ID: 948487265

View in Genome Browser
Species Human (GRCh38)
Location 2:238288824-238288846
Sequence CCGCCCCCGGCCTCCGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948487260_948487265 -8 Left 948487260 2:238288809-238288831 CCGCGCGCGCCGCGCCCGCCCCC 0: 3
1: 5
2: 29
3: 282
4: 1653
Right 948487265 2:238288824-238288846 CCGCCCCCGGCCTCCGCCATTGG 0: 1
1: 0
2: 1
3: 21
4: 203
948487259_948487265 18 Left 948487259 2:238288783-238288805 CCGCTGTCACATAGTGGAAAACG 0: 1
1: 0
2: 1
3: 8
4: 113
Right 948487265 2:238288824-238288846 CCGCCCCCGGCCTCCGCCATTGG 0: 1
1: 0
2: 1
3: 21
4: 203
948487257_948487265 26 Left 948487257 2:238288775-238288797 CCGAGTCGCCGCTGTCACATAGT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 948487265 2:238288824-238288846 CCGCCCCCGGCCTCCGCCATTGG 0: 1
1: 0
2: 1
3: 21
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948487265 Original CRISPR CCGCCCCCGGCCTCCGCCAT TGG Intronic
900633655 1:3651722-3651744 CCTCCCCCGGCCGCCGCCTGTGG - Intronic
900638819 1:3678647-3678669 CAGCCACCGGCCTCCCCCATGGG - Intronic
902470396 1:16644771-16644793 CCGCGCCCAGCCTCCGCTAGGGG + Intergenic
902807646 1:18871137-18871159 CCGCCCCCTCTCCCCGCCATGGG - Intronic
902896796 1:19485212-19485234 CCGCTCCCAGCCCCCGCCCTTGG - Intronic
903064826 1:20693554-20693576 CCGCACCCAGCCTCCACCTTGGG + Intronic
903777094 1:25800213-25800235 CCGCCGCCAGCCGCAGCCATGGG + Exonic
903907502 1:26696833-26696855 CCGCCCCCAGCCTACGGCTTCGG + Exonic
904836217 1:33338832-33338854 CCTCCCCCAGCCTCTCCCATCGG - Intronic
913130927 1:115838233-115838255 TCGCCCTCGGCCTCCTCCACCGG + Exonic
914831957 1:151176720-151176742 CCGCCCACTGCCTCAGCCCTGGG - Exonic
920666275 1:207964727-207964749 CCTCCCCCGCCCTCCTCCCTCGG - Intergenic
922729626 1:227942844-227942866 CCGACCCAGGCCCCAGCCATGGG + Intronic
922823493 1:228501306-228501328 CCTCTCCCGGACTCCCCCATGGG - Intergenic
923744299 1:236686400-236686422 CCGCCCCCGGCCCCGCCCGTCGG - Intergenic
1062861361 10:812975-812997 CGGCCCTCGCCCTCGGCCATGGG - Exonic
1064908093 10:20369907-20369929 CAGCCCCCTGCCCCCTCCATTGG - Intergenic
1065550119 10:26861232-26861254 CCGCCCCCTCCCTCCACCCTCGG - Intergenic
1066065854 10:31760262-31760284 CCGCCCCCCGCATTCCCCATTGG + Intergenic
1067769912 10:49115574-49115596 CCGCCCCCGGCCCGCCCCTTGGG + Intergenic
1072188355 10:93062276-93062298 CGGTCCCCGGCATCTGCCATGGG + Intronic
1077034763 11:489291-489313 CCGGCCCCGCCCTGTGCCATCGG - Intronic
1077124131 11:925079-925101 CCGCCCCCGGCCGCTGTCACTGG + Intronic
1077422858 11:2461065-2461087 CTGCCCCCAGCCACGGCCATTGG - Intronic
1078328613 11:10400614-10400636 TCGCCCCCTGCCTCTACCATAGG + Intronic
1079035297 11:17014712-17014734 CCGCCAGCGGCCCCCGCCAGCGG - Intergenic
1080601983 11:33829344-33829366 CCGCCCCCTCCCCCCGCCTTGGG - Intergenic
