ID: 948485359

View in Genome Browser
Species Human (GRCh38)
Location 2:238277529-238277551
Sequence CTCGACAGGGCCTCGTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 26}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948485354_948485359 11 Left 948485354 2:238277495-238277517 CCAGTACCTGTCTGTTGGCAACT 0: 1
1: 0
2: 1
3: 15
4: 122
Right 948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG 0: 1
1: 0
2: 0
3: 4
4: 26
948485353_948485359 12 Left 948485353 2:238277494-238277516 CCCAGTACCTGTCTGTTGGCAAC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG 0: 1
1: 0
2: 0
3: 4
4: 26
948485351_948485359 22 Left 948485351 2:238277484-238277506 CCTTACACTACCCAGTACCTGTC 0: 1
1: 0
2: 1
3: 12
4: 113
Right 948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG 0: 1
1: 0
2: 0
3: 4
4: 26
948485356_948485359 5 Left 948485356 2:238277501-238277523 CCTGTCTGTTGGCAACTGGATCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG 0: 1
1: 0
2: 0
3: 4
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948485359 Original CRISPR CTCGACAGGGCCTCGTTATG AGG Intronic
901233097 1:7652064-7652086 CACGACAGGGCCTCCTCATTTGG - Intronic
907284762 1:53372544-53372566 CTCCACACGGCCTCATTTTGGGG + Intergenic
912695408 1:111838002-111838024 CTCGACAGTGACGCGTTATGTGG - Intronic
1066008484 10:31170438-31170460 CTTGCCTGGGCCTCGGTATGAGG - Intergenic
1066641859 10:37561935-37561957 GTGGACAGGGCCTCATTATGTGG - Intergenic
1077614816 11:3667150-3667172 CGCGACAGGGCCTGGGTCTGCGG - Intronic
1091802507 12:3333640-3333662 CTAGAGAGGACCTCGTTCTGGGG + Intergenic
1095931619 12:47631995-47632017 CTCTCCAGGGCCTCTTTAAGGGG + Intergenic
1096629229 12:52915016-52915038 CTCCACAGGGTCTTGTTATGTGG - Intronic
1107818327 13:44264172-44264194 CTGCACAGGGCCTCGTTAAGTGG - Intergenic
1121080301 14:91102643-91102665 CTCTACAGGGCATGGATATGGGG + Intronic
1146112036 17:30098510-30098532 GTAGACAGGGTCTCGTTCTGTGG - Intronic
1148071499 17:44911440-44911462 CTCTCCAGGGACTCGTTCTGTGG + Exonic
1164442696 19:28291431-28291453 CTCAGCAGGGCCTCTTTGTGAGG - Intergenic
928979762 2:37125559-37125581 CTCCACATGGCCTCCCTATGGGG - Intronic
935265999 2:101394808-101394830 CCGGACAGGGCCTCGCTCTGTGG + Intergenic
945221175 2:207485753-207485775 ATGGACAGTGCCTGGTTATGAGG - Intergenic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
1185391486 22:50563687-50563709 CTTGACAGGGCTTGGTAATGTGG + Intergenic
950113338 3:10434684-10434706 CTTGACAGGGCCTGGCCATGGGG - Intronic
971402624 4:26290297-26290319 TTAGACAGGGTCTCGTTCTGTGG - Intronic
996411391 5:123163106-123163128 CTCCACAGAGCCTCTTTATAGGG + Intronic
1032303000 7:130707183-130707205 CTCGTCAGTCCCTGGTTATGTGG - Intergenic
1041376029 8:57210016-57210038 CTGCATAGGGCCTCGTTCTGTGG - Intergenic
1041376799 8:57214395-57214417 CTGCATAGGGCCTCGTTCTGTGG - Intergenic
1056545791 9:87612358-87612380 CTCCACAGGGCCTTCTTATAAGG - Intronic
1056680737 9:88715602-88715624 CTTGACAGGGCCTCTTCATCAGG - Intergenic
1057232458 9:93332067-93332089 CTCCAGAGGGCCTGGTGATGTGG - Intronic
1058165215 9:101611349-101611371 CTCCACAGGGTCTCCTTATAAGG + Intronic
1187370216 X:18699195-18699217 CACCAGAGGGCCTCATTATGAGG - Intronic
1195829471 X:109040133-109040155 AGAGACAGGGCCTCCTTATGTGG - Intergenic