ID: 948485291

View in Genome Browser
Species Human (GRCh38)
Location 2:238276932-238276954
Sequence CCCGGGGGCTCTGGACGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948485291 Original CRISPR CCCGGGGGCTCTGGACGGTG AGG Intronic
900112741 1:1015426-1015448 CCCGAGGGCTCTGAAAGCTGAGG - Intergenic
900132443 1:1092803-1092825 CCGGAGGACTCTGGAAGGTGGGG + Intronic
900488111 1:2933102-2933124 GCAGGGGTCTCTGCACGGTGGGG + Intergenic
900511450 1:3062921-3062943 CCCGGGCGCTCTGGCTGCTGGGG - Intergenic
900880507 1:5377971-5377993 TCAGGGGGCTCTGGCTGGTGGGG + Intergenic
900999424 1:6141166-6141188 CCCGGCGACTCTGGAGGCTGAGG + Intronic
901160386 1:7172800-7172822 CCCCGGGGCCCTGGAGGGTGAGG + Intronic
901216090 1:7556159-7556181 CCTGCGGGCTCTGGGCGGAGAGG + Intronic
901220353 1:7580237-7580259 CCCTGGGGCTGTGGAGGCTGAGG + Intronic
903963215 1:27070321-27070343 CCCCAGGGCCCTGGATGGTGAGG + Intergenic
904045223 1:27604404-27604426 CCGGGGGGCTCTGGATCGAGCGG + Intronic
904238890 1:29131356-29131378 CCCGCTGGCTCTGGGCAGTGAGG - Intergenic
908534888 1:65067594-65067616 CCCGGGGGCGCAGGTGGGTGTGG - Intergenic
908785658 1:67732391-67732413 CCCATGGGATCTGGAAGGTGGGG + Intronic
909443579 1:75724367-75724389 CCCGGTTGCGCTGAACGGTGGGG - Intronic
912409020 1:109467019-109467041 GCCGGGGGGTCAGGGCGGTGGGG - Intronic
913177734 1:116290445-116290467 CCCTGGGGCACTGGAGGGTTTGG - Intergenic
913211825 1:116588814-116588836 CCTCGGCTCTCTGGACGGTGAGG + Exonic
914293601 1:146298038-146298060 CCCGGGAGCGCTAGTCGGTGCGG - Intergenic
914490007 1:148146136-148146158 CCCGGGGGCGCGGGCCGGGGTGG + Intronic
914554645 1:148748821-148748843 CCCGGGAGCGCTAGTCGGTGCGG - Intergenic
915835353 1:159171696-159171718 CCCGGGGGCTGGGGATGGGGAGG - Exonic
917725877 1:177826608-177826630 CCCTGGGGCTCTGGTTGGAGTGG + Intergenic
920017748 1:202927198-202927220 CCCGGAGGCTCTGGAGGCTCTGG + Exonic
920250949 1:204622143-204622165 CCCTGGGCCTCTGGAGGGTCTGG + Exonic
920272110 1:204773441-204773463 GCCCGGGGCTCTGGACCATGGGG + Intergenic
922729384 1:227941967-227941989 CCTGGAGGCTCTGGACCCTGGGG - Intronic
923674253 1:236065799-236065821 CCCGGGTGCTCTGGAAGGAATGG + Intergenic
924483856 1:244461305-244461327 CCCGGCGCCTCTGGACAGGGCGG - Intronic
924624136 1:245686103-245686125 CCCGGCTGCTCTGGAGGCTGGGG - Exonic
1062891471 10:1063846-1063868 CCAGGTGGATGTGGACGGTGAGG - Intronic
1062996355 10:1870521-1870543 CCAGGTGGCTCTGGACAGTGAGG + Intergenic
1064064776 10:12172374-12172396 CCCAGCTGCTCTGGAAGGTGAGG - Intronic
1067564622 10:47327652-47327674 CCAGTGGGGTCTGGAGGGTGGGG - Intergenic