1081871031 11:46382526-46382548 GCGGCCCCGCCCTCCGCCAAGGG - Intronic
1084308323 11:68300684-68300706 CCTCCCCCGGCCCCCACCAAGGG - Intergenic
1086143381 11:83523822-83523844 CCGCCCCCTGCCCCTGCCATTGG - Intronic
1088823538 11:113475478-113475500 CCGCCCCCGCCCCCCACCAAAGG + Intronic
1089306380 11:117528923-117528945 CCGCCCCCCGCCCCCCCCCTTGG + Intronic
1089442908 11:118531245-118531267 CCGCCCCCGCCCCCCGCCACCGG - Intronic
1090369432 11:126238069-126238091 CCGCACCCGGCCTCTTCCATTGG - Intronic
1090474044 11:127003828-127003850 CCGCCCCCCACCTCCGCCAGCGG + Intergenic
1091024077 11:132126532-132126554 CCTCCTCCTGCCCCCGCCATGGG - Intronic
1092123035 12:6057743-6057765 CCGCCCCCGCCCTCCGCGGTGGG + Intronic
1092247946 12:6873601-6873623 CTGCCCCGGGCCTTCGCCGTGGG - Intronic
1093921708 12:24866373-24866395 CCGCCCCCCGCCACCGCTGTGGG + Intronic
1094819847 12:34215981-34216003 CCGCGCCAGGCCACCGTCATTGG - Intergenic
1096101012 12:48970493-48970515 CCGGCCGCGGCCTCCGCCCTCGG - Exonic
1096491370 12:52014915-52014937 CCGCCCCCGGCCCGCGCCTTCGG + Exonic
1097106776 12:56630374-56630396 CCCCACGCGGCCTCCGCCACAGG + Intronic
1102231509 12:111265737-111265759 CCTCCTCCGGGCTCTGCCATTGG - Intronic
1102370911 12:112381919-112381941 CGGCCCCCGGCCCCCGCCATCGG - Intronic
1104854278 12:131894832-131894854 CCGGCCCCGGCCTGCCCGATGGG + Exonic
1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG + Exonic
1107911282 13:45107877-45107899 CTGCCCCCTGCCTCAGCCAAAGG - Intergenic
1109816844 13:67596007-67596029 CCGCGCCCAGCCTACCCCATTGG - Intergenic
1113582233 13:111437762-111437784 CCGCCTCCTGCTTCCGCCCTGGG + Intergenic
1113769237 13:112897985-112898007 CCGGCCCCGGCCCCGGCCCTGGG + Intronic
1113962395 13:114133055-114133077 CCACCCCAGACCTCCGGCATGGG + Intergenic
1114069772 14:19097719-19097741 CCGCCGCCGGCCACCGTCGTGGG + Intergenic
1114092490 14:19302284-19302306 CCGCCGCCGGCCACCGTCGTGGG - Intergenic
1116817681 14:49598947-49598969 CCGCCACCCGGCGCCGCCATCGG - Exonic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1122637938 14:103138928-103138950 GCGCCCCCGGCCTCCAGCAGTGG + Intergenic
1122960975 14:105093518-105093540 CCGCCCCCGGCCCGCGCCCCGGG + Intergenic
1123060536 14:105592331-105592353 CCTCCCTCGGCCTGCCCCATGGG + Intergenic
1127995992 15:64153350-64153372 CAGCCCCTGGCCCCCGCCATCGG - Intronic
1128322579 15:66703532-66703554 CCGGCCCCTGGCTCCGACATGGG - Exonic
1129752710 15:78077229-78077251 GCGTCCCCTGCCTCCGCCACTGG - Intronic
1131234419 15:90683559-90683581 CCGCCCCCAGCCACACCCATGGG - Intergenic
1132398454 15:101490280-101490302 TGGGCCGCGGCCTCCGCCATGGG - Intronic
1132557198 16:577930-577952 CAGCCCCCAGCCTCTGCGATGGG + Intronic
1132644030 16:990680-990702 CCGGCCCCCGCCTTCCCCATGGG + Intergenic
