ID: 948487318

View in Genome Browser
Species Human (GRCh38)
Location 2:238289076-238289098
Sequence CCAGCTCGGGGAGCGCGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948487307_948487318 5 Left 948487307 2:238289048-238289070 CCTTCCATTCACTACGCCCTCAA 0: 1
1: 0
2: 1
3: 8
4: 114
Right 948487318 2:238289076-238289098 CCAGCTCGGGGAGCGCGGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 202
948487305_948487318 23 Left 948487305 2:238289030-238289052 CCACTTCCGGCGTCGGCGCCTTC 0: 1
1: 0
2: 2
3: 4
4: 56
Right 948487318 2:238289076-238289098 CCAGCTCGGGGAGCGCGGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 202
948487306_948487318 17 Left 948487306 2:238289036-238289058 CCGGCGTCGGCGCCTTCCATTCA 0: 1
1: 0
2: 0
3: 1
4: 59
Right 948487318 2:238289076-238289098 CCAGCTCGGGGAGCGCGGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 202
948487308_948487318 1 Left 948487308 2:238289052-238289074 CCATTCACTACGCCCTCAAGCCC 0: 1
1: 0
2: 0
3: 9
4: 140
Right 948487318 2:238289076-238289098 CCAGCTCGGGGAGCGCGGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948487318 Original CRISPR CCAGCTCGGGGAGCGCGGAG TGG Intronic
900003598 1:29441-29463 CGCGCTCGGGGAGGGCGCAGTGG - Intergenic
900023316 1:199957-199979 CGCGCTCGGGGAGGGCGCAGCGG - Intergenic
900210363 1:1452586-1452608 CCAGCTCAAGGAGGGAGGAGCGG - Intronic
900395880 1:2453063-2453085 CCAGCTCTGAGAGCACTGAGGGG - Intronic
900570797 1:3357350-3357372 CCAGCTCGGGGCGGGGGGTGGGG - Intronic
902090426 1:13898560-13898582 CCAGCTCGTGGAGGGTGGAAGGG + Intergenic
902279035 1:15360973-15360995 CCAGCGAGGGCAGCGCGAAGTGG + Intronic
902348358 1:15835557-15835579 CCAGCACGGGGAGAGGGCAGGGG - Intergenic
902598489 1:17525171-17525193 CCAGCATGGGGAGGGAGGAGAGG + Intergenic
905796367 1:40818732-40818754 CCAGAGCGGGCAGGGCGGAGAGG + Intronic
906482186 1:46206348-46206370 CCCGCTCTGGGAGCTCGGACTGG + Intronic
907526917 1:55059122-55059144 CCAGCTAGGAGAGTGAGGAGGGG + Intronic
910232034 1:84997264-84997286 CCTTCTCCGGGAGCGCGGGGAGG - Intergenic
912324804 1:108747135-108747157 CCAACTGGTGGAGCGCGGACGGG - Intronic
914942738 1:152037070-152037092 CCAGCCCGGGAGGCGGGGAGGGG - Intronic
915564369 1:156705661-156705683 CCAGGTGGGGGGGGGCGGAGCGG - Intronic
916716991 1:167455000-167455022 CCGGCTCGGGGAGCTCCGGGAGG - Intronic
916737549 1:167621490-167621512 CCATCTCAGGGGGCGGGGAGAGG + Intergenic
917749070 1:178038013-178038035 CCAGCCCCGGGAGAGCGGAAGGG + Intergenic
917854355 1:179089045-179089067 CTAGCTTGGGGAGTGTGGAGGGG + Intronic
918178131 1:182062855-182062877 CCAGTTGGGGGAGTGCGGGGTGG - Intergenic
921945087 1:220880491-220880513 CCAGCCCGGGGTCCGGGGAGTGG - Intronic
