ID: 948487363

View in Genome Browser
Species Human (GRCh38)
Location 2:238289226-238289248
Sequence TCCCGCGGCCCTGGCCGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948487363 Original CRISPR TCCCGCGGCCCTGGCCGCTG GGG (reversed) Intronic
900369677 1:2326037-2326059 TCCCGCCGTCCTGCCCGCTGTGG + Intronic
900456572 1:2777825-2777847 TCCTGCGGCCCTGGACACAGCGG + Intronic
900500811 1:3003650-3003672 TCCCGAGGCCCCTGCAGCTGTGG - Intergenic
900514670 1:3075892-3075914 TTCTGCCGCCCTGGCCTCTGGGG - Intronic
900532519 1:3161682-3161704 TCCCGCGGCCGGGCCTGCTGGGG - Intronic
900633270 1:3649858-3649880 GCCCCCGGCCCTGCCCGCCGGGG + Intronic
902641135 1:17767085-17767107 TCCCCCGTCCCTGACCACTGTGG - Intronic
903287489 1:22285983-22286005 TCCCCCGGCCCAGGCCCCAGAGG + Intergenic
903324774 1:22563578-22563600 ACCCTCGGGCTTGGCCGCTGCGG - Exonic
904500195 1:30908755-30908777 TCCTGCGGGCGCGGCCGCTGTGG - Exonic
904822669 1:33255999-33256021 TCCCGGGGCCCCGGCGGCCGTGG - Intergenic
905279500 1:36840039-36840061 TCCCTCTGTCCTGGCCCCTGGGG + Intronic
906109062 1:43311534-43311556 TCCCTGGGCCCTGGCCACTATGG + Intronic
907303081 1:53500330-53500352 TCTCGCGTGCCTGGCAGCTGGGG - Intergenic
908414843 1:63903071-63903093 TCCAGCCTCCCTGGCAGCTGAGG - Intronic
909629802 1:77759642-77759664 TCCCGCGGGCCAGGCCGTGGAGG - Exonic
912957258 1:114164274-114164296 TCCCTCTGCCTTGGCCTCTGAGG - Intergenic
913670970 1:121097297-121097319 TCCCCGGGCGCTGGCGGCTGCGG - Intergenic
914022733 1:143884718-143884740 TCCCCGGGCGCTGGCGGCTGCGG - Intergenic
914661220 1:149792662-149792684 TCCCCGGGCGCTGGCGGCTGCGG - Intronic
914702805 1:150149914-150149936 TCCCCCGGCCCGGTGCGCTGTGG - Intronic
916075154 1:161196374-161196396 TCCCGGGGACCTGGGCACTGAGG + Intronic
916782974 1:168056321-168056343 CGCCGAGGCCCTGGCAGCTGGGG - Intronic
919826497 1:201507031-201507053 TCGCGCGGCTCTGCCCGCCGCGG - Intronic
922824790 1:228510328-228510350 TTCCGTGGCCCTGGACACTGGGG - Intergenic
923631088 1:235649894-235649916 TCCCCCGGCCCTGGACGCTGGGG + Exonic
1066022819 10:31319742-31319764 TCCCGGGGGCCTGGGCGCTGAGG - Intronic
1069438529 10:68407298-68407320 TCCCGCCGCCGGGGGCGCTGTGG - Intergenic
1069719606 10:70541176-70541198 TGGTACGGCCCTGGCCGCTGAGG - Exonic
1074967679 10:118506917-118506939 CCCCGCAGCCCTGGCCTCTCTGG + Intergenic
1075077244 10:119359596-119359618 TGCTGTGGCCCTGGCTGCTGTGG + Intronic
1075711089 10:124530807-124530829 GCCCTCGGCCCTGTGCGCTGTGG - Intronic
1076423338 10:130349810-130349832 TCCAGCTACCCTGGCGGCTGAGG - Intergenic
1076705088 10:132297136-132297158 TCCTGCGCCTCTGGCTGCTGTGG + Intronic
1076721968 10:132396832-132396854 TCCCGGGGCTCCGGCCGCGGCGG + Intergenic
1076738415 10:132468774-132468796 TCACGCGGTCCTTGCCCCTGTGG + Intergenic
1077036805 11:499335-499357 TCCAGAGGCCCGGGCCTCTGTGG + Intronic
1079729423 11:23921403-23921425 TCCCCCACCCCTGGCAGCTGTGG - Intergenic
1083596518 11:63920460-63920482 CCCAGCGAGCCTGGCCGCTGTGG + Intergenic
1083747780 11:64745021-64745043 GCCCGCGGCCCTGGCCTCCCGGG - Intronic