1133479824 16:6159365-6159387 CCGCACACGGCCTCTGTCATAGG + Intronic
1134716479 16:16360090-16360112 CCACCCCAGGCCTGCGCCAATGG + Intergenic
1134803490 16:17106342-17106364 CTGCCCCCGGCCTCTGCCTCTGG - Exonic
1134958271 16:18392069-18392091 CCACCCCAGGCCTGCGCCAATGG - Intergenic
1136402264 16:30025171-30025193 CGGCCCCCGGCCTCAGTCCTGGG + Exonic
1137559238 16:49492462-49492484 CCGGCCCCGGCCTCGGCCTCCGG - Intronic
1138652063 16:58466304-58466326 CCGCACCCAGCCCCCACCATGGG + Intronic
1140333029 16:74076173-74076195 CCTCCCCCTGCCTCCCCCACAGG - Intergenic
1140897683 16:79339347-79339369 CCGCACCCGGCCTGGGTCATGGG + Intergenic
1141531239 16:84648468-84648490 CTCCCCGCGGCCGCCGCCATTGG + Intergenic
1141900817 16:86989108-86989130 CCTCCCCCGGCCCCCGGCACTGG + Intergenic
1142173190 16:88633546-88633568 CAGCCCCCGGCCACAGCCCTAGG + Intergenic
1142263468 16:89053092-89053114 CAGCCCCCCGCCTCCCCCAACGG + Intergenic
1144128114 17:12221136-12221158 GCGCCCCCGCCCCCCGCCGTGGG + Intergenic
1144685974 17:17226725-17226747 CTGCCCCCAGCCTCCATCATTGG + Intronic
1145384054 17:22401810-22401832 ACGCCCCCGGACTCCGCCTGTGG - Intergenic
1145765543 17:27456333-27456355 CTGCCGCCGGCCTCCGCCCTCGG - Intergenic
1145865840 17:28241006-28241028 CCGCCCCCGACCTCTGCCACTGG - Intergenic
1145938404 17:28728112-28728134 CCGCCCCCATCTTCCCCCATGGG + Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1147261730 17:39212946-39212968 CCACTCCCTCCCTCCGCCATAGG + Intronic
1147420470 17:40319809-40319831 CCCCCCCCGGCCCCCTCCAGGGG - Intronic
1147425060 17:40342338-40342360 CCGCCCCCGGCCTGCGGACTTGG + Intronic
1148433678 17:47663871-47663893 CCCACCCCAGCCTCCTCCATAGG - Intronic
1148682760 17:49484183-49484205 CCCACCCCAGCCCCCGCCATGGG - Intergenic
1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG + Intergenic
1152361903 17:79836696-79836718 CAGGCCCCGGCCCCCGCCCTGGG - Intronic
1152625653 17:81386931-81386953 CCGCCCCCGGCCGGCGCAAGTGG - Intergenic
1156159698 18:34344687-34344709 CCGCCCCCTCCCACTGCCATGGG + Intergenic
1157464283 18:47930747-47930769 CCGCTTCCGCCCTCCGCCCTCGG + Intronic
1158579854 18:58671677-58671699 CCGCCCTCGGCCGCCCCCACGGG + Exonic
1160704941 19:525224-525246 CCTCCCCCAGCCTCAGCGATGGG + Intergenic
1160815062 19:1031328-1031350 CCGCCCCCCGCCACCACCCTCGG - Intronic
1160823015 19:1067100-1067122 GCGCCCCCCGCTTCCGCCTTCGG - Intronic
1161279614 19:3438725-3438747 CCGCACCCGGCCTCCTCCTGAGG + Intronic
1161507057 19:4649801-4649823 CCGCCCCTGCCCTCCGACCTCGG - Intronic
1161991598 19:7687353-7687375 CCTCCCGTGGCCTCCGGCATGGG + Exonic
1162348315 19:10134267-10134289 CCGCCCCTGGCCAAAGCCATTGG - Exonic
1162555359 19:11383050-11383072 CCACCCCCTCCCTCCGCCCTTGG + Intronic
1162931956 19:13961967-13961989 GCGCCCCCGCCCTCCGCCGCTGG - Exonic