922315042 1:224434590-224434612 GCAGCTCGGGGTGCGCGGCCCGG + Intronic
922988964 1:229888790-229888812 CCAGCTCTGGGAGAGCCCAGAGG + Intergenic
923730380 1:236544198-236544220 CCAGCACTGGGAGGGCGAAGTGG - Intronic
1065137741 10:22689158-22689180 GCAGCTTGGGGAGTGAGGAGGGG - Intronic
1066429286 10:35336686-35336708 CCAACTGGGGAAGCGCGGGGGGG + Intronic
1067015771 10:42755418-42755440 CCGGCTCGGTGAGCGCAGAGAGG + Intergenic
1067853275 10:49768863-49768885 CCTGCTGGAGGAGCGCGGACCGG - Intergenic
1072016215 10:91349404-91349426 CAAGCTCTGGGAGAGGGGAGGGG + Intergenic
1073048873 10:100655306-100655328 CCAGCGCCGGGAGAGGGGAGAGG - Intergenic
1074819217 10:117166428-117166450 CCAGCCTGGGGTGCGAGGAGGGG - Intergenic
1075587048 10:123665879-123665901 ACAGCGCGGGGGGCGGGGAGAGG + Intergenic
1075634527 10:124021221-124021243 CCAGCTCGGGGGGTACGGGGGGG + Intronic
1077416107 11:2425018-2425040 CCAGCCCGCGGACCGCAGAGAGG + Intergenic
1079031078 11:16987001-16987023 CCAGCCCAGGGAAGGCGGAGAGG + Intronic
1081576481 11:44321655-44321677 CCAGCTCTGGAAGCGGGAAGTGG + Intergenic
1082001544 11:47395837-47395859 CCAGCCCGGGGAGTGCAGCGAGG - Intergenic
1083053008 11:59793532-59793554 CCAGCGTGGGGAGGGAGGAGAGG + Intronic
1083432553 11:62621851-62621873 ACAGCTCGGTGAGCGGGGCGGGG - Exonic
1084273022 11:68039057-68039079 CCCGCCCGGCGTGCGCGGAGCGG + Exonic
1084310181 11:68312409-68312431 GCAGGGCGGGGAGCGCGGGGAGG + Intergenic
1088823522 11:113475423-113475445 CGAGCGCGGGGAGCGCGGGAGGG + Intronic
1089619264 11:119713206-119713228 CCAGCTGGGGGAGGGGGCAGAGG + Intronic
1090075339 11:123577248-123577270 CCAGCTCAGGGAGCCAGGTGAGG - Intronic
1091377015 12:31495-31517 CGCGCTCGGGGAGGGCGCAGCGG - Intergenic
1092860823 12:12717666-12717688 CGAGCTCTAGGAGCGCGCAGGGG - Exonic
1096257714 12:50073257-50073279 CCAGCTCCGGCAGCACAGAGAGG - Intronic
1096538547 12:52290337-52290359 CCAGCTCTGGGGGCTCGCAGGGG + Intronic
1096540232 12:52303027-52303049 CCAGCTCTGGGGGCTCGCAGGGG - Intronic
1097123211 12:56752262-56752284 GCAGCTCGGGCAGCTCGGTGGGG + Exonic
1097262212 12:57726272-57726294 CCCGCTCGGGGTTCGCGGAAGGG - Intronic
1098543579 12:71686335-71686357 CCAGCGCCGGGACCGCGGATTGG + Exonic
1103487912 12:121295753-121295775 CCTTCTCGGGGAGATCGGAGGGG + Intronic
1103595300 12:122021688-122021710 CCGGCTCTGGGCGCGCGGTGGGG - Exonic
1103626768 12:122226056-122226078 GCAGCTTCGTGAGCGCGGAGCGG + Exonic
1113254920 13:108495957-108495979 CAAGCGCGGGGAACGCGGCGGGG + Intergenic
1113255039 13:108496466-108496488 CCAGCTGGGGTCGCGCAGAGGGG - Intergenic
1115960825 14:38835277-38835299 CCCGCACTGGGAGCGTGGAGAGG + Intergenic
1118404649 14:65412017-65412039 ACAGCACGGGGAGAGGGGAGAGG - Intronic
1119702006 14:76761893-76761915 CCGGCTCGGGCGGCGCGCAGGGG - Intergenic
