ID: 948484365

View in Genome Browser
Species Human (GRCh38)
Location 2:238271184-238271206
Sequence AGCTGGCGGCCCCCACAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948484359_948484365 -6 Left 948484359 2:238271167-238271189 CCTTTGCCAGAGCAGGCAGCTGG 0: 1
1: 0
2: 3
3: 50
4: 307
Right 948484365 2:238271184-238271206 AGCTGGCGGCCCCCACAGGTGGG 0: 1
1: 0
2: 2
3: 13
4: 110
948484358_948484365 0 Left 948484358 2:238271161-238271183 CCTTTACCTTTGCCAGAGCAGGC 0: 1
1: 0
2: 0
3: 17
4: 114
Right 948484365 2:238271184-238271206 AGCTGGCGGCCCCCACAGGTGGG 0: 1
1: 0
2: 2
3: 13
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948484365 Original CRISPR AGCTGGCGGCCCCCACAGGT GGG Intronic
900250209 1:1665005-1665027 GGCTGGAAACCCCCACAGGTAGG + Exonic
902451906 1:16501545-16501567 AGCTGGAGGCCCCCCCAAGGAGG - Intergenic
902510347 1:16963488-16963510 AGCTGGAGGCCCCCAGGGGCAGG + Intronic
903072052 1:20731536-20731558 AGCTGGGTGCCCCCAGAGGGCGG - Intronic
904575327 1:31501727-31501749 AGCTGGAGGACCCCACAGCTTGG - Intergenic
905772036 1:40644652-40644674 AGCTGTTGGCCTCCACAGTTTGG + Intronic
912008476 1:104932410-104932432 AGCTGGCAGCCGCCCCAGATGGG - Intergenic
912449204 1:109759020-109759042 AGCTGGGAGGCCCCATAGGTGGG + Intronic
915039230 1:152953907-152953929 AGCTGGCCGCACCCACAGGCAGG - Intergenic
917213534 1:172655239-172655261 GGCTGGTGGCTCCCACAGGCTGG - Intergenic
922505269 1:226122271-226122293 AGCCGGCGGCCCCGAGAGGCCGG - Intergenic
923226338 1:231941952-231941974 AGCAAGCTGCCCCCACAGGGAGG + Intronic
923419326 1:233797211-233797233 TGGTGGCTGCCCCCAGAGGTGGG + Intergenic
1073568968 10:104559955-104559977 AGCTTGAGGCTCCCACAGGGTGG + Intergenic
1076822452 10:132946268-132946290 AGCTGCCGGACCCCACAGTGTGG - Intergenic
1077562622 11:3273477-3273499 AGCCGGCTGCCCCCACAGGCTGG - Intergenic
1077568515 11:3319296-3319318 AGCCGGCTGCCCCCACAGGCTGG - Intergenic
1077705966 11:4485905-4485927 AGCAGGCAGCCAGCACAGGTAGG - Intergenic
1080283681 11:30585674-30585696 AGGTGGGGACCCCCAGAGGTCGG + Intronic
1084089123 11:66868960-66868982 ACGTGGCCGCCCCCACAGGTGGG - Exonic
1089826352 11:121281576-121281598 GTCTGGCTGCCCCAACAGGTGGG + Intergenic
1089954289 11:122556025-122556047 GGCAGGCAGACCCCACAGGTGGG - Intergenic
1100706267 12:97203535-97203557 AGTGGGCAGACCCCACAGGTGGG + Intergenic
1104000443 12:124856778-124856800 AGCGGGCGGCCCCTGCAGGATGG + Intronic
1104920039 12:132285940-132285962 GGCAGGAGGGCCCCACAGGTGGG + Intronic
1106182547 13:27381395-27381417 GGCTGGTTGCCCCCACAGGAGGG - Intergenic
1106724387 13:32469545-32469567 AGCTGTTGGGCCCCAAAGGTAGG + Intronic
1123924138 15:25091702-25091724 TGCTGGTGGATCCCACAGGTTGG + Intergenic
1128617529 15:69121766-69121788 AGCTTGGGGTCCCCACAGTTGGG - Intergenic
1129332454 15:74834627-74834649 AGCAGTGGGCCCCCACAGGGAGG - Intergenic
1132147555 15:99437590-99437612 AGCAGGCGGCCTCCCCAGATAGG - Intergenic
1132828787 16:1917760-1917782 AGCCTGGGGCCCCCACAGGGCGG + Intronic
1137711249 16:50568345-50568367 AGCTGGGGCCCCCCATAGGCTGG - Intronic
1142034361 16:87854554-87854576 TGCTGGCTGCCCCCACAGCAGGG + Intronic
1142225787 16:88877056-88877078 GGCTGGCAGCACCCACAGGCAGG + Exonic
