ID: 948485354

View in Genome Browser
Species Human (GRCh38)
Location 2:238277495-238277517
Sequence AGTTGCCAACAGACAGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948485354_948485362 26 Left 948485354 2:238277495-238277517 CCAGTACCTGTCTGTTGGCAACT 0: 1
1: 0
2: 1
3: 15
4: 122
Right 948485362 2:238277544-238277566 TTATGAGGAAGGACAGACACTGG 0: 1
1: 0
2: 2
3: 20
4: 288
948485354_948485360 15 Left 948485354 2:238277495-238277517 CCAGTACCTGTCTGTTGGCAACT 0: 1
1: 0
2: 1
3: 15
4: 122
Right 948485360 2:238277533-238277555 ACAGGGCCTCGTTATGAGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 104
948485354_948485358 -2 Left 948485354 2:238277495-238277517 CCAGTACCTGTCTGTTGGCAACT 0: 1
1: 0
2: 1
3: 15
4: 122
Right 948485358 2:238277516-238277538 CTGGATCTGCGAACTCGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 25
948485354_948485359 11 Left 948485354 2:238277495-238277517 CCAGTACCTGTCTGTTGGCAACT 0: 1
1: 0
2: 1
3: 15
4: 122
Right 948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG 0: 1
1: 0
2: 0
3: 4
4: 26
948485354_948485357 -3 Left 948485354 2:238277495-238277517 CCAGTACCTGTCTGTTGGCAACT 0: 1
1: 0
2: 1
3: 15
4: 122
Right 948485357 2:238277515-238277537 ACTGGATCTGCGAACTCGACAGG 0: 1
1: 0
2: 0
3: 1
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948485354 Original CRISPR AGTTGCCAACAGACAGGTAC TGG (reversed) Intronic
901958700 1:12807691-12807713 GGTTGCCTCCAGACAGGCACAGG - Intergenic
903874745 1:26465967-26465989 AGGTGCCAACAGAGTGGTAGAGG + Intronic
906680800 1:47724482-47724504 AGTTTCCAACAGACAGCAAGGGG + Intergenic
913261863 1:117005733-117005755 AGTTACAAACAGACATTTACAGG + Intronic
914860280 1:151380301-151380323 AGTAGGCAAGAAACAGGTACAGG + Intergenic
917135394 1:171784141-171784163 AGTGGCCAACAGCCAGGACCAGG + Exonic
918281179 1:183007755-183007777 AATTCTCAACAGACAGATACTGG + Intergenic
919576992 1:199322615-199322637 AGTTGCCAACAGTGGGGTAAAGG - Intergenic
923571493 1:235118843-235118865 AATTGCCAACAGACTGGGAAGGG - Intronic
1063149843 10:3326379-3326401 AGTTGCCCAGGGACAGGGACTGG - Intergenic
1063874883 10:10464275-10464297 TGTTGCTAATAGACAGTTACCGG - Intergenic
1066503229 10:36015079-36015101 TGTCGCCAACAGACAGGTGAGGG + Intergenic
1067176935 10:43956739-43956761 AGTCGCAGACAGACAGGAACGGG - Intergenic
1069569087 10:69483702-69483724 AGATGCCCACAGACAGGACCAGG - Exonic
1070955896 10:80463228-80463250 AGCTGCCTGCAGACAGCTACGGG + Intronic
1071982966 10:91022387-91022409 AGTGACCTTCAGACAGGTACAGG + Intergenic
1075251462 10:120879422-120879444 ATTTGCCAGCAGAATGGTACTGG + Intronic
1077107749 11:849390-849412 AGTTGCCACCAGACAGCAACGGG + Intronic
1077111104 11:862630-862652 AGTTGGCAGCCGACAGGGACGGG - Exonic
1077992794 11:7426744-7426766 TGTTTCCACCAGACAGGTAGAGG - Intronic