1119808708 14:77499033-77499055 ACGGGTCGGGGAGCGCCGAGGGG - Intergenic
1122116708 14:99531204-99531226 CCAGCTTGGGGAGCGAGGCTGGG - Intronic
1122838655 14:104443736-104443758 CCAGCTCGGGCACCGCTGTGGGG + Intergenic
1123039764 14:105485747-105485769 CCAGCTTGGGGAGAGGGCAGGGG - Intergenic
1123167984 14:106344655-106344677 ACAGCTCGTGGAGTCCGGAGAGG - Intergenic
1123170623 14:106369368-106369390 ACAGCTCGTGGAGTCCGGAGAGG - Intergenic
1124370960 15:29104362-29104384 GCAGCCCTGGGAGCGCGGCGGGG - Intronic
1124624945 15:31302471-31302493 CCAGGCCAGGGAGTGCGGAGTGG - Intergenic
1124960541 15:34389995-34390017 CCCGCTCTGGGAGAGTGGAGGGG + Intronic
1124977170 15:34536216-34536238 CCCGCTCTGGGAGAGTGGAGGGG + Intronic
1126823542 15:52528524-52528546 CCAGCTCGAGCAGCGCGGCAGGG + Intronic
1128368251 15:67020185-67020207 CAAGCCCAGGGAGCGAGGAGGGG - Intergenic
1131099869 15:89679432-89679454 CCAGCTAGAGGAGGGCAGAGAGG + Intronic
1131515962 15:93076971-93076993 CCAGCTTGGGGTGCAGGGAGGGG + Intronic
1131832643 15:96363509-96363531 GCAGTTCAGGGAGCGCGGGGTGG - Intergenic
1132449905 15:101961499-101961521 CGCGCTCGGGGAGGGCGCAGCGG + Intergenic
1132498522 16:274893-274915 CCAACTCGGGGAGACAGGAGGGG - Intronic
1132657145 16:1046073-1046095 GCAGCTCGGGGAGGGCTGGGTGG + Intergenic
1132859954 16:2065533-2065555 CCAGCTCCGGGGGTGGGGAGAGG - Exonic
1133271452 16:4612720-4612742 CCAGCGGGTGGAGCGTGGAGAGG + Intronic
1135520431 16:23172757-23172779 GCAGCACGGGCAGCGGGGAGGGG + Intergenic
1135544979 16:23359555-23359577 CCAGCACCGGGAGAGCAGAGAGG - Intronic
1136867888 16:33770940-33770962 CTGGCTCGGGCAGCGCTGAGGGG + Intergenic
1136898924 16:34015149-34015171 CTGGCTCGGGCAGCGCCGAGGGG + Intergenic
1140481847 16:75266314-75266336 TCAGCTGGGGGAGGGCAGAGGGG - Intronic
1141312187 16:82925268-82925290 CCAGCTAGGGGTGCTCTGAGGGG - Intronic
1141484014 16:84326757-84326779 TCAGCTGGGGGAGGGAGGAGAGG + Intronic
1141526929 16:84617794-84617816 CGAGCCCGGGGAGCGGGGCGTGG + Intronic
1141705387 16:85661771-85661793 GCAGCTCGGGGCCCGCGGGGAGG - Intronic
1142136423 16:88453793-88453815 ACAGCGCGGGGGGCGCGGCGCGG - Intronic
1142216209 16:88831331-88831353 CGAGCACGGGGAGCGTGGGGAGG + Intronic
1142216289 16:88831619-88831641 CGAGCACGGGGAGCGTGGGGAGG + Intronic
1142216339 16:88831799-88831821 CGAGCACGGGGAGCGTGGGGAGG + Intronic
1203074084 16_KI270728v1_random:1108387-1108409 CTGGCTCGGGCAGCGCCGAGGGG - Intergenic
1203104291 16_KI270728v1_random:1345352-1345374 CTGGCTCGGGCAGCGCTGAGGGG - Intergenic
1203129223 16_KI270728v1_random:1617016-1617038 CTGGCTCGGGCAGCGCTGAGGGG + Intergenic
1142509672 17:385856-385878 CCAGCTCGGGGTGCGGGTGGGGG - Intronic
1142704339 17:1684840-1684862 CCGGCGCTGGGAACGCGGAGCGG - Intronic
