ID: 948485356

View in Genome Browser
Species Human (GRCh38)
Location 2:238277501-238277523
Sequence AGATCCAGTTGCCAACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948485356_948485358 -8 Left 948485356 2:238277501-238277523 CCTGTCTGTTGGCAACTGGATCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 948485358 2:238277516-238277538 CTGGATCTGCGAACTCGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 25
948485356_948485359 5 Left 948485356 2:238277501-238277523 CCTGTCTGTTGGCAACTGGATCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG 0: 1
1: 0
2: 0
3: 4
4: 26
948485356_948485357 -9 Left 948485356 2:238277501-238277523 CCTGTCTGTTGGCAACTGGATCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 948485357 2:238277515-238277537 ACTGGATCTGCGAACTCGACAGG 0: 1
1: 0
2: 0
3: 1
4: 20
948485356_948485360 9 Left 948485356 2:238277501-238277523 CCTGTCTGTTGGCAACTGGATCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 948485360 2:238277533-238277555 ACAGGGCCTCGTTATGAGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 104
948485356_948485362 20 Left 948485356 2:238277501-238277523 CCTGTCTGTTGGCAACTGGATCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 948485362 2:238277544-238277566 TTATGAGGAAGGACAGACACTGG 0: 1
1: 0
2: 2
3: 20
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948485356 Original CRISPR AGATCCAGTTGCCAACAGAC AGG (reversed) Intronic
900230654 1:1555394-1555416 TGACCCAGATGCCAACAGCCTGG + Intronic
900844524 1:5086086-5086108 AGATCCAGGTGCCAGCTGAGAGG - Intergenic
902182068 1:14696909-14696931 AAATGCAGCTGCCAACAGGCGGG + Intronic
903787861 1:25873393-25873415 TGACCCAGTTGCTAAGAGACTGG - Intergenic
906128970 1:43444633-43444655 AGATGGAGGTGGCAACAGACGGG - Intronic
907224903 1:52936482-52936504 GGATCCAGTTGCCAATTTACAGG + Intronic
907898408 1:58715005-58715027 AGCTCCAGTGGCCCACAGAAGGG + Intergenic
909020644 1:70427174-70427196 AGATCCAGAGGACAAAAGACTGG - Intronic
919370722 1:196723215-196723237 AAGTCCAGTTTCCAACAGACAGG + Intronic
920095602 1:203484488-203484510 AGATCCAGTTGCCAAGGAACTGG - Intronic
924362512 1:243255843-243255865 AGAGCCTGCTGCCAAGAGACAGG - Intergenic
924798581 1:247310610-247310632 AGATCAAGGTGCCAGCAGGCTGG + Intronic
1064347896 10:14549109-14549131 AGATCAAGGTGCCAGCAGATTGG - Intronic
1064350410 10:14571054-14571076 AGATCAAGGTGCCAGCAGATCGG + Intronic
1067176937 10:43956745-43956767 AGATACAGTCGCAGACAGACAGG - Intergenic
1070831028 10:79418230-79418252 AGATCCAGAGGCGATCAGACAGG - Intronic
1071577313 10:86738303-86738325 AGATCCAGAAGCCATCACACTGG - Intergenic
1076403091 10:130195933-130195955 AGCCCCAGCTGGCAACAGACAGG - Intergenic
1078033314 11:7775905-7775927 AGGCCCAATTGCCAACATACTGG + Intergenic
1080325983 11:31074165-31074187 AGATCCAGTTCACATCAGAGAGG + Intronic
1081603011 11:44508314-44508336 AGAGCCAGTGGCCTTCAGACTGG - Intergenic