1083921468 11:65783209-65783231 TCTCGCAGCACTGGCTGCTGGGG + Intergenic
1084526662 11:69702467-69702489 TCCCGCGGCCCCGCGCGCAGAGG - Intronic
1084561827 11:69909865-69909887 TCCCAGGGCCCTGGCTGCTCCGG - Intergenic
1084653272 11:70501252-70501274 TTCCTCGGCCCAGGGCGCTGAGG - Intronic
1085318768 11:75562028-75562050 CCCCGCAGCCCGGGCCGCCGAGG + Intergenic
1085517348 11:77119254-77119276 TGCCGCTGCCCTGGCTGCCGTGG + Intronic
1086333313 11:85775596-85775618 TCCAGCTGCTCTGGACGCTGGGG - Intronic
1087147452 11:94826175-94826197 TCCAGCTGCCCTGGAGGCTGAGG + Intronic
1087241828 11:95789546-95789568 GCCCGCGGCCCGGGCGGCGGCGG - Exonic
1091305317 11:134532611-134532633 CCCCTCGGCCCTGACCGCAGAGG - Intergenic
1091582645 12:1798504-1798526 ACTCACAGCCCTGGCCGCTGTGG - Intronic
1091782146 12:3220663-3220685 TCCTGCTGCCCTGGCCTGTGGGG + Intronic
1094495063 12:30984081-30984103 TGCAGGGGCCCTTGCCGCTGAGG - Intronic
1095752648 12:45729151-45729173 ACGCGCGGCCTCGGCCGCTGAGG - Intergenic
1096143753 12:49264458-49264480 GCCCGCTCCCCTCGCCGCTGAGG - Intronic
1097180639 12:57169809-57169831 TCCCAGTGCCCTGGCCTCTGGGG + Intronic
1098157745 12:67617826-67617848 TCCAGCCACCCTGGCCTCTGTGG + Intergenic
1099133464 12:78864537-78864559 TCCCAGGTCCCTGTCCGCTGTGG + Intronic
1100841201 12:98613160-98613182 TGCCGCAGCCCTGTCCCCTGAGG + Intergenic
1101409485 12:104457036-104457058 TGCCGCTGCGCTGGCCGCTGTGG - Exonic
1103085780 12:118061086-118061108 GCCCGCGGCCCGGGGGGCTGAGG - Intronic
1103562519 12:121800074-121800096 CCCGGCCGCCCGGGCCGCTGGGG - Intronic
1104568085 12:129903229-129903251 TCCCCGGGCCCTGGCGGCCGCGG + Intronic
1104947724 12:132424045-132424067 TCCCGCAGCCCAGGCCCTTGTGG - Intergenic
1104958377 12:132476801-132476823 TCCAGCCGTCCTGGCCTCTGGGG - Intergenic
1105849832 13:24323642-24323664 TCCCTCGGCCCTGGAGGCTGGGG - Intergenic
1110219626 13:73059373-73059395 TCCTGCGGCGCCGGCGGCTGGGG - Exonic
1112507732 13:99985199-99985221 CCCCGCCGCCCTGGCCCCTGGGG - Intronic
1113749849 13:112769428-112769450 ACCCGGGTCCCTGGCAGCTGTGG + Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1115235667 14:31207202-31207224 TCCCGGGGCCCTGCCGGCGGCGG - Exonic
1115399181 14:32938917-32938939 GCCCGCGGCCCGGGCCGCCCCGG - Intronic
1117147168 14:52846985-52847007 TCCCCTGGCCCGGGTCGCTGTGG + Intergenic
1117954304 14:61110924-61110946 TCCCTGGCCCCTGGCCCCTGGGG - Intergenic
1119646326 14:76351102-76351124 TCCCCCAACCCTGGCCACTGTGG + Intronic
1122270772 14:100567688-100567710 TCCGCCGGCCCGGGCCGCTGCGG - Intronic
1122414137 14:101540765-101540787 CCCAGAGGCCCTGGCGGCTGAGG - Intergenic
1122494040 14:102139590-102139612 TCCGCTGGCCCTGGCGGCTGCGG + Exonic
1122910688 14:104826482-104826504 TCCCGCGGCGCTGGGCGCCCTGG + Intergenic
1122977070 14:105175128-105175150 TCAAGCAGCCCTGGCCGCGGTGG - Intronic
1123002003 14:105300807-105300829 TCCCGCGGGCGCGGCCGTTGCGG - Exonic
1126102882 15:45130124-45130146 GCCCGCGGGCCTGGGCGCTCCGG + Intronic
1130511665 15:84594768-84594790 TCCCTCAGCAGTGGCCGCTGTGG + Intergenic
1132352541 15:101148903-101148925 TCCCTCAGCCCTGGCCCGTGGGG + Intergenic
