTAGAGCAGGG - Intronic
1029744895 7:102511402-102511424 ACAGGACCCAAGTTAGAGCCAGG + Intronic
1029762887 7:102610564-102610586 ACAGGACCCAAGTTAGAGCCAGG + Intronic
1036766923 8:11555265-11555287 ACAGCTCCCAAGGTAGAGCCTGG + Intronic
1041349480 8:56934346-56934368 AACATTCCCAACTTAGAACGGGG + Intergenic
1042111617 8:65387373-65387395 ACAGCTTCCAACTTAGAAAGTGG - Intergenic
1042656136 8:71099121-71099143 AGAGTTTCTAACTTAGATCGGGG + Intergenic
1059903061 9:118950411-118950433 ACATTTCTCAACATAGAGCAGGG - Intergenic
1192438687 X:71158782-71158804 ACAGTTCCCAACTGACACTGTGG - Intronic
1193744766 X:85263614-85263636 ACAGTTCCCAAATTAAATAGTGG - Intronic