1082110281 11:48266548-48266570 AGATCCAGTGGCCAGGATACTGG + Intergenic
1083499262 11:63088173-63088195 AGCTCCAGTTGGCATCAGGCTGG + Intronic
1084189679 11:67493309-67493331 CGATCCAGTTGGGAACAGATGGG + Intronic
1084194178 11:67514719-67514741 AGATTCAGTTGCTTACATACAGG + Intergenic
1085161131 11:74346754-74346776 AGATCCTGATGCAGACAGACTGG - Exonic
1085908964 11:80798546-80798568 AGCTCCAGCTGCCATCAGGCTGG + Intergenic
1086930720 11:92689988-92690010 AGATGGAGTTGCCCACAGCCTGG - Intronic
1097951109 12:65429097-65429119 AGATACAGTGGCAAACAGACAGG + Intronic
1098567482 12:71952391-71952413 ACATTCAGTTACCAACAGCCAGG - Intronic
1100393814 12:94167180-94167202 AGATCCTGTTTGCAAAAGACTGG - Intronic
1101959444 12:109237565-109237587 AGATCCAAGTGCCACCAGCCTGG - Intronic
1106085317 13:26536491-26536513 AGATCCTGTGACCAACAGGCTGG - Intergenic
1108764715 13:53612713-53612735 AGATTCAGTTTCCATCAGAAGGG - Intergenic
1110468845 13:75834430-75834452 AGAACCACTTGCCAACGGCCAGG - Intronic
1114215592 14:20655533-20655555 AGACCCACTTGCCATAAGACAGG - Intergenic
1117094507 14:52283614-52283636 AAATCCACTTGGAAACAGACAGG + Intergenic
1117721718 14:58635196-58635218 AGATTCCGTTGGCAACAGAAGGG + Intronic
1118855096 14:69614777-69614799 AGAACCACTTGCCAGCAGAGAGG + Intronic
1118998476 14:70859209-70859231 ACTTCCAGTTGGGAACAGACAGG - Intergenic
1121238152 14:92408387-92408409 AGCTGCAGTTGCCAACACACAGG - Intronic
1124093896 15:26630384-26630406 AGTTCCAGTTCCCAGTAGACTGG - Intronic
1125538999 15:40459055-40459077 AGACCCAGCTCCCAAGAGACTGG + Exonic
1135069034 16:19336221-19336243 AGATCAAGGTGCCAGCAGATTGG + Intergenic
1135989856 16:27211458-27211480 AGGTCCTGGTGCCAACACACAGG + Intronic
1139277845 16:65744377-65744399 AGATCAAGGTGCCAGCAGATGGG - Intergenic
1139795914 16:69482714-69482736 CCAGCCAGTTGCCCACAGACTGG + Intergenic
1140059138 16:71552846-71552868 AGAAGCAGTGGCCAACAGACAGG + Intronic
1143919516 17:10319677-10319699 AGATCATGTTGCCAAAAGAAAGG + Intronic
1144054976 17:11532616-11532638 AGATCAAGTTAGCTACAGACAGG + Intronic
1145395830 17:22494015-22494037 AAATCCAGTTGTCAGCAGATGGG - Intergenic
1150155835 17:62852246-62852268 CTATCCAGTTGCTAACAGACAGG + Intergenic
1155266471 18:24099238-24099260 AGATCCAGGTGCCAGAAGATTGG + Intronic
1156797866 18:41070215-41070237 AGATTCAGTTACCACCATACTGG - Intergenic
1158067996 18:53436843-53436865 AGATCAAGGTGCCAGCAGACTGG + Intronic
1158883955 18:61807575-61807597 TGATCCAGTTATCAAAAGACAGG + Intergenic
1159190869 18:65040466-65040488 TTATCCAGTTGCCAACTGATGGG + Intergenic
1160391401 18:78536267-78536289 AGATCAAGGTGCCAGCAGGCCGG - Intergenic
1163007215 19:14404603-14404625 AGGTCCAGCTGCAACCAGACAGG + Intronic
1165263949 19:34645244-34645266 AGATACATTTGCCAAGACACAGG + Intronic
927326636 2:21812761-21812783 AGATCAAGGTGCCAACAGAGGGG - Intergenic
929761311 2:44809804-44809826 ACATCAATTTGCCATCAGACTGG + Intergenic
