ID: 948485351

View in Genome Browser
Species Human (GRCh38)
Location 2:238277484-238277506
Sequence GACAGGTACTGGGTAGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948485351_948485359 22 Left 948485351 2:238277484-238277506 CCTTACACTACCCAGTACCTGTC 0: 1
1: 0
2: 1
3: 12
4: 113
Right 948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG 0: 1
1: 0
2: 0
3: 4
4: 26
948485351_948485360 26 Left 948485351 2:238277484-238277506 CCTTACACTACCCAGTACCTGTC 0: 1
1: 0
2: 1
3: 12
4: 113
Right 948485360 2:238277533-238277555 ACAGGGCCTCGTTATGAGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 104
948485351_948485355 -10 Left 948485351 2:238277484-238277506 CCTTACACTACCCAGTACCTGTC 0: 1
1: 0
2: 1
3: 12
4: 113
Right 948485355 2:238277497-238277519 AGTACCTGTCTGTTGGCAACTGG 0: 1
1: 0
2: 1
3: 9
4: 109
948485351_948485357 8 Left 948485351 2:238277484-238277506 CCTTACACTACCCAGTACCTGTC 0: 1
1: 0
2: 1
3: 12
4: 113
Right 948485357 2:238277515-238277537 ACTGGATCTGCGAACTCGACAGG 0: 1
1: 0
2: 0
3: 1
4: 20
948485351_948485358 9 Left 948485351 2:238277484-238277506 CCTTACACTACCCAGTACCTGTC 0: 1
1: 0
2: 1
3: 12
4: 113
Right 948485358 2:238277516-238277538 CTGGATCTGCGAACTCGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948485351 Original CRISPR GACAGGTACTGGGTAGTGTA AGG (reversed) Intronic
904510584 1:31003188-31003210 GAGTGGTACTTGGTAGTGTATGG - Intronic
905585552 1:39114748-39114770 GACAGTTACTGTCTATTGTAGGG + Intronic
906611702 1:47208475-47208497 GACAGGGACTGGGGAGGGAAGGG - Intergenic
910474508 1:87592205-87592227 TCCTGGTACTGGGTAGTGTAGGG - Intergenic
911097712 1:94068731-94068753 GACAAGAACTGGCTATTGTAAGG + Intronic
911757605 1:101577348-101577370 GACAGTTTCTGTGTAGTGTGAGG + Intergenic
913193051 1:116429822-116429844 GACAGCTGCTGGTGAGTGTAAGG - Intergenic
914764931 1:150629476-150629498 GACCGGGACTGTGGAGTGTAAGG + Exonic
915030036 1:152871213-152871235 GGCAGGTAGTGGGGAGTGTGTGG - Intergenic
921269582 1:213455465-213455487 GACAGGTACTGAGTTCTGTCTGG + Intergenic
923696073 1:236253816-236253838 GTCAGGCACTGGGTAGGCTATGG + Intronic
924588662 1:245382210-245382232 AAAAGGTACTGGGGAGGGTATGG - Intronic
1064334854 10:14430044-14430066 TGCAGGTATTGGGTAGGGTAGGG + Intronic
1064694047 10:17948088-17948110 GACAGGTACTTGGAAGTATCAGG + Intergenic
1067202078 10:44181810-44181832 GGCAGATACTGGGTAGAGTTTGG - Intergenic
1070151469 10:73807895-73807917 GACCGGTACTGCGTGGAGTATGG - Exonic
1070339092 10:75480402-75480424 AACAGGTACTGGGTAGTCACTGG + Intronic
1084470302 11:69355560-69355582 GCCAGGTCCTGGGTTGGGTATGG + Intronic
1085199357 11:74692276-74692298 GACAGAGACTGGGAAGGGTATGG + Intergenic
1087151398 11:94863184-94863206 TACAGGGACTGGGTAGGGCACGG - Intronic
1089859716 11:121577989-121578011 GATAGGCAGTGGGTAGTGCAAGG + Intronic
1091763893 12:3105658-3105680 GACAGCTACTAGGTAGGGCAGGG - Intronic
1094442473 12:30493904-30493926 GAAGGGTAGTGGGTAGGGTAGGG - Intergenic
1095363026 12:41367122-41367144 TACAGGTACTAGGGAATGTAAGG - Intronic
1098547902 12:71731624-71731646 GGAAAGTTCTGGGTAGTGTAGGG + Intergenic
1101713305 12:107288549-107288571 CCCAGGTACTGGGGAGTTTAAGG + Intergenic
1104998536 12:132674208-132674230 GACAGGTTCCGGGTAGAGTGTGG - Intronic
1104998606 12:132674512-132674534 GACAGGGAATGGGTAGAGAAGGG - Intronic
1108327702 13:49350322-49350344 GAAAGGAACTAGGTAGTGAAGGG - Intronic
1109735855 13:66483705-66483727 GACAAGTGCTGGGTAGAGGAGGG + Intronic