1070042553 10:72795880-72795902 CCCGGGTACTCTGGAGGCTGAGG + Intronic
1070194779 10:74147167-74147189 CCCGGCTGCTCTGGAGGCTGAGG + Intronic
1070284404 10:75072757-75072779 CCCGGGGGCTCTGATCGTTCGGG - Intergenic
1071629093 10:87203834-87203856 CCCGGGGTCTGGGCACGGTGGGG - Intergenic
1072849116 10:98867944-98867966 CCCAGGTACTCTGGAGGGTGAGG + Intronic
1076136194 10:128046886-128046908 CCTGGAGGCTCTGAAAGGTGGGG + Intronic
1076171862 10:128326389-128326411 CCCGAGGGCTCTGGGCCGTCCGG + Intergenic
1076581182 10:131513016-131513038 CCCAGGCGCTCTGGCTGGTGTGG + Intergenic
1076753512 10:132555539-132555561 CCAGGAGCCTCTGGACAGTGGGG + Intronic
1076783535 10:132737559-132737581 CCAGCGTGCTCTGGATGGTGAGG + Intronic
1077326737 11:1967253-1967275 AGCGGGGCCTCTGGAGGGTGAGG - Intronic
1079167025 11:18053697-18053719 CCCAGGTGCTCTGGAGGCTGAGG + Intergenic
1081089969 11:38852105-38852127 CCCGGCTACTCTGGAGGGTGAGG + Intergenic
1083861621 11:65423109-65423131 CCCGGGTGCGCTGGTCTGTGTGG + Intergenic
1084310398 11:68313076-68313098 CCCGCGGGCTCGGGCAGGTGAGG - Intronic
1084936683 11:72590499-72590521 CCGGGGGGTTCTGGACGGCTCGG + Exonic
1085294163 11:75421268-75421290 CCCTGGGGCTTTGGAAGATGGGG + Intronic
1086837318 11:91640913-91640935 TACGGGGGCCCTGTACGGTGGGG - Intergenic
1088276132 11:108087847-108087869 CCCGGCTGCTCTGGAGGCTGAGG + Intronic
1088329380 11:108634332-108634354 TCTGGTGGCTCTGGAAGGTGTGG - Intergenic
1088823452 11:113475219-113475241 CGCCGGGGCTCTGAACGGCGCGG - Exonic
1089586417 11:119512560-119512582 CCAGGGAGCCCTGGAGGGTGGGG - Intergenic
1090609008 11:128453433-128453455 CCCTGGGTGTCTGGTCGGTGTGG - Intergenic
1091112030 11:132978550-132978572 CCCCGGGGGTCTGCAAGGTGTGG + Intronic
1202809718 11_KI270721v1_random:22433-22455 AGCGGGGCCTCTGGAGGGTGAGG - Intergenic
1091385081 12:88759-88781 CCTGGGGGCTGTGGAGGGAGAGG - Intronic
1096595549 12:52692781-52692803 CCTGCAGCCTCTGGACGGTGCGG + Exonic
1100309150 12:93378191-93378213 CCCGGGAGCGCTAGTCGGTGCGG - Exonic
1103191893 12:119008762-119008784 CCCGTTGGCTCTGGCTGGTGGGG - Intronic
1103288748 12:119826276-119826298 CCCTGGGTTTCTGAACGGTGGGG - Intronic
1103375118 12:120449561-120449583 CCCGGGTGCTCGGGAAGCTGAGG - Intronic
1104523655 12:129498367-129498389 CCCGGGTGCTCAGGAGGCTGAGG - Intronic
1105215080 13:18279440-18279462 CCTCGGCTCTCTGGACGGTGAGG + Intergenic
1105233421 13:18522664-18522686 CCACGGGGCTCTGGTCAGTGGGG - Intergenic
1105701942 13:22940557-22940579 CTTGGGGGCTCTGGAGGCTGAGG - Intergenic
1105854567 13:24362363-24362385 CTTGGGGGCTCTGGAGGCTGAGG - Intergenic