930387104 2:50710891-50710913 AGATACAGTTGCAAACAGAAAGG - Intronic
936374202 2:111926944-111926966 AGATCAGGATGACAACAGACAGG - Intronic
938945146 2:136205643-136205665 AGATCCAATATCCAACAAACAGG - Intergenic
941085512 2:161112744-161112766 AGATGAAGTTGCCACCAGATTGG - Intergenic
945281941 2:208043836-208043858 ACATTCAGTTTCCAACACACGGG + Intergenic
946283195 2:218681636-218681658 AGATCAAGGTGCCAGCAGATTGG + Intronic
946336084 2:219037535-219037557 GGCTCCAGTTCCCACCAGACAGG - Intronic
948485356 2:238277501-238277523 AGATCCAGTTGCCAACAGACAGG - Intronic
948909838 2:240997656-240997678 AGATGCAGTTACCATCAGCCCGG + Intergenic
948978534 2:241479824-241479846 AGCTCCAGAAGCCAGCAGACAGG - Intronic
1169018616 20:2311736-2311758 TGCTCCAGTTGACTACAGACAGG - Intronic
1169331388 20:4719232-4719254 AGATCAAGGTGCCAGCAGATTGG + Intergenic
1170460087 20:16569145-16569167 AGATCAAGGTGCCAGCAGATAGG - Intronic
1171190265 20:23153976-23153998 AGATCCAGGTGCCAGCAGGGTGG + Intergenic
1172319213 20:33983164-33983186 AGCTCCAGTTGTCCACAGAGGGG - Intergenic
1175547705 20:59789323-59789345 AGATCCAGTTGGCCATAGCCTGG + Intronic
1178713678 21:34943735-34943757 AAATCCAGTTGCCAATAATCAGG - Intronic
1181139142 22:20791311-20791333 AGAGCCTGCTGCCAACAGAGTGG + Intronic
949265091 3:2147812-2147834 AGATCCATTTGGAAAAAGACAGG - Intronic
950598658 3:14010480-14010502 AGATCAAGGTGCCAAAAGATTGG + Intronic
951923058 3:27876878-27876900 TGATCCAGATGCCAAGAGAGGGG + Intergenic
953455199 3:43035242-43035264 AGATGCAGGTGCCAGCAGCCAGG - Intronic
957185430 3:76935630-76935652 AGATCAAGGTGCCAGCAGATTGG + Intronic
958748051 3:98161696-98161718 AGATCAAGATGCCATCAGATTGG + Intergenic
958751845 3:98201210-98201232 AGATCAAGATGCCATCAGATTGG + Intergenic
958891339 3:99786483-99786505 AGATCAAGGTGCCAGCAGATTGG - Intronic
959509200 3:107190520-107190542 AGATCAAGGTGCCAGCCGACTGG + Intergenic
963866131 3:150363578-150363600 AGATCCTGTTCTCCACAGACAGG - Intergenic
964210005 3:154216042-154216064 AGATGTAGTTGGAAACAGACTGG - Intronic
968327014 3:197826679-197826701 AGATCCAGTTGCCTATAGACAGG - Intronic
968546820 4:1203118-1203140 AGATCCAGGTGCCGGCAGGCTGG - Intronic
971310090 4:25518253-25518275 AGATCAAGGTGCCAACTGATGGG + Intergenic
971603218 4:28622963-28622985 AGATCCAGGTGACAAAAGAAAGG - Intergenic
973285444 4:48410872-48410894 ATGTGCAGTTGCCAGCAGACAGG + Intronic
976384545 4:84440487-84440509 AGATCCACTTACCACCAGAGAGG - Intergenic
977982219 4:103337738-103337760 AGAAGAAGTTGCCAACAGATAGG + Intergenic
979169241 4:117579057-117579079 AAATTCAGATGACAACAGACAGG + Intergenic
979282305 4:118881422-118881444 AGATCAAGGTGTCAGCAGACTGG - Intronic
986003104 5:3645253-3645275 AGCTCCCACTGCCAACAGACAGG - Intergenic
990962704 5:61411657-61411679 AGATCAAGGTGCCATCAGATTGG + Intronic
992201072 5:74384436-74384458 AGAAGCAGCTGCCAAGAGACTGG - Intergenic