1163685517 19:18709782-18709804 CTGTCCCCGGCCTCAGCCCTCGG - Intronic
1165349788 19:35269308-35269330 CCGCCCCCGGCCCCCGGCCTCGG + Intronic
1165404091 19:35619483-35619505 CCTCCCCCGGGCTCCGGCACAGG - Exonic
1165654915 19:37524745-37524767 CCGCCCCTGGCCTGCTTCATGGG + Intronic
1165867834 19:38949847-38949869 CCGCCCCCTGGCTCCTCCAGCGG + Exonic
1166258226 19:41620574-41620596 CCGCCCCCAGCCTCCACCCCTGG - Exonic
1166343194 19:42150787-42150809 CCCCACCCGGCCTGCGGCATTGG - Intronic
1166678419 19:44753604-44753626 CCGGCCCCAGCCTGCGCCACCGG + Intronic
1167354209 19:48993365-48993387 CCCCCCCCAGCCAGCGCCATTGG + Intergenic
1167377204 19:49118638-49118660 CTGCCTCCGCCCTCCGCCCTCGG - Exonic
1167428846 19:49443010-49443032 CCGCCCACCGCCTCCGCCTCTGG + Intergenic
1167605720 19:50480500-50480522 CCTCCCCCGGCCCCCACCACAGG - Intronic
1167818495 19:51904984-51905006 GCGCCCTCGTCCGCCGCCATAGG - Exonic
1168314085 19:55476549-55476571 CCGCCCCCGGACCCTCCCATTGG - Exonic
1168659427 19:58154708-58154730 CGGCCCCCGACCTCCGCCTGGGG - Intronic
924987972 2:288406-288428 CCGCACCCGGCCTCCTCCGTGGG - Intronic
925068909 2:951015-951037 CCGCCCCCGGCCGCCTCCCGCGG + Exonic
925419923 2:3703617-3703639 CCGTCCCCGTCCTGCGCCAGCGG + Exonic
937904466 2:127046145-127046167 CCTCTCCCGGCCCCCACCATGGG + Intergenic
938418424 2:131123779-131123801 CCCCCCCCGCCCCCCGCCCTCGG + Intronic
938796105 2:134719136-134719158 GCGGCCCCAGCCTCCGCCACCGG - Intergenic
940112625 2:150171189-150171211 CCCCGCCCCACCTCCGCCATGGG - Intergenic
943060558 2:183038193-183038215 CCGCCCGCGACCTCCGCCTTAGG + Exonic
943266557 2:185739114-185739136 CCGCCCCCGGGCGCCGCAAGAGG - Intronic
945408575 2:209481555-209481577 CCTACCCCAGCCTCAGCCATAGG - Intronic
946250068 2:218406344-218406366 CCGCTCCCCGCCTCTGCCTTCGG - Intergenic
948487265 2:238288824-238288846 CCGCCCCCGGCCTCCGCCATTGG + Intronic
1169367292 20:5001588-5001610 CCGCCCCCGACCCCTGCCCTCGG + Intronic
1172143935 20:32743342-32743364 CCGCCCACGGCCTCCGGCACCGG + Exonic
1173795115 20:45854497-45854519 CCGCGCCCGGCCTCACACATAGG + Intronic
1174287814 20:49484379-49484401 CCGCCCCCGGCCTCCCCGGCAGG - Intergenic
1174458300 20:50665144-50665166 CCGCACCCGGCCAGCACCATGGG - Intronic
1174646620 20:52091695-52091717 CCGCGCCCAGCCACGGCCATAGG - Intronic
1175898790 20:62351878-62351900 CCCTCCCCCGCCTGCGCCATGGG + Intronic
1180488239 22:15820282-15820304 CCGCCGCCGGCCACCGTCGTGGG + Intergenic
1182122665 22:27797715-27797737 CCGTCCCCGGCCGCCGCCCCCGG + Exonic
1182856056 22:33518597-33518619 CCGCGCCCGGCCTCAGGCACAGG + Intronic
1184086864 22:42270562-42270584 GCGGCCGCGGCCTCCGCCAGGGG - Intronic
1184381872 22:44149750-44149772 CCACCCCTGGCCCCCGCCAAAGG - Intronic
1184640490 22:45867648-45867670 CCGCCTCCGGCCTCTGCCCGCGG + Intergenic