1113520600 13:110937857-110937879 CTCGGAGGCTGTGGAGGGTGGGG - Intergenic
1113750412 13:112773084-112773106 CCCGAGGGCTGTGGCCTGTGAGG + Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1113920149 13:113903163-113903185 CCCTGGGGCTCTGCACACTGCGG + Intergenic
1114046445 14:18880523-18880545 CCAGGGGCCTCTGGAGGGGGCGG + Intergenic
1114117767 14:19638927-19638949 CCAGGGGCCTCTGGAGGGGGCGG - Intergenic
1121120699 14:91374055-91374077 CCCCAGGGCTCTGCACAGTGTGG + Intronic
1123121668 14:105919609-105919631 TTCGGGGGCTCTGGAGGCTGGGG + Intronic
1124413213 15:29453532-29453554 CCAGGGCACTCTGGCCGGTGGGG - Intronic
1124620332 15:31270388-31270410 CCTGGGGGCCCTGGTCAGTGGGG - Intergenic
1126742606 15:51792850-51792872 ACCGGGGCCTGTGGAGGGTGGGG + Intronic
1127582256 15:60349025-60349047 CCGGGGTGCTCTGGACGGCAGGG + Intronic
1128367000 15:67011438-67011460 CCCGGGGGTTCTGAAGGCTGGGG + Intergenic
1128461425 15:67870645-67870667 CCCAGGGACTCGGGAGGGTGAGG + Intergenic
1129229534 15:74189109-74189131 TCTGTGGGCTCTGGAAGGTGAGG - Exonic
1131257448 15:90871725-90871747 CCCGGGTGCTCGGGCCGGGGAGG + Intronic
1132481035 16:166187-166209 TCCCCGGGCTCTGGGCGGTGTGG + Intronic
1132513343 16:354487-354509 CCTGGGAGCTCTGAAGGGTGAGG - Intergenic
1132591403 16:727860-727882 CCCCGGGGCTCTGGCCGGCCTGG + Intronic
1133048024 16:3099957-3099979 CCCGGGGGCTCAGAACGCTCAGG - Intergenic
1133269311 16:4602715-4602737 CCTGGGGGCTTGGGAAGGTGGGG + Intergenic
1133324815 16:4936347-4936369 CCCGGAGGCCCTGGGGGGTGTGG - Intronic
1133848781 16:9481940-9481962 GCAGGGGGCTCTGAGCGGTGGGG + Intergenic
1135607252 16:23835732-23835754 CCCGGGGGCCGAGGACGGGGTGG + Intergenic
1136455643 16:30378345-30378367 CCGGGGGGCGCTGGGCAGTGTGG + Exonic
1136900637 16:34034146-34034168 CCACGGGGCTCTAGTCGGTGGGG - Intergenic
1137610507 16:49814268-49814290 CCCGTGGGCTCTGGGGGGTGGGG + Intronic
1137988803 16:53131529-53131551 CCCGGGGGCTGTGGGCCGGGGGG - Intronic
1138106023 16:54287421-54287443 CCCGGGGGCACTGGAAGGGTAGG + Intergenic
1138487900 16:57358507-57358529 CCCAGGGTCTCTGCACTGTGTGG - Intergenic
1140776601 16:78254643-78254665 CCCGGGTGCTCAGGAGGCTGTGG - Intronic
1140930016 16:79618805-79618827 CCAGGGGGCTGTGGACTGCGGGG + Intergenic
1142202353 16:88767374-88767396 CTGGGGGGCTCTGGGCTGTGGGG - Intronic
1142269468 16:89081648-89081670 CCAGGAGGCTCTGGATCGTGGGG + Intergenic
1142805861 17:2370765-2370787 CTCGGGGGCTTTGAACAGTGGGG + Intronic
1143668103 17:8376430-8376452 CCCGTGTGGTGTGGACGGTGAGG - Intronic
1144702215 17:17347214-17347236 CCCAGGGGCTCAGGACAGGGAGG + Exonic