994016748 5:94975489-94975511 AGATCAAGGTGCCAGCAGATTGG - Intronic
996502113 5:124229300-124229322 AGATCAAGTTGCTGGCAGACTGG + Intergenic
997048704 5:130352233-130352255 AGATTCAGTTGCCTGCAGAAAGG - Intergenic
997429743 5:133829558-133829580 AGACACAGTTGCCAACACTCAGG + Intergenic
997431405 5:133843617-133843639 AGGTCCAGTTGTCAGCAGAAAGG - Intergenic
998609947 5:143677418-143677440 AGAGCCAGCTCCCAACAGGCAGG - Intergenic
998918681 5:147043476-147043498 AGATCCAGGTCCCAGCAGGCTGG - Intronic
1000251282 5:159497948-159497970 AGTGCCAGTTCCCAACAGAGTGG + Intergenic
1001279955 5:170379566-170379588 AGAGCCAGCTGCCTCCAGACAGG + Intronic
1003946228 6:11078342-11078364 AGATCAAGTTGCCAGAAGAGTGG - Intergenic
1004075844 6:12343691-12343713 AGTTCCAGTTGACAACAGGGAGG - Intergenic
1012313891 6:97761244-97761266 AGATCAAGAGGCCAACAGAGAGG - Intergenic
1013752543 6:113423762-113423784 AGGTGGAGTTGACAACAGACTGG - Intergenic
1017174380 6:151489508-151489530 AGATCAAGGAGCCAACAGATTGG + Intergenic
1024677791 7:51653105-51653127 AGAGGCAGAAGCCAACAGACAGG - Intergenic
1029671700 7:102037183-102037205 AGATCCTGTCTCAAACAGACAGG + Intronic
1032696174 7:134338481-134338503 AGATCAAGGTGCCAGCAGATTGG + Intergenic
1034189116 7:149200228-149200250 AGATCCAGTTACCAATCAACTGG - Intronic
1034245051 7:149637646-149637668 AGATCCAGCTGCCATAAAACAGG - Intergenic
1038164009 8:25067422-25067444 AAATCTACTTGCCACCAGACAGG + Intergenic
1038485527 8:27932516-27932538 AGATCAAGGTGCCACCAGGCTGG + Intronic
1047555312 8:125923136-125923158 ATATCTAGTTTCAAACAGACTGG + Intergenic
1047763035 8:127968230-127968252 AGATCCTGTTCCCAAAAGCCAGG - Intergenic
1048855043 8:138679746-138679768 AGATCCAGTACCTAACAGAGGGG - Intronic
1049636842 8:143693621-143693643 AGAGCCAGTGGCCCACAGCCAGG - Intronic
1055633146 9:78245300-78245322 AGATCCAGATGCCAGTAGATAGG + Intronic
1056072082 9:82997777-82997799 AGATTCAGTGGTGAACAGACAGG - Intronic
1060778089 9:126391384-126391406 GGATCCAGATGCAGACAGACTGG + Intronic
1061277066 9:129575189-129575211 AGATCAAGGTGCCAGCAGATTGG - Intergenic
1062167706 9:135116247-135116269 AGATCCAGTTGCCAATGGGAAGG - Intronic
1186186070 X:7020882-7020904 ACATCCAATTGCTAATAGACAGG - Intergenic
1186724042 X:12337956-12337978 AGATTAAAGTGCCAACAGACTGG + Intronic
1190711857 X:53077338-53077360 CGATCCAGTTGGCAGCAGCCTGG - Exonic
1192081531 X:68052641-68052663 AGAACCAATGGCCAACAGAAAGG + Intronic
1192511326 X:71722047-71722069 AGCTCCCATTGCCAAGAGACTGG + Intergenic
1192515371 X:71759506-71759528 AGCTCCCATTGCCAAGAGACTGG - Intergenic
1194601110 X:95922995-95923017 AGATCTTGGTGCCAGCAGACTGG + Intergenic
1194954336 X:100161988-100162010 AGCTCCATCTGCCATCAGACAGG - Intergenic
1198406724 X:136320593-136320615 AAAACCAGTTGCCAAAAGATGGG - Intronic
1198670261 X:139072382-139072404 AGATCAAGGTGCCATCAGAGAGG - Intronic
1200111351 X:153742515-153742537 AGATCCAGGTGCCAGCAGGGTGG + Intronic