1109834641 13:67841052-67841074 GACAGCTCTTGGGTAGAGTAAGG + Intergenic
1112309063 13:98301791-98301813 TACACGTACTCGGTGGTGTATGG + Intronic
1112607446 13:100920916-100920938 GCCAGGTACTGGGTGGGGGATGG + Intergenic
1113553126 13:111208742-111208764 AGCAGGTCCTGGGAAGTGTAGGG + Intronic
1117056437 14:51916744-51916766 GTCAGGTAGTGGATAGTGTGAGG + Intronic
1117581844 14:57159054-57159076 GAGAGGCACAGGGTAGTGTCTGG - Intergenic
1117940119 14:60954540-60954562 GACAGCTCCTTGTTAGTGTATGG + Intronic
1120299935 14:82693061-82693083 GACCGGGACTGTGGAGTGTAAGG + Intergenic
1120314163 14:82870894-82870916 GACAGGTACTGTGTAGGTGAGGG - Intergenic
1120546470 14:85818345-85818367 GACAGGCACTGTGTATGGTATGG - Intergenic
1121339870 14:93098958-93098980 GACAGGCCCTGGTTAGAGTATGG - Intronic
1126137352 15:45404250-45404272 CACAGGTACTAGATAGTGCAAGG - Intronic
1133988041 16:10683354-10683376 GACAGGAATTGGGTAGGGTTGGG + Intronic
1134862780 16:17575506-17575528 AACAGGTACAGGGTGGGGTAGGG - Intergenic
1135059619 16:19259993-19260015 AACAGGGACTGGGGAGTGTGTGG + Intronic
1135060226 16:19265130-19265152 GACACTTAGTGGGCAGTGTAAGG - Intronic
1136584406 16:31174718-31174740 GACAGGCACTGGGTAGTTGTAGG - Intergenic
1138960658 16:62024914-62024936 GTCAGGTACTGGGGAGAGAAAGG + Intronic
1144967510 17:19087338-19087360 GGCAGGTCCTGGGGAGTGTAGGG + Intergenic
1144980409 17:19164727-19164749 GGCAGGTCCTGGGGAGTGTAGGG - Intergenic
1144987813 17:19213505-19213527 GGCAGGTCCTGGGGAGTGTAGGG + Intergenic
1146470604 17:33121359-33121381 GACAGGTACTGGGTGGTGCCAGG + Intronic
1148644919 17:49214292-49214314 GAAAGGTACAGGCTAGAGTATGG + Intronic
1148778699 17:50109942-50109964 GACAGGGCCTGGGGAGTGTCAGG - Exonic
1149488407 17:57063748-57063770 GACAGGTTCAGGGTAGTTCAGGG + Intergenic
1156445405 18:37233152-37233174 GACAGGCACTGAGTGGTGAAGGG - Intergenic
1157762512 18:50275073-50275095 GGCAGGTACTGGGTAAGGTCAGG + Intronic
1159529772 18:69640611-69640633 GACAGGGACTGAGAAGAGTAAGG + Intronic
1164155917 19:22596972-22596994 GGCAGGAACTGGGTACTGTGTGG - Intergenic
1166509263 19:43393394-43393416 GACAGGGACTGGATTGTGCATGG - Intergenic
931620948 2:64208731-64208753 GACAGGTACTGCGCAGGGTTGGG - Intergenic
932330617 2:70896562-70896584 GAAAGGTACTGGGTAGTGTCTGG + Intergenic
941610671 2:167657702-167657724 GATAGGTACTGTGGTGTGTAAGG + Intergenic
943304423 2:186241986-186242008 GAAAGGTGCTATGTAGTGTAGGG - Intergenic
945255329 2:207798460-207798482 GACAGGGACTGGGTAAAATAAGG + Intergenic
947817955 2:233050696-233050718 GACTGGTACTGGGTACTTTAGGG + Intergenic
948485351 2:238277484-238277506 GACAGGTACTGGGTAGTGTAAGG - Intronic
1169617415 20:7464521-7464543 GAAAGGTAGTGGGAGGTGTAAGG - Intergenic
1170199832 20:13731011-13731033 GGCCGGTACTGAGTACTGTAGGG + Intronic
1173435665 20:43030172-43030194 GACAGGTACTGGATTGGGCAGGG + Intronic
1173606913 20:44337969-44337991 GACAGGTACTGGGGAATCTCAGG + Intronic
1174074096 20:47919868-47919890 GACAGGTGGTGGGAAGTGGATGG + Intergenic
1180132207 21:45834055-45834077 GACATGTCCTGGGTAGGGAAGGG + Intronic
1181941715 22:26483259-26483281 GAGAGGACCTCGGTAGTGTAGGG - Intronic
1184333034 22:43838035-43838057 GACAGAAAGTGGGCAGTGTAGGG - Intronic
1184493846 22:44825971-44825993 GACCGGCAGTGGGTAGTGGATGG + Intronic
1184879954 22:47298352-47298374 GACAGGGAGTGGAGAGTGTAAGG + Intergenic
1184885521 22:47342805-47342827 GACAGGGATTGGGTAGGGCAAGG - Intergenic