1144825357 17:18102706-18102728 TCCTGGTGCTCTGGAAGGTGTGG + Intronic
1145190613 17:20840787-20840809 CCCGGGGGCGCGGGCCGGGGTGG + Intronic
1146646815 17:34581559-34581581 CCCGGGCGCGCAGGCCGGTGCGG + Intronic
1147245605 17:39118317-39118339 CCCAGAGACTCTGGAGGGTGAGG - Intronic
1147296854 17:39490633-39490655 CCAGGGAGCTCTGGAGGGAGAGG - Exonic
1147434875 17:40405103-40405125 CCCAGGGGCTCAGGAGGCTGAGG - Intronic
1147673472 17:42190051-42190073 CCCTGGGGCTCTGGGAGGGGAGG - Intronic
1148092364 17:45030250-45030272 GCTGGGCGCTCTGGACGGTGGGG - Intronic
1148583140 17:48757434-48757456 ACCGTGGGCTCTGGCTGGTGTGG - Intergenic
1149676886 17:58472792-58472814 CCTGGGGGCTCTGGGGAGTGGGG - Intronic
1151765645 17:76132044-76132066 CCTGGGGGCTGTGGGCGGGGTGG + Intergenic
1152245431 17:79182716-79182738 CCCAGGAGCTCTGGCCGGGGAGG - Intronic
1152414227 17:80148338-80148360 CCCAGGTGCTCTGGAGGCTGAGG - Intergenic
1154173801 18:12068513-12068535 GCCCGGGGCTCTGGGCTGTGAGG - Intergenic
1154519599 18:15212793-15212815 CCATGGGGCTCTGGTCAGTGGGG + Intergenic
1155047870 18:22119038-22119060 CCCAGCTGCTCTGGAGGGTGAGG - Intergenic
1156351887 18:36309093-36309115 CCTGGGGGCTCTCGTGGGTGGGG + Intronic
1157310369 18:46548127-46548149 CCTGGGATCTCTGGACGCTGTGG + Intronic
1157606723 18:48930501-48930523 CCTGGAGGCTCTGAAAGGTGGGG - Intronic
1160029075 18:75243020-75243042 CCCGGGGGATGGGGCCGGTGAGG + Intronic
1160501754 18:79404825-79404847 CCCTGGGGCTCAGCACGGCGGGG + Intronic
1160587985 18:79923200-79923222 CAGGGGGGCTGTGGACGGTGAGG + Intronic
1160996702 19:1885351-1885373 CCCGGGGGCGCGGGCCGGGGTGG - Exonic
1161303022 19:3552047-3552069 CCCGGGTGCTCCGAAGGGTGAGG - Intronic
1161737887 19:6002688-6002710 CCCGGGCCCTGGGGACGGTGTGG + Intronic
1163152218 19:15422357-15422379 CTCTGGGGCCCTGGAGGGTGGGG - Exonic
1163631372 19:18419535-18419557 GCCTGGGGCTCGGGGCGGTGAGG + Exonic
1164645951 19:29858884-29858906 CCCGGGAGCTCAGGAGGGTGGGG - Intergenic
1165452217 19:35890282-35890304 CCTGGGGGCTGTGGACGTGGAGG - Intronic
1167410231 19:49339872-49339894 CCCTGGGGCTCTGGCCGCTGTGG + Intronic
1167552235 19:50169196-50169218 CCCTGGGCCTCGGGAGGGTGTGG - Intergenic
1167695467 19:51013205-51013227 CCTGTGGGCTCTGCAGGGTGGGG + Exonic
1168353245 19:55688090-55688112 CCCTGGGGCTTTGGAGGCTGGGG + Intronic
1168630886 19:57955208-57955230 CCCGGGGGCACAGGACAGAGCGG - Intergenic
1168688435 19:58362524-58362546 CCGGGCCGCTCTGGACGGCGCGG + Intronic
925103411 2:1268916-1268938 CCCTGGGGCACTAGAGGGTGTGG - Intronic
925194916 2:1915006-1915028 GGCCGGGGCTCTGCACGGTGGGG - Intronic