1144779723 17:17801692-17801714 CCAGCATGGGCAGCGGGGAGGGG + Intronic
1145765594 17:27456525-27456547 CCGGCTCGGGCAGCGCCGAGGGG + Intergenic
1145976352 17:28986359-28986381 CCAGCTGGGTGAGGGTGGAGCGG + Intronic
1146061989 17:29612580-29612602 CCACCCCGGGGAGAGCCGAGGGG - Intronic
1149293031 17:55235577-55235599 CCATCTCGGGGGGTGGGGAGTGG - Intergenic
1151666018 17:75545504-75545526 CCGGCTCGGGGAGTGTGGTGGGG + Intronic
1151714280 17:75823529-75823551 CCAGGTCGGGGAGCACTGGGTGG + Intronic
1151802063 17:76384564-76384586 CCACCCCCGGGAGCGCGGGGCGG + Intronic
1152390423 17:80000999-80001021 TCAGCTCTGGGAGCTTGGAGGGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152558209 17:81065145-81065167 GCAGCTCGGGGAGACTGGAGTGG + Intronic
1152722084 17:81928151-81928173 CCAACTCGGGGGTCCCGGAGCGG + Intergenic
1153741834 18:8137846-8137868 CCAGCTGGGGAAGAGTGGAGGGG - Intronic
1155540360 18:26863308-26863330 CCAGATCTGGGAGCGCGGCACGG + Intronic
1157485809 18:48085974-48085996 CCAGCTCAGGGAGAGAGGAGAGG - Intronic
1159770379 18:72541753-72541775 CCAGCCCGGGGAGAGGGGCGGGG - Intronic
1160635351 19:71048-71070 CGCGCTCGGGGAGGGCGCAGCGG - Intergenic
1160861222 19:1237939-1237961 GCAGCACCGGGCGCGCGGAGCGG - Exonic
1161077186 19:2291536-2291558 CCAGCGCGGGCAGCGCGGCCAGG + Exonic
1161400803 19:4065712-4065734 CCTCCCCGGGGAGCGCGGGGAGG + Intronic
1161751320 19:6099299-6099321 AAAGTTCGGGGAGCGGGGAGGGG - Intronic
1161846570 19:6714506-6714528 ACAGGTCGGGGAGAGCTGAGAGG - Intronic
1161973471 19:7596349-7596371 CCGGCTGCGGGAGCGCGGTGGGG + Intronic
1162514293 19:11138846-11138868 CCAGACTGGGGAGCGGGGAGGGG - Intronic
1162524228 19:11197881-11197903 CCAGCTCGGGGAGGGCGCGCGGG + Intergenic
1162560653 19:11416578-11416600 CCAGATAGGGGAGTGCGGGGAGG - Intronic
1162909664 19:13842281-13842303 CCAGGTCGGGGGGCTAGGAGTGG + Intergenic
1163243121 19:16076423-16076445 CCGGCCCGGGGGGCGGGGAGAGG + Intronic
1163334405 19:16661395-16661417 GCAGCTCGGGGGTCGCAGAGAGG + Intronic
1165058520 19:33194119-33194141 GGAGCGCGGGGAGCGCGGCGGGG + Intronic
1166672942 19:44722440-44722462 CCACCTCGGGAAGCCCCGAGCGG + Intergenic
1166830934 19:45639303-45639325 TAAGCCCCGGGAGCGCGGAGAGG + Intronic
1167269526 19:48499331-48499353 CCAGCTGGGGGACCTCGGAGGGG + Exonic
1168320733 19:55508045-55508067 CCAGGTCGGGGAGCTCTGTGAGG + Intronic
1168605070 19:57752117-57752139 CCAGCTCCGGGAGCCCGAGGCGG - Intronic
928606185 2:32947071-32947093 GGAGCCCGGGGAGCGGGGAGGGG - Exonic
932374788 2:71226510-71226532 CCAGCCCGGGGAGAGGGGCGGGG + Intronic
932752461 2:74380051-74380073 CCAGCTGGGGGAGGGGGTAGAGG - Exonic
935173299 2:100627292-100627314 CCAGGTCGGGGAGGAGGGAGAGG - Intergenic