1083753466 11:64776668-64776690 AGTTATCAACAGACAGCTAAGGG + Intronic
1084995550 11:72974048-72974070 AGTTGATAACAGACAGGTAAGGG + Intronic
1085008124 11:73114054-73114076 AGATGCCAGTAGCCAGGTACTGG + Intronic
1086401449 11:86464169-86464191 AGTTGGCAAGAGACAGGTGTTGG - Intronic
1087186154 11:95198106-95198128 AGTTGGTAAAAGACAGTTACAGG - Intronic
1089887740 11:121844714-121844736 AGTAGCTAACAGACATGAACTGG - Intergenic
1093111267 12:15155262-15155284 ATTTTCCAACAGGCAGGTTCTGG - Intronic
1094081039 12:26536291-26536313 TGTTGCCAACAGATGGGAACAGG - Intronic
1095861297 12:46920930-46920952 AATTGCCAACAGAGAGGGACAGG + Intergenic
1097560055 12:61191996-61192018 AGTTGCCAATAGCTAGGAACTGG + Intergenic
1098594057 12:72250597-72250619 AGTTGCAAACAGACTCTTACTGG + Intronic
1099617851 12:84961511-84961533 ACATGCAAACAGACAGGTAAGGG - Intergenic
1109323904 13:60844645-60844667 AGATGGCAACATTCAGGTACAGG - Intergenic
1110160949 13:72378142-72378164 AGTTGCCAGCACTCAGCTACTGG + Intergenic
1117518606 14:56527869-56527891 AGTAGCCATGAGACAGGTTCTGG + Intronic
1118124511 14:62886024-62886046 ATTTGCAAACAGACAGGTGTTGG - Intronic
1119481632 14:74961825-74961847 GGTGGGCAACAGACAGGTAGGGG - Intergenic
1119481661 14:74961975-74961997 GGTGGGCAACAGACAGGTAGGGG - Intergenic
1120182208 14:81355265-81355287 AGATGACAACATCCAGGTACAGG + Intronic
1121246018 14:92461275-92461297 AGCAGCCAACAAACAGCTACTGG + Intronic
1121596194 14:95164876-95164898 ATTTGCCAACTGATAGATACTGG - Intergenic
1121862638 14:97332968-97332990 ATGTGCCAACAGAAAGGCACTGG - Intergenic
1125596765 15:40892564-40892586 AGTTGCAATGAGACAGGTAAGGG - Intergenic
1129911318 15:79229213-79229235 AGACGCCAACATCCAGGTACAGG - Intergenic
1130141543 15:81230276-81230298 ATTTGCAAACAGACAGGGGCTGG - Intronic
1130365828 15:83237566-83237588 AGATGCCAACATATAGGTACAGG + Intergenic
1130943126 15:88528241-88528263 ATTTGCCAACAGGCAGCTCCAGG - Intronic
1135047055 16:19164660-19164682 AGGTGACAAGAGACAGGGACAGG - Intronic
1137296136 16:47095517-47095539 AGTTGCTAAAAGACAGCTAGGGG + Intronic
1138513493 16:57522439-57522461 AGCTGTGAACAGACAGGAACAGG - Intronic
1140586331 16:76296932-76296954 AGTTGCCAACGGAGAGCAACTGG - Intronic
1140714278 16:77707934-77707956 AGTTGCCAACAGGAGGCTACAGG + Intergenic
1140935217 16:79663960-79663982 AATTGACAACACACAGGTGCTGG + Intergenic
1142707721 17:1707245-1707267 AGTTGCCAAGAGACAGAACCTGG - Exonic
1146470600 17:33121348-33121370 GGTGGCCTGCAGACAGGTACTGG + Intronic
1148197869 17:45727727-45727749 TGTTGTCACAAGACAGGTACAGG - Intergenic
1153604257 18:6816019-6816041 TGCTGCCAACAGAGAGGTTCAGG + Intronic
1158066587 18:53417729-53417751 AGTTGACAACAAACATGTCCAGG + Intronic
927603735 2:24467260-24467282 AGCTGCCAATAGACAGGAAATGG - Intergenic