925853797 2:8110138-8110160 TCTGGGGGCTCAGGAGGGTGAGG + Intergenic
926119962 2:10236422-10236444 TCCTGGGGCTCTGCATGGTGAGG - Intergenic
930093319 2:47547552-47547574 CTAGGGGGCTCTGGAAGCTGAGG - Intronic
932058020 2:68466961-68466983 CCCGCGGGATTTGGACGGAGTGG - Intronic
934299240 2:91767297-91767319 CCTCGGCTCTCTGGACGGTGAGG - Intergenic
934561834 2:95317513-95317535 CCCCGGGGCTCTGGGCTGAGGGG + Intronic
935680931 2:105636353-105636375 ACGGGGAGCTCTGGACAGTGAGG - Intergenic
938319919 2:130355912-130355934 CCCGGGCGCTCGGGCCGCTGTGG - Intergenic
938519582 2:132053421-132053443 CCACGGGGCTCTGGTCAGTGGGG + Intergenic
938863272 2:135392196-135392218 CCCAGTGGCTCAGGAGGGTGAGG + Intronic
940011748 2:149061611-149061633 CCCCGGGGCTTTGGAGGATGGGG + Intronic
942065944 2:172271596-172271618 CCCAGGTACTCTGGACGCTGAGG - Intergenic
946053990 2:216885355-216885377 CCCGCGGGCCCTGGGCAGTGAGG + Intergenic
947593731 2:231398571-231398593 CCCGGGGGCCCTGTACGGCAAGG + Exonic
948097444 2:235347547-235347569 CCCGTGGGCTCTGGGGGCTGAGG - Intergenic
948461665 2:238132665-238132687 CTCGGGGGCTCTGGGTGCTGCGG + Exonic
948485291 2:238276932-238276954 CCCGGGGGCTCTGGACGGTGAGG + Intronic
948586992 2:239025839-239025861 CCCGGGGGCTCTGCACCAAGTGG + Intergenic
1169637183 20:7705500-7705522 CCTGGCGGCTCTGGAGGTTGAGG - Intergenic
1171426124 20:25049836-25049858 CCGGGGGACTTTGGAGGGTGGGG - Intronic
1172169082 20:32917996-32918018 CAGGGGGGCTCTGGTAGGTGGGG + Intronic
1172271574 20:33658342-33658364 CTCGGGGGCTCGGGCAGGTGGGG + Intronic
1174064735 20:47856222-47856244 ACCGGGGGCTCTGGAGGGCTTGG + Intergenic
1174113304 20:48210865-48210887 CCTGGGAGCTCTGGTCTGTGTGG + Intergenic
1174223362 20:48975683-48975705 CCCAGGTGCTCTGGAGGCTGAGG + Intronic
1174468020 20:50731955-50731977 GCCCCGGGGTCTGGACGGTGCGG + Intronic
1176232149 20:64038149-64038171 CCCGGGAGCTCGGGACGGCGGGG + Intronic
1176777405 21:13150943-13150965 CCACGGGGCTCTGGTCAGTGGGG - Intergenic
1179907890 21:44433710-44433732 CCGGGGGGCCTTGCACGGTGGGG - Intronic
1180464981 22:15603159-15603181 CCAGGGGCCTCTGGAGGGGGCGG + Intergenic
1180525019 22:16250408-16250430 CCACGGGGCTCTGGTCAGTGGGG - Intergenic
1180840656 22:18957440-18957462 CCCAGGGCCTGTGGAGGGTGGGG + Intergenic
1180967450 22:19798049-19798071 GCCGGGTGCTCTGGACACTGAGG - Intronic
1181060832 22:20281334-20281356 CCCAGGGCCTGTGGAGGGTGGGG - Intronic
1181121670 22:20671203-20671225 CCCGGGGGCGCGGGCCGGGGTGG - Intergenic
1181426868 22:22849314-22849336 CCCATGAGCTCTGGAGGGTGGGG - Intronic
1183073726 22:35413525-35413547 CCTGTGGGCTGTGCACGGTGCGG - Intronic