1142229317 16:88892344-88892366 AGCTGCCGGGCCCCGCAGGCTGG + Exonic
1142740666 17:1930162-1930184 TGCTGGAGGCCTACACAGGTAGG - Intergenic
1144269396 17:13601923-13601945 CGCTGGCCGCCGCCACACGTGGG + Exonic
1144604590 17:16653563-16653585 AGCTGGCCTCCCTCACAGGTAGG - Intronic
1145128380 17:20320497-20320519 AGCTGGCGACCCGGGCAGGTCGG - Intergenic
1145219807 17:21079004-21079026 AGCTGCCGACCCCCAAAAGTTGG + Intergenic
1148760301 17:49996519-49996541 AGCTGGGGGTCCCCACAGAGGGG - Intergenic
1149335881 17:55635438-55635460 AGCTGGCTGCCCACACATCTGGG - Intergenic
1150443990 17:65214456-65214478 AGCTGGAGGAACCCAGAGGTGGG + Intronic
1152404231 17:80087335-80087357 TGCTGGCTGTCCCCACAGGCAGG + Intronic
1152542044 17:80981437-80981459 AGCCGGCGGCCCTCGCAGCTGGG - Intergenic
1162660429 19:12164165-12164187 AGCTGAGTGCCCCCAGAGGTTGG - Intronic
1163250642 19:16124621-16124643 AGAGGGTGGCCCCCACATGTGGG + Intronic
1163521628 19:17795231-17795253 ATCTGGCGGACCCCAGTGGTGGG + Intronic
1164137742 19:22428654-22428676 AGCTGGGGGCCCCGGCAGGGCGG + Intronic
1164958486 19:32406259-32406281 ACCTGGCGTCCCCATCAGGTAGG - Exonic
1165743855 19:38218903-38218925 AGCGGGGGTCCCCCAGAGGTGGG + Intronic
1165755068 19:38288231-38288253 AGCTGGAGGCCCGCACAGCAAGG - Intronic
1165923356 19:39312303-39312325 AGCTGGGGCTCTCCACAGGTAGG + Intronic
1166945597 19:46394152-46394174 AACTGACACCCCCCACAGGTGGG - Intergenic
930052257 2:47225592-47225614 AGCTGGCGGTTGCCACAGTTGGG + Intergenic
934579544 2:95427380-95427402 AGGTGGCGGCCCTCACAGGTCGG - Intergenic
934599900 2:95649345-95649367 AGGTGGCGGCCCTCACAGGTCGG + Intergenic
934655181 2:96113542-96113564 AGGTGGCAGCGCCCCCAGGTGGG - Exonic
940893938 2:159062536-159062558 TGCTGGCTGCCTACACAGGTGGG + Intronic
942544028 2:177044012-177044034 AGCTGACTGGCCCCAAAGGTAGG + Intergenic
944840692 2:203621091-203621113 AGCTGGGCATCCCCACAGGTAGG + Intergenic
946226936 2:218269244-218269266 CGCTGGAGGAGCCCACAGGTGGG - Intronic
948484365 2:238271184-238271206 AGCTGGCGGCCCCCACAGGTGGG + Intronic
948624735 2:239261970-239261992 AGCCCCCGGCCCCTACAGGTTGG + Intronic
1170737792 20:19026333-19026355 AGCAGCCGGTCCCCACATGTGGG - Intergenic
1170784866 20:19459093-19459115 ATCTTGCAGTCCCCACAGGTAGG - Intronic
1171972546 20:31573216-31573238 ATCTGGCGGCCCCCGCGGGGCGG - Intronic
1172010572 20:31843728-31843750 TGGTGGTGGCCCCCAGAGGTGGG - Intergenic
1172359515 20:34302697-34302719 GGGTGGGGGACCCCACAGGTTGG + Intronic
1173155719 20:40606877-40606899 AGCTGGCAGCCCCCAGAAGCTGG - Intergenic
1173586339 20:44186296-44186318 AGCTGGGGGCCCGCAGAGGTGGG - Intronic
1175956079 20:62610101-62610123 AGCAGGCGGCCCCCACAGCAGGG - Intergenic
1175985894 20:62764032-62764054 ACCTGGCTGCCCCCAAAGGAAGG - Intergenic
1178351367 21:31874445-31874467 AGCTGCCGGAGCCCACAGGTGGG - Intronic
1179943403 21:44654334-44654356 GGCTGGCAGCACCCAGAGGTTGG + Exonic
1180799197 22:18623920-18623942 AGCTTTGGGCCCCCAGAGGTGGG - Intergenic
1181222521 22:21371346-21371368 AGCTTTGGGCCCCCAGAGGTGGG + Intergenic
1184924591 22:47627985-47628007 TCCTGGCAGCTCCCACAGGTTGG + Intergenic
949918665 3:8984760-8984782 AGCAGGCTGCTCCCAGAGGTGGG - Exonic