1184885661 22:47343327-47343349 GGCAGGGACTGGGTAGGGCAGGG - Intergenic
1184885757 22:47343669-47343691 GGCAGGGACTGGGTTGGGTAGGG - Intergenic
949317283 3:2770766-2770788 GACAGGCAATGCTTAGTGTATGG + Intronic
950772323 3:15322462-15322484 GACAGGTTCTGGGGAGGGAAAGG + Intronic
956348534 3:68308389-68308411 GACAGGTAACAGGTAGTATAGGG - Intronic
956893825 3:73639570-73639592 GGCAGGGACTGGGTAATGTAGGG - Intergenic
963570774 3:146992651-146992673 GCCAGGGGCTGGGTAGTGTAGGG - Intergenic
966690905 3:182740452-182740474 GAGAGGAGCAGGGTAGTGTACGG - Intergenic
967277478 3:187790692-187790714 GACAGGTAGTGGGGAGGGCAGGG - Intergenic
973762648 4:54133693-54133715 GACAGGTACTAATTGGTGTAAGG + Intronic
976501309 4:85793128-85793150 TACAGGTAGAGGGTAGTGAATGG - Intronic
980518077 4:133891149-133891171 GGCAGGGAGTGGGTAGAGTAGGG - Intergenic
982990589 4:162268917-162268939 AACAGGTGCTGGCGAGTGTATGG + Intergenic
984397426 4:179219680-179219702 GACAAATACAGGGTAATGTAAGG - Intergenic
985527625 5:415199-415221 CAGAGGTGCTGGGTAGTGCAGGG - Intronic
998167944 5:139855228-139855250 GGCAGGTACTAGGTAGTGTTGGG - Intronic
998554757 5:143112371-143112393 TACAGGGACTGGGTAGAGGAGGG + Intronic
999854662 5:155580837-155580859 GACAGGGTCTGGGAAGTGAATGG + Intergenic
1004960903 6:20786837-20786859 GACGGGTAGGAGGTAGTGTAGGG + Intronic
1005426725 6:25710489-25710511 GAGAAGTACTGGGTAGAGGAGGG - Intergenic
1005437490 6:25830658-25830680 GAGGAGTACTGGGTAGTGTTTGG - Intronic
1013875625 6:114823543-114823565 TACAGCTTCTGGCTAGTGTAAGG + Intergenic
1016273772 6:142323712-142323734 AACAGGTACTGAATACTGTAGGG + Intronic
1020429690 7:8106319-8106341 GACTGGTTCTGGGTACTGGAGGG + Intergenic
1021412130 7:20340742-20340764 TACAGGTACTAGGTAGGGAAGGG + Intronic
1022950685 7:35335193-35335215 GACAGGGGCAGGGTAGGGTAGGG - Intergenic
1023130345 7:36996818-36996840 GACAGATACTGGGAAGTGCAAGG + Intronic
1029485171 7:100835969-100835991 GAAAGGTACAGGGTAGTGGGAGG + Intronic
1030059463 7:105611262-105611284 GACAGGGACTGGTTAGTGCCTGG - Intronic
1032120382 7:129150837-129150859 GACAGGGACTGGCTAGGGAAGGG + Intronic
1033619335 7:143048428-143048450 GACAGGTCCTGGGCAGAGCAGGG - Intergenic
1038324301 8:26560987-26561009 GGCAGCAACTGTGTAGTGTAAGG - Intronic
1041540084 8:58974244-58974266 TACAGGGTCTGGGCAGTGTAGGG - Intronic
1049632336 8:143665523-143665545 GACAGGGACAAGGGAGTGTATGG + Intergenic
1050306184 9:4308209-4308231 GACAGGCACTGTGAAGTGAAAGG + Intronic
1050632208 9:7572041-7572063 AATAGGTAATGGGTAGTGTCAGG - Intergenic
1051983677 9:23056642-23056664 GACAGATACTGGCAAGCGTATGG + Intergenic
1053462292 9:38280348-38280370 GGCAGGTACTGGATCGTATAAGG + Intergenic
1059288068 9:113194533-113194555 AACAGGTAATGGCTTGTGTAAGG - Intronic
1059944617 9:119396748-119396770 GACAGCTCCTGGCTAGTCTATGG + Intergenic
1060448785 9:123717460-123717482 CACAGTTACTGGGTAGAGTAAGG + Intronic
1060893556 9:127203491-127203513 TACAGGTAGTGGGAAGCGTAGGG + Intronic
1062722649 9:138052468-138052490 GACAGGTGCAGGGTGGTGGAGGG + Intronic
1187253473 X:17620913-17620935 GACAGGTAGAGGGTTGTTTATGG + Intronic
1188646618 X:32576492-32576514 GACAGGTACTGAGTAATGGGCGG + Intronic
1190177422 X:48162466-48162488 AAGAGGTACTTGGTAGTGAATGG - Intergenic
1194170747 X:90577276-90577298 GACAGATTCTGAGTAGTTTATGG - Intergenic
1200410354 Y:2854676-2854698 GACAGGATCTGGGTAGCGGATGG - Exonic
1200516987 Y:4155022-4155044 GACAGATTCTGAGTAGTTTATGG - Intergenic