1183538955 22:38418703-38418725 GCCGGGGGCGCTGAGCGGTGCGG - Intergenic
1183671194 22:39273963-39273985 CCTGGGGGCTCTGGAGGGTCCGG - Intergenic
1183742961 22:39678592-39678614 ACTGGGGGCTCTGCAGGGTGGGG - Intronic
1183784639 22:40022341-40022363 AACGGGGGCTCTGCACAGTGGGG + Intronic
1184036564 22:41920814-41920836 CCCCAGGGCCCTGGCCGGTGGGG - Intergenic
1184502639 22:44883097-44883119 CCTGGGGGTGCTGGACGGTGGGG + Exonic
1184787488 22:46678895-46678917 CCCCGTGGCTCTGGACTGCGCGG + Exonic
1185065404 22:48629434-48629456 CCAGGGAGCTGTGGACTGTGGGG - Intronic
1185315115 22:50175639-50175661 CCTGGGGACTCTGGAGGGTTTGG - Intronic
950208309 3:11096860-11096882 CCCGGGGGCTGGGGACGGTTGGG + Intergenic
950440553 3:13007859-13007881 GCTGGGGGCTCTGGACTCTGGGG - Intronic
950446698 3:13042773-13042795 CCCTGGGGCTCCGGGTGGTGGGG + Intronic
950472856 3:13197332-13197354 GCCAGGGGCGCTGGAGGGTGGGG + Intergenic
950538311 3:13594631-13594653 TCCGTGGGCTCTGGAGGGAGGGG + Intronic
953330645 3:42050339-42050361 CCCGGGCGTTCAGGAAGGTGAGG + Intronic
953914348 3:46909075-46909097 CCCAGGGGCTCTGGCAGCTGTGG - Intergenic
954452605 3:50579853-50579875 CCCCGCGGCCCTGGATGGTGGGG + Exonic
954672946 3:52300221-52300243 CCCGGGGGCTGTGCCTGGTGGGG - Intergenic
957651580 3:83013120-83013142 CCTGGGGGCTGTGGACTCTGGGG - Intergenic
961789705 3:129366639-129366661 CCCCGGGGCACTCCACGGTGGGG + Intergenic
961831871 3:129627123-129627145 CCGGGGGGCTCGGGAAGCTGGGG - Intergenic
962254373 3:133860395-133860417 CCCGGAGGCACTGGAAGCTGGGG + Intronic
968512278 4:1001005-1001027 CCCTGGGGCCCTGGCCGGGGCGG + Intronic
968512833 4:1002977-1002999 CGCTGGGGCTCTGGAGGGGGCGG + Intronic
968704965 4:2073453-2073475 CCTGGTGGCTCTGGCTGGTGGGG - Intronic
969455541 4:7297849-7297871 GCTGGGCCCTCTGGACGGTGGGG - Intronic
982129184 4:152212106-152212128 GCAGGGAGCTCTTGACGGTGTGG - Intergenic
984434154 4:179686563-179686585 CCCAGTGGGTCTGGAAGGTGAGG + Intergenic
985496968 5:214169-214191 GCCGGGGGCTATGGAGGGAGGGG + Intronic
985625276 5:982395-982417 GCCGGGGGCTCTGGACTGGTAGG - Intergenic
985846661 5:2354509-2354531 CCAGGGGGCTCTGTAGGGTATGG - Intergenic
987231384 5:15897016-15897038 CCCAGCTGCTCTGGAGGGTGAGG + Intronic
988296863 5:29375761-29375783 CCCGGCTGCTCTGGAGGCTGAGG - Intergenic
989571950 5:42953372-42953394 CCTGAGAGCTCTGGACGGGGAGG - Intergenic
991587511 5:68215654-68215676 GCCGCGGGCTCTGGTTGGTGTGG + Intergenic
993104302 5:83581277-83581299 ACCTAGGGCTCTGGAGGGTGGGG + Exonic
997560990 5:134846104-134846126 CCCGCCGCCTCTGCACGGTGCGG - Exonic
1003302189 6:4893575-4893597 CCCGGCTGCTCAGGAGGGTGAGG + Intronic