954199340 3:49014890-49014912 AGATGGTGGCCCTCACGGGTGGG - Exonic
961780744 3:129318872-129318894 AGCTGGCTGCAGCCACAGGCTGG + Intergenic
968554716 4:1241023-1241045 TGCTGGCGGCCTCCACATGGAGG + Intronic
974635909 4:64563917-64563939 AGCTGCCAACCCCCAAAGGTTGG - Intergenic
977675164 4:99739514-99739536 AGCTGGCTTCCCCCAAAGATAGG + Intergenic
982885943 4:160783065-160783087 AGGTAGCAGCCCCCACATGTTGG + Intergenic
990109473 5:52305807-52305829 AGCTGGCAACCCCCAAAAGTTGG - Intergenic
995228012 5:109725304-109725326 AGCTGGCCTGCCCCACAGGCTGG - Intronic
996392341 5:122974878-122974900 AGCTGGCAGCACCCACACATTGG - Intronic
997606190 5:135177224-135177246 CACTGGCAGCACCCACAGGTGGG - Intronic
1007348647 6:41251998-41252020 AGCTGGAGGAGCCCACAGTTGGG + Intergenic
1007395757 6:41576804-41576826 AGCTGGCAGGCCGCACAGCTGGG + Intronic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1014256255 6:119162191-119162213 AGCTGGTGGACCCCACCAGTTGG - Intergenic
1014380809 6:120738816-120738838 AGCTGCCAGCCCCATCAGGTAGG - Intergenic
1017747735 6:157461761-157461783 AACTGGCGTCCCCCACAGGGTGG - Intronic
1019410285 7:903809-903831 AGCTGGCAGCCCCCACTGACAGG + Intronic
1019425828 7:976079-976101 GGCTGGCGGCCCCCAGAAGCTGG - Intergenic
1019570435 7:1708991-1709013 AGCTGGTGGCTCCGGCAGGTGGG + Intronic
1019733805 7:2640861-2640883 ACCTGGCTGCCTGCACAGGTGGG - Intronic
1026235339 7:68521943-68521965 AGCTGGAGCCCCCCACATGAGGG - Intergenic
1026289080 7:68989760-68989782 AGCAGGCGGCCAACACAGCTTGG - Intergenic
1026909365 7:74083626-74083648 AGCTCGCGGCGCCCCCAGGCCGG + Intronic
1028780271 7:94727968-94727990 AGCTGCCGACCCCCAAAAGTTGG + Intergenic
1032765359 7:134986675-134986697 AGGTGCCGGCCCCGACAGGACGG + Exonic
1033658979 7:143390920-143390942 ACCTGGTGCCCCCCTCAGGTGGG - Exonic
1034172345 7:149071977-149071999 ATCTGGCGGCCCACACGGGGAGG - Exonic
1038931561 8:32199219-32199241 AGCTGAGGGCCCCCACAGAAAGG - Intronic
1040501401 8:48008453-48008475 AGATGGCGGTCTCCACAGGTCGG + Exonic
1042446387 8:68889963-68889985 AGCTGCCAGCCCCCAAAAGTTGG - Intergenic
1048272394 8:133040047-133040069 AGCTGGAGGCCCTCACTGCTGGG + Exonic
1049211614 8:141389198-141389220 AGGAGGAGGCCCCCGCAGGTGGG - Intergenic
1049674096 8:143882200-143882222 TCCTGGCTGCCCCCACAGGTGGG - Intergenic
1053025408 9:34724870-34724892 AGCAGGCAGCCCCGACAGGAAGG + Exonic
1053036937 9:34833932-34833954 AGCAGGCAGCCCCGACAGGAAGG + Intergenic
1057276220 9:93677214-93677236 AGCTGGCCGGCCCCACGGCTGGG - Intronic
1057549299 9:96040200-96040222 GGCTGGCGGCCATCACAGCTGGG - Intergenic
1059996299 9:119913551-119913573 TTCTGGCAGCCCCCACAGGTAGG + Intergenic
1060796461 9:126515529-126515551 TGCTGGCGTGCCCCTCAGGTCGG - Intergenic
1061807598 9:133145033-133145055 AACTGGCAGCCACCAGAGGTTGG + Intronic
1062234628 9:135501956-135501978 AGCTGGCTGTCGGCACAGGTAGG + Exonic
1062658165 9:137614729-137614751 GGCTGGCGGCCCCCACTTCTTGG + Exonic
1194842707 X:98763667-98763689 AGCTGGAGGCCAACACAGGAAGG - Intergenic
1195676812 X:107512938-107512960 GGCTGGCAGCCCCAACAGGCAGG + Intergenic
1199589255 X:149451188-149451210 AGCCGGTGGCCCCCACTGGGAGG + Intergenic
1200101049 X:153689162-153689184 CCCTGGCTGCCCCCACGGGTCGG + Intronic