927638391 2:24832004-24832026 AGGGGCCAGCAGACAGGGACCGG + Intronic
931704785 2:64938197-64938219 AGTTGTCAACTGCCAGGTCCTGG - Intergenic
932310173 2:70733463-70733485 AGATGCCATCAGACAAGTGCAGG + Intronic
933064718 2:77779122-77779144 ATTTGCCAGCAGACAGGGAAAGG + Intergenic
933616028 2:84483305-84483327 AGTTGCCAAATGCCAGGGACTGG - Intergenic
936242751 2:110801840-110801862 AGTTGTCAACAAACCTGTACGGG - Intronic
937984936 2:127634187-127634209 GGTTGCCAACACACGGGTGCGGG + Exonic
940826643 2:158419990-158420012 AGTTGTCAGCAGAGAGGTGCTGG - Intronic
940848221 2:158663418-158663440 AGTTGCCAGCAGAGAGGTTCTGG - Exonic
941547208 2:166866514-166866536 AGTTGCAAACAGATACCTACAGG + Intergenic
942590907 2:177545971-177545993 AGCAGCCAGCACACAGGTACTGG - Intergenic
945384441 2:209180169-209180191 AGTTGCCAGCAGAGAGGTTCTGG - Intergenic
948332140 2:237178074-237178096 AGGTGCCAACAGTCAGTTCCTGG - Intergenic
948485354 2:238277495-238277517 AGTTGCCAACAGACAGGTACTGG - Intronic
1169293260 20:4370968-4370990 AGTTGCCTACAGTCTGGTTCTGG - Intergenic
1171352960 20:24518828-24518850 GGATGCCAACAGACAGAAACTGG - Intronic
1172765765 20:37349962-37349984 AGTTGCCAAGTGACAGGGCCAGG + Intronic
1175340299 20:58224887-58224909 AGTTGACAACAGACGTGTAAGGG + Intronic
1175998114 20:62820339-62820361 AGTGTCCAACAGGCAGGCACAGG - Intronic
1179924782 21:44528473-44528495 CGTTGCCAACACACAGATACAGG + Exonic
1181171690 22:21013645-21013667 ATTTGTCATCAGACAGGTAGAGG - Intronic
1183647736 22:39136205-39136227 GGGTGCCAACAGTCAGGTCCTGG + Intronic
953273481 3:41470099-41470121 AGATGCCAACATTCAGGTAGAGG + Intronic
954820301 3:53320783-53320805 ATTTGCCAAGAGTCAGGGACGGG - Intronic
955893451 3:63674750-63674772 AGATGCCAACAGAGAGATGCAGG - Intronic
957477722 3:80748543-80748565 AGTTGGCAAAAGACATGAACGGG - Intergenic
957515584 3:81246734-81246756 GGTAACCAACAAACAGGTACAGG - Intergenic
957594617 3:82246583-82246605 AGTTGCCTACAGACAGGGGTGGG - Intergenic
957598953 3:82307186-82307208 AGATGCCAACATACAGGTACAGG + Intergenic
960402322 3:117216761-117216783 AATAGCTAACATACAGGTACTGG - Intergenic
962032168 3:131612558-131612580 AGATGCCAAGAGAGAGGTACAGG - Intronic
962613837 3:137104426-137104448 AGTTGGCAAAAGTCAGGTACTGG + Intergenic
966452759 3:180080299-180080321 AGTTGACAACATACAAGAACAGG + Intergenic
968425067 4:517768-517790 AGGTGCCAGGAGACAGCTACAGG + Intronic
968630665 4:1649313-1649335 GGTTGGCCACAGACAGGTAGGGG - Intronic
968723243 4:2223269-2223291 AGCAGACTACAGACAGGTACTGG - Intronic
976399006 4:84586641-84586663 AGTTCCTAACAGGCCGGTACTGG + Intronic
977129522 4:93218162-93218184 AGTAGGCAACAGAAAGTTACAGG - Intronic
980577939 4:134709427-134709449 AGTTGGGAACAGACAGTTCCTGG - Intergenic
980831311 4:138132313-138132335 AGATGCCAACACCCAGGTACAGG - Intergenic
984368838 4:178834910-178834932 AGTTGGCCAAAGACAGGTATGGG + Intergenic