1003331688 6:5134975-5134997 TCCCGGGGCTGTGGAGGGTGCGG + Intronic
1003331697 6:5135003-5135025 TCCCGGGGCTGTGGAGGGTGCGG + Intronic
1003331706 6:5135031-5135053 TCCCGGGGCTGTGGAGGGTGCGG + Intronic
1003331739 6:5135143-5135165 TCCCGGGGCTGTGGAGGGTGCGG + Intronic
1003331748 6:5135171-5135193 TCCCGGGGCTGTGGAGGGTGCGG + Intronic
1003331757 6:5135199-5135221 TCCCGGGGCTGTGGAGGGTGCGG + Intronic
1003331766 6:5135227-5135249 TCCCGGGGCTGTGGAGGGTGCGG + Intronic
1003331783 6:5135283-5135305 TCCTGGGGCTGTGGAGGGTGCGG + Intronic
1003331807 6:5135367-5135389 TCCCGGGGCTGTGGAGGGTGCGG + Intronic
1003331816 6:5135395-5135417 TCCCGGGGCTGTGGAGGGTGCGG + Intronic
1003331825 6:5135423-5135445 TCCCGGGGCTGTGGAGGGTGCGG + Intronic
1003331842 6:5135479-5135501 TCCTGGGGCTGTGGAGGGTGCGG + Intronic
1003331858 6:5135535-5135557 TCCTGGGGCTGTGGAGGGTGCGG + Intronic
1004251178 6:14024352-14024374 CCCTGGGGCTGTACACGGTGGGG + Intergenic
1004924126 6:20402640-20402662 CGCCGGGGCTGGGGACGGTGGGG - Intronic
1006012170 6:31052018-31052040 CCCGGGTGCTCGGGAGGCTGAGG + Intergenic
1006151330 6:31991781-31991803 CCCGGGGCCTCCTGAAGGTGGGG - Exonic
1006157631 6:32024519-32024541 CCCGGGGCCTCCTGAAGGTGGGG - Exonic
1006371517 6:33647134-33647156 CCCAGCTGCTCTGGAAGGTGAGG - Intronic
1006725549 6:36196931-36196953 CCCAGGGGCCCCGAACGGTGGGG + Exonic
1007626841 6:43251550-43251572 CCCGGGGGTCCTGGAGGGTGAGG - Intronic
1008545256 6:52577502-52577524 CCCGGGGGCTGAGGGCGGCGCGG + Intergenic
1009598772 6:65771460-65771482 CCCGGGGGCTCTGGGGGAAGAGG + Intergenic
1010253689 6:73734235-73734257 CCTGGGGGATCTGGAGGGTTGGG - Intronic
1010414822 6:75601632-75601654 CCATGGGGCCCTGGGCGGTGGGG + Intronic
1011603644 6:89081512-89081534 CCCGGGGGGTCGGGCGGGTGGGG + Intronic
1012900426 6:104999253-104999275 CCCAGCTGCTCTGGAGGGTGAGG - Intronic
1015355121 6:132268849-132268871 CCCAGGTGCTCTGGAGGCTGAGG + Intergenic
1015938266 6:138424260-138424282 CCGCGGGGCTCTGGGCGCTGCGG - Exonic
1017482513 6:154871649-154871671 CCCAGGTACTCTGGACGCTGAGG + Intronic
1017748868 6:157471430-157471452 CTCGGGGGTTCTGGATGGGGAGG - Intronic
1017984935 6:159435635-159435657 CATGTGGGCTCTGGACTGTGTGG - Intergenic
1019373102 7:673864-673886 CCCGGGGCCTCTGGAGGGCGTGG - Intronic
1019429165 7:990850-990872 CTCTGGAGCTCTGGAGGGTGCGG + Intergenic
1019514002 7:1431860-1431882 CCCGGAGTCTCTGGCAGGTGTGG + Intronic
1019638288 7:2088564-2088586 CCGGGGAGATCAGGACGGTGTGG + Intronic
1023221129 7:37920960-37920982 CCAGGGCGCCCGGGACGGTGCGG - Exonic