935820236 2:106886716-106886738 CCAGCTAGGTGAGCCTGGAGCGG - Intronic
936566131 2:113583999-113584021 CGCGCTCGGGGAGGGCGCAGCGG + Intergenic
943669735 2:190648708-190648730 CCCGCTCCGGGCGCGGGGAGGGG - Intronic
944716052 2:202376731-202376753 CCGTCTCGGGGAGCCCGGACCGG + Intergenic
946431250 2:219628226-219628248 CAAGCTCTGGGAGCCCAGAGAGG + Intronic
948291280 2:236826753-236826775 GCAGCTCAGGGAGAGCGGATGGG + Intergenic
948487318 2:238289076-238289098 CCAGCTCGGGGAGCGCGGAGTGG + Intronic
948975506 2:241461273-241461295 CTGGCTTGGGGGGCGCGGAGGGG - Intronic
1168959856 20:1861608-1861630 CCAGCTCGCGGAGCGGGGCCTGG - Intergenic
1169200412 20:3706521-3706543 CCAGCTTGGGGTCCGCCGAGTGG + Exonic
1169274170 20:4221831-4221853 CGGGGTCGGGGAGCGCGGTGAGG + Exonic
1169326568 20:4681584-4681606 CCAGCTTGGGTAGGGCAGAGTGG + Intergenic
1172154170 20:32812008-32812030 CCAGCCTGGGCAGCACGGAGAGG + Intergenic
1172995742 20:39069337-39069359 CCAGCTCTGGGTGTGGGGAGGGG - Intergenic
1173808464 20:45941276-45941298 CCAGTTTGGGGATGGCGGAGTGG + Intronic
1175036428 20:56004967-56004989 GCAGCCCGGAGAGCGCGAAGCGG + Exonic
1175903400 20:62368646-62368668 CCACCTGGGGGAGGGGGGAGAGG + Intergenic
1176199819 20:63855210-63855232 CCAGCTCGGGAAGTGCGGGGAGG + Intergenic
1179885664 21:44313281-44313303 CCAGCTGGGGGAACGCACAGCGG + Intronic
1181711612 22:24695148-24695170 CCACCAGGGGGTGCGCGGAGTGG + Intergenic
1181898965 22:26136760-26136782 GCAGCCCAGGGAGCGCTGAGTGG - Intergenic
1183535282 22:38397834-38397856 GCACCTCGGGGTCCGCGGAGAGG + Intronic
1183607310 22:38873093-38873115 CCAGGTCGGGGGGCCGGGAGGGG - Intergenic
1183961430 22:41413880-41413902 CCGGCACGGCGGGCGCGGAGGGG + Intergenic
1185324791 22:50220342-50220364 CCAGCTCGGGCTGCGGGGAGGGG - Exonic
949482789 3:4510058-4510080 CCAGATCTGGGAGGTCGGAGAGG + Intronic
949562265 3:5213868-5213890 GCAACTGGGGGAGCGGGGAGGGG - Intronic
951898350 3:27632776-27632798 CCGGCCCGGGGGGCGGGGAGAGG + Intergenic
956814474 3:72895225-72895247 CCAGATGGGGTAGGGCGGAGTGG + Intronic
961144740 3:124584634-124584656 CCACCTTGGGAAGCGGGGAGGGG - Intronic
967115230 3:186331610-186331632 CCAGGTGGGGGAGCTGGGAGTGG + Intronic
967889225 3:194353280-194353302 CCAGCCCGGGGGCCGCTGAGGGG - Intergenic
968188978 3:196653653-196653675 GGAGCTCGGGGAGCGAGGCGGGG + Intronic
968190016 3:196660765-196660787 CCAGCTCGGTGAGCGCTCCGGGG - Exonic
968466906 4:756784-756806 CCTGCTGGGGGAGCGGGGTGGGG - Intronic
971244175 4:24913219-24913241 CCCGCGCGGAGAGCGCTGAGGGG - Intronic
973887659 4:55339454-55339476 GTAGCTAGGGGACCGCGGAGAGG - Intergenic
975997745 4:80336051-80336073 CCGGACCGGGGAGCGCGGGGCGG - Intronic
976733289 4:88284884-88284906 CCAGCGGGCGGAGCGCGGAGGGG + Intergenic