954299025 3:49689459-49689481 CCGCGCCCAGCCTCCGCTAGGGG - Intronic
954361001 3:50122821-50122843 CCTGCCTCGGCCTCCCCCATTGG - Intergenic
958026827 3:88059001-88059023 CCGCCTACGGGCTCTGCCATAGG - Intronic
961305683 3:125958237-125958259 CCGCCGCCTGCCTCCGCCCAGGG + Intergenic
962982068 3:140499629-140499651 CCACCCCCTGCCTACACCATAGG - Intronic
966872303 3:184299068-184299090 CCGCCCTCGGACCCCGCCCTCGG - Exonic
966993092 3:185254082-185254104 GCGCGCCCGGCCTCCTCCAGAGG + Exonic
968479235 4:826336-826358 CCGCCCCCCGCCCCCGCCCCCGG - Intergenic
968479289 4:826421-826443 CCGCCCCCCGCCCCCGCCCCCGG - Intergenic
968659701 4:1793917-1793939 GCGGCCCCCGCCCCCGCCATGGG + Exonic
968879551 4:3292260-3292282 CCGGCCCCGGCCTGCGCCTCTGG - Intergenic
969346755 4:6575108-6575130 CCGCCCCCGCCCGCAGCCAATGG + Intergenic
970823888 4:20251806-20251828 CCGCCCCCTGGCTCCGCTCTGGG - Intergenic
975118537 4:70705072-70705094 CCGCCGCCGGCCTCCCCCGCCGG + Intronic
975139105 4:70902351-70902373 CCGCCCCCTCCCCCTGCCATTGG + Intronic
975339158 4:73218352-73218374 CTGCAGCCGGCCTCTGCCATTGG - Intronic
976199098 4:82561808-82561830 CCGTCCCCGGTCTCCGCCTGCGG + Intronic
979231506 4:118352913-118352935 CCACCCGCGGCCGCCGCCAGGGG - Exonic
980969987 4:139558592-139558614 CCAACCCCGGCCCCCGCCGTCGG + Intronic
983077450 4:163343761-163343783 ACGCCCCCGGCCCCCGGCTTTGG + Intronic
985630961 5:1013771-1013793 CAGCCTCCGGCCTCCACCATGGG - Intronic
985679781 5:1249817-1249839 CCGCCAGCGGCCTCGGCCATTGG + Intergenic
992283179 5:75203371-75203393 CCGCGCCCGGCCTCCCCTTTGGG - Intronic
994947767 5:106417449-106417471 CCGCCGCCGGCCTCCCCCGCCGG - Intergenic
997200691 5:132008424-132008446 CCACCCCTGGCCTCTGCCTTAGG - Intronic
998521133 5:142801689-142801711 CCTCCCCCAGCCCCCGCCTTTGG + Intronic
1002541332 5:179908054-179908076 CAGCCCACGGCCTCCGGCCTGGG + Intergenic
1002927139 6:1611163-1611185 CTGTCCCCGGCCGCCGCCCTGGG + Exonic
1006911392 6:37565885-37565907 CCCTCCCCAGCCCCCGCCATAGG - Intergenic
1007431574 6:41780109-41780131 CCGCGCCCCGCCTCCGCCGCAGG - Intronic
1011075270 6:83431400-83431422 CCGCTCCCTGCCCCCGCCCTGGG - Intergenic
1012873240 6:104696151-104696173 CCCCCCCCCGCCCCCACCATGGG - Intergenic
1015402129 6:132798642-132798664 CCGCCCCCGGCCTCCTCCCGGGG - Intergenic
1019471912 7:1225554-1225576 CCTCTCCCGGCCTCCACCATCGG + Intergenic
1019474159 7:1236126-1236148 CCGCCGCCGCCCGCCGCCAAGGG + Exonic
1019483857 7:1278949-1278971 CCGCCATCGGTCTCTGCCATTGG - Intergenic
1019483860 7:1278962-1278984 CCGCCATCTGTCTCCGCCATCGG - Intergenic
1019504329 7:1383288-1383310 CCGCCCTCGGCCCCCACCACCGG + Intergenic
1019917872 7:4144991-4145013 CCGCCCCAGGCCTCCCCCGCTGG - Intronic
1020035063 7:4959433-4959455 CCGCCCCAGGCCTGGGCGATGGG - Intergenic