1023560414 7:41467841-41467863 CCCAGGGGCTCTGCAGGGTGGGG - Intergenic
1024018254 7:45338828-45338850 ACCGGGGGCTGTGGGCGGCGGGG + Intergenic
1024256966 7:47546473-47546495 CCAGGTGGCCCAGGACGGTGAGG + Intronic
1024520862 7:50303785-50303807 CCCGGGGCCGCTGGTCGGTCGGG - Intergenic
1025837478 7:65108588-65108610 CCACGGGGCTCTAGTCGGTGGGG - Intergenic
1025885594 7:65587410-65587432 CCACGGGGCTCTAGTCGGTGGGG + Intergenic
1026004038 7:66586829-66586851 CCCGGCTGCTCTGGAGGCTGAGG - Intergenic
1029305582 7:99617197-99617219 CCCTGCGGGTCTGGACGCTGAGG + Intronic
1030030478 7:105364800-105364822 CCCTGGGGTTCTGGATGGTCAGG + Intronic
1032269065 7:130387445-130387467 CCCTGGGGCTCTGGTCTGTGAGG - Intronic
1034129256 7:148699737-148699759 CCGGGGGGCTCTGTCCGGTTCGG - Intronic
1034433271 7:151051352-151051374 GCCGGGGGCTCCCGACGGGGCGG + Intronic
1035012263 7:155729619-155729641 CCCGGGTTCTCTGGAGGCTGAGG + Intronic
1035223280 7:157419175-157419197 CAGGGGGGCTGTGGACGGTGTGG + Intergenic
1035290522 7:157835135-157835157 CTAGGGGGCTCAGGACGCTGTGG - Intronic
1035485300 7:159218811-159218833 CCGTGGGGCTCTGTTCGGTGGGG - Intergenic
1035568375 8:656813-656835 CCCGGGGGCTCTTCAGAGTGAGG - Intronic
1036971691 8:13362409-13362431 CCCGGGCACTCTGTATGGTGGGG + Intronic
1038056399 8:23862222-23862244 CCTGAGGGCTGTGGAAGGTGGGG + Intergenic
1039446284 8:37635795-37635817 CCCGAGGTCTCTGGAGAGTGAGG - Intergenic
1042689781 8:71484872-71484894 CCCGGGGGACCTGGAGGGTAGGG + Intronic
1044038345 8:87334837-87334859 CCCAGCGGCTCTGGAGGCTGAGG - Intronic
1049721124 8:144116042-144116064 CCCGGGGGCTGGGGTGGGTGGGG - Intronic
1049785976 8:144451060-144451082 ACCCGGGGCTCGGGGCGGTGAGG - Intronic
1049989319 9:976934-976956 CCAGGGAGCGCTGGACGGCGGGG - Intergenic
1050941072 9:11458585-11458607 CCTCAGGGCTCTAGACGGTGGGG + Intergenic
1055958897 9:81800760-81800782 CCCAGCTGCTCTGGAGGGTGAGG + Intergenic
1057269616 9:93643458-93643480 CCAGGGGGGACTAGACGGTGAGG - Intronic
1060403300 9:123360726-123360748 CCCTTGGGCTGTGGACTGTGAGG + Intronic
1061851458 9:133418284-133418306 GCTGGGGGCACTGGGCGGTGGGG + Intronic
1061995803 9:134182196-134182218 CCCGGGTACTCTGGAGGCTGAGG + Intergenic
1189479615 X:41382561-41382583 CCCAGCTGCTCTGGACGCTGAGG + Intergenic
1190049701 X:47140579-47140601 GCCTGGGGCTTTGGAGGGTGTGG - Intergenic
1191062181 X:56310426-56310448 CCAGGGGGCTCTGCTTGGTGAGG + Intergenic
1196124306 X:112082890-112082912 CCCGGGGGCTGGGGGAGGTGAGG - Intergenic
1196425133 X:115561793-115561815 CCCTGGGGCTCTGGAGAGGGGGG + Intronic
1199973767 X:152879475-152879497 CCCTGGGGCCCTGGACGCAGAGG - Intergenic