985706614 5:1405285-1405307 AGTTGCCAGCAGAGGGGTTCCGG - Intronic
986049481 5:4075455-4075477 AGATGCCAACATCCAGGTACAGG - Intergenic
986773336 5:10993089-10993111 GGTTGCCAACAGATAGGTCCTGG - Intronic
986805292 5:11303153-11303175 AGCTGCCAAATGCCAGGTACTGG - Intronic
988649810 5:33136743-33136765 AGATGCCAACATTCAGGTATAGG - Intergenic
993114502 5:83703816-83703838 AGAGGCCAACAGACAAGTTCAGG - Intronic
996608751 5:125354451-125354473 CGTTGCCAACAAATAGGTCCAGG - Intergenic
1001778040 5:174343909-174343931 AGTTCCCAACTGAGAGGCACAGG - Intergenic
1002464878 5:179402882-179402904 AGTTGCTAGAAGACAGGGACAGG + Intergenic
1002526774 5:179819601-179819623 TGTGGCCTACAGACAGGTGCTGG - Intronic
1002687171 5:181022125-181022147 AGATACCAACATTCAGGTACAGG + Intergenic
1004887907 6:20069411-20069433 AGGGGCCAACAGACAGGAAGAGG - Intergenic
1008181543 6:48336577-48336599 ATGTGCCAAGAGACAGGTAATGG + Intergenic
1013477903 6:110526364-110526386 AGTTTCCCACTGTCAGGTACAGG - Intergenic
1014658496 6:124136372-124136394 AGTTGCCAACAAAAAAGTCCAGG + Intronic
1016524421 6:144985457-144985479 AGATGCCAACACCCAGGCACAGG - Intergenic
1017036073 6:150268463-150268485 AGTTCCCTACAGACAGGCTCAGG - Intergenic
1018160879 6:161041286-161041308 AGTTACCCACAGACAGGTGCTGG - Intronic
1023163897 7:37324160-37324182 CTTGGCCAACAGACAGGAACAGG - Intronic
1031675540 7:124607353-124607375 ATTCACCAACAGACAAGTACAGG + Intergenic
1031764338 7:125758604-125758626 AGATGTCAACATACAGGTACAGG + Intergenic
1032120378 7:129150826-129150848 AGTGGCAAGCAGACAGGGACTGG + Intronic
1038490686 8:27968547-27968569 AGTTGCAACCAGACAGCTAGTGG - Intronic
1041369913 8:57148435-57148457 ATTTGCCATCAGCCAGGGACTGG - Intergenic
1042511737 8:69619611-69619633 ACTTCCCAACAGACACATACGGG - Intronic
1047795275 8:128248829-128248851 AGTTTCCAAGAGACAAATACTGG - Intergenic
1048104143 8:131389013-131389035 ATTTGGCCACAGACAGGCACAGG + Intergenic
1048651839 8:136486598-136486620 AGTGGCCAACACTCAGTTACAGG + Intergenic
1048984460 8:139727388-139727410 CTTTGCCTACACACAGGTACTGG + Intergenic
1050006716 9:1139731-1139753 AGATACCAACATTCAGGTACAGG - Intergenic
1055150590 9:72994284-72994306 AGTGGCCCACAGACAAGAACAGG + Intronic
1058477964 9:105359869-105359891 ATTTGCCAACAAATAGGTAATGG + Intronic
1186541397 X:10404706-10404728 AATTCCCAACAGACACATACAGG + Intergenic
1187880961 X:23847028-23847050 AGTGGCCAAAAGACATGAACAGG + Intronic
1189872171 X:45395385-45395407 AGATGCCAACATCCAGGTAGAGG - Intergenic
1193536637 X:82724781-82724803 AATTGCAAACTGACAGGCACTGG - Intergenic
1198192112 X:134317393-134317415 AGATGCCAACATACAAGTACAGG + Intergenic
1198557871 X:137814903-137814925 ATTTGCCAAAAGACATGTCCAGG + Intergenic
1199955941 X:152742484-152742506 TGTTGCCACCAGACAGGGTCTGG - Intergenic