1020083094 7:5296817-5296839 CCGGCCCCGCCCTCCACCACAGG - Intronic
1022471149 7:30682521-30682543 CCGCCCCCCGGCGCAGCCATTGG - Intronic
1025211209 7:57020413-57020435 CCGGCCCCGCCCTCCACCACCGG + Intergenic
1025660746 7:63556434-63556456 CCGGCCCCGCCCTCCACCACCGG - Intergenic
1027025894 7:74851430-74851452 CGGCCGCCGCCCTCGGCCATCGG - Exonic
1027061865 7:75092680-75092702 CGGCCGCCGCCCTCGGCCATCGG + Exonic
1029640566 7:101816838-101816860 CCGGCCCCGGCCGCCGCCCCCGG + Intronic
1030176658 7:106661035-106661057 TCGCCCGCGTCCTCCGCCCTCGG - Intergenic
1031011196 7:116526256-116526278 CCTCCCCCGCCCGCCGCCAGGGG - Intronic
1031919105 7:127588481-127588503 CCCTCCCCGGGCCCCGCCATGGG + Exonic
1032241441 7:130162355-130162377 CCCCTCCCGGCCCCCGCCACTGG + Intergenic
1034106340 7:148494013-148494035 CCACACCCGGCCTCCTCCAAGGG + Intergenic
1034560482 7:151876677-151876699 CCTCCCCCGGCCGCTGCCTTCGG + Exonic
1039943916 8:42114179-42114201 CCACCCCCAGCCTCTGCCCTGGG + Intergenic
1042093211 8:65181509-65181531 CCGCGCCCGGCCTCCATCACTGG + Intergenic
1045063400 8:98426746-98426768 CAGCCCCCTGCCTGCGCCCTGGG + Intronic
1045488701 8:102654402-102654424 CCAGCCCCGGCCTCCGCCAGGGG - Intronic
1046660048 8:116938747-116938769 CCGCCCCCACCCCCCACCATGGG - Intronic
1047124786 8:121948353-121948375 CCCGCCCCCGCCCCCGCCATGGG + Intergenic
1047393725 8:124475033-124475055 CCGCCCCCGGCCGCGGCCCCGGG + Exonic
1049791642 8:144475124-144475146 CCGCCCCCGGGCTCCGACCCTGG + Intronic
1051936254 9:22446734-22446756 CCTCCCCCGGCTTCCGCGCTGGG + Intergenic
1053163446 9:35829159-35829181 CCGCCCCCGCCCTACTCTATTGG - Intronic
1056406779 9:86282580-86282602 CCGCCCCCCGCCGCCACCATTGG + Intergenic
1056808838 9:89748847-89748869 TCTCCCCAGGCCTCCCCCATTGG + Intergenic
1058861188 9:109119296-109119318 CCGCCCCCGTCCCCCGCCCGTGG - Intronic
1061623614 9:131827497-131827519 CAGCCCCCGGCAGCCTCCATTGG - Intergenic
1062168533 9:135121479-135121501 CCGCCCCAGGCCCCCTCCAGTGG - Intergenic
1062567536 9:137169957-137169979 CCGCCCCCGGCACCCGCGGTGGG + Exonic
1062706740 9:137949670-137949692 CCTCTGCCGGCCACCGCCATCGG - Intronic
1185890688 X:3819379-3819401 CCGCGCCCGGCCTCCCTCAAGGG - Intronic
1185895783 X:3857770-3857792 CCGCGCCCGGCCTCCTTCAAGGG - Intergenic
1185900902 X:3896194-3896216 CCGCGCCCGGCCTCCTTCAAGGG - Intergenic
1185906017 X:3934633-3934655 CCGCGCCCGGCCTCCTTCAAGGG - Intergenic
1196424974 X:115561109-115561131 CGCCCCTCGGCCGCCGCCATTGG - Intergenic
1199711608 X:150473559-150473581 GCTCCCCCGGCCACCCCCATGGG - Intronic
1200292167 X:154885081-154885103 CCGCCCCCGGCCGCCAGCACCGG - Exonic
1200339005 X:155380818-155380840 CCGCCCCCGGCCGCCAGCACCGG - Exonic
1200347464 X:155459874-155459896 CCGCCCCCGGCCGCCAGCACCGG + Exonic
1200886863 Y:8279897-8279919 CCGCCCAGGGCCTCCGCCTCCGG + Intergenic