997297436 5:132776963-132776985 CCAGCTCGAGGACCCCGGCGCGG - Intronic
997551110 5:134754044-134754066 CCAGCCCGGGGGGCGGGCAGAGG - Intergenic
999732089 5:154482577-154482599 CCAGTCCGGGGGGCGCGGATAGG - Intergenic
1003115827 6:3283426-3283448 CCATCTCGGGGAGGGCCGGGGGG + Intronic
1004650192 6:17600622-17600644 CGAGCTCAGGAAGCGCGGGGAGG + Exonic
1005894157 6:30163801-30163823 CCATCTGGGAGAGCGCGGGGAGG - Exonic
1008952994 6:57181315-57181337 CCATCTCTGGGAGAGTGGAGAGG + Intronic
1013099725 6:106975716-106975738 GCCGCTCGGGGAGGGCGGTGGGG - Intergenic
1015149362 6:130020295-130020317 CCAGCTCGCGGGGCGCGCGGCGG - Intronic
1019750051 7:2723625-2723647 AGAGCTTGGGGAGCGCCGAGGGG - Intronic
1022989550 7:35694689-35694711 CCAGCTTGGGGGTCGCGGTGGGG - Exonic
1024919421 7:54542366-54542388 CCGGCTCGGGAAGTGGGGAGTGG - Exonic
1026771834 7:73206995-73207017 CCAGCGCGGGGAGTGAGGAGGGG + Intergenic
1027012702 7:74760391-74760413 CCAGCGCGGGGAGTGAGGAGGGG + Intronic
1027075338 7:75185662-75185684 CCAGCGCGGGGAGTGAGGAGGGG - Intergenic
1029628433 7:101734936-101734958 CCAGCTCAGGGATCTCTGAGAGG + Intergenic
1034487748 7:151376615-151376637 CCAACTAGGGGAGAGCGCAGGGG - Exonic
1035187569 7:157138641-157138663 CGTGCTGGGGGAGCGCGGCGAGG - Intergenic
1035300595 7:157894797-157894819 CCAGCTGGGGAAGTGGGGAGGGG + Intronic
1036195386 8:6708945-6708967 CCAGCTGTGGGGGAGCGGAGAGG - Intronic
1037390508 8:18387233-18387255 CCAGCGGGAGGAGCGCGGGGCGG - Intergenic
1037876767 8:22552329-22552351 CCAGCCCCGGGAGCGGGGAGAGG - Intronic
1044193190 8:89343360-89343382 ACAGCTGGGGGATGGCGGAGGGG + Intergenic
1044973772 8:97644333-97644355 CCACCGCGGGGAGGGCGGAGGGG - Exonic
1049292560 8:141812390-141812412 CCAGGGCGGGGAGGGCGGGGAGG + Intergenic
1049313415 8:141946158-141946180 GCAGCTTGGGGAGCTCGGTGGGG + Intergenic
1053482282 9:38424465-38424487 ACTGCTCGGCGGGCGCGGAGCGG - Intergenic
1053575546 9:39355505-39355527 CCAGCTTGGGGGGTGGGGAGGGG + Intergenic
1054097106 9:60914192-60914214 CCAGCTTGGGGGGTGGGGAGGGG + Intergenic
1054118513 9:61189821-61189843 CCAGCTTGGGGGGTGGGGAGGGG + Intergenic
1055404752 9:75962844-75962866 CCAGCTCTGGGTGTGCGCAGAGG - Intronic
1055987237 9:82063855-82063877 CCAGCTTGGGGGGTGGGGAGGGG - Intergenic
1059208292 9:112486863-112486885 GGAGCTCGGGGCGCACGGAGCGG + Intronic
1060992245 9:127855889-127855911 CCAGCTCAGGGAGCACTGATGGG - Intergenic
1062464650 9:136675676-136675698 TCAGCTCTGGGAGAGCAGAGGGG - Intronic
1185644611 X:1608279-1608301 CCAGCTCGGGCAGGGGTGAGCGG + Intergenic
1187648550 X:21375146-21375168 CCAGCTAGAGGGGCGCGGAGCGG + Intronic
1192699057 X:73448207-73448229 CCAGCTTTGGGGGCGGGGAGGGG - Intronic
1197252586 X:124230924-124230946 TTAGCGGGGGGAGCGCGGAGTGG - Intronic