1132670365 16:1099993-1100015 TCCCTCAGCCCTGGGCCCTGTGG - Intergenic
1132679464 16:1133817-1133839 ACCCCCGGCCCTGGCCTCTCTGG - Intergenic
1134045637 16:11098899-11098921 TCCCTCCACCCTGGCCTCTGAGG - Intronic
1134675844 16:16090116-16090138 TCCTGCGGCCCTGGAATCTGGGG + Intronic
1135610803 16:23865416-23865438 TCCAGCTGCCCTGGAGGCTGAGG - Intronic
1137666281 16:50251505-50251527 TCCCACGGCCCTGGCCTCTGCGG - Intronic
1138528410 16:57621764-57621786 TCCCTTGGCCCTGGCCTGTGAGG - Intronic
1139631116 16:68232463-68232485 TTCTGCGGCCCTGGGCGTTGAGG + Exonic
1140804033 16:78516174-78516196 TCCCGGGGCGCTGTCAGCTGTGG - Intronic
1141086016 16:81096177-81096199 CGCCGAGGCCCTGGCAGCTGGGG - Exonic
1142224533 16:88871148-88871170 CCCCTCGGCCCTGGCAGATGGGG + Intergenic
1143375417 17:6464202-6464224 TGCCGCGGCCCCGGCGCCTGGGG - Exonic
1143512737 17:7405193-7405215 TCCCGGGCCCCGGGCCCCTGGGG + Intronic
1145094020 17:20009373-20009395 GCCCGGAGCCGTGGCCGCTGGGG + Intronic
1145264191 17:21371679-21371701 TCCCGTGGCCCCGCCCTCTGCGG - Intergenic
1145965420 17:28913336-28913358 TGCTGCAGCCCTGGCCACTGTGG - Intronic
1147341389 17:39754859-39754881 TCCCGCCGCCCACGCCGCTCGGG - Intergenic
1147957218 17:44142617-44142639 TCCTGCGGCTCTGGCATCTGGGG + Intronic
1148388549 17:47253872-47253894 GGCCGCGGCCCCGGCCGCTCTGG + Intergenic
1148454920 17:47806071-47806093 CCCCGCTGCCCTCGCCCCTGGGG - Intergenic
1148579594 17:48734473-48734495 TCCCTCAGCCCTGGCCTCAGAGG - Intergenic
1151454459 17:74217767-74217789 TCCCGCTGCCATGGTCACTGCGG + Intronic
1151863265 17:76782124-76782146 TCCCCCGCCCCCGGCCCCTGTGG + Intergenic
1152037410 17:77881674-77881696 TCCCGCAGCTCTGGCCTCTGGGG - Intergenic
1152542043 17:80981436-80981458 GCCGGCGGCCCTCGCAGCTGGGG - Intergenic
1152587872 17:81197126-81197148 CCCTGCGGCCCTGCCCTCTGGGG + Intronic
1153015661 18:580387-580409 TCCTGCCGCTCTGGCCGCCGTGG - Exonic
1153285372 18:3450905-3450927 TCCCGCGGCCCCGGCCGCCTGGG - Intronic
1153495689 18:5696502-5696524 GCCCATGGCCCTGGCGGCTGGGG - Intergenic
1156836709 18:41563720-41563742 TCCCGTGGCCCTAGCCACAGGGG + Intergenic
1157338538 18:46758112-46758134 GCCCGCGGCGCTCGCCACTGAGG + Intronic
1160662155 19:306212-306234 GCCCGCGGCCCTGCCGGGTGTGG + Exonic
1160869573 19:1271053-1271075 GCCCGCGGCCCTGGGCGGGGGGG + Intronic
1160911089 19:1474114-1474136 TCCCGGGGCCCCGGAAGCTGGGG - Exonic
1160983107 19:1825809-1825831 TCCTGCTGGCCTGGCCTCTGCGG + Intronic
1161118546 19:2512704-2512726 TCCCTCTGCCCTGGCAGCGGGGG + Exonic
1161484171 19:4525815-4525837 TCCAGCGGCACTGGCGGCTGAGG - Exonic
1161925054 19:7293879-7293901 TCCCGCAGCCATGGCCACCGGGG - Exonic
1161973347 19:7596019-7596041 CCCCCGGGCCCGGGCCGCTGCGG + Exonic
1162301116 19:9845826-9845848 GTCCCCAGCCCTGGCCGCTGGGG + Intronic
1163250787 19:16125231-16125253 TCCTGCCCCCCGGGCCGCTGAGG - Intronic
1164620629 19:29694096-29694118 TCCCTCAGCCCTGCCAGCTGTGG + Intergenic
1166304117 19:41928094-41928116 TCCCGCAGCCATGGCCCCCGCGG + Intronic
1166996447 19:46721877-46721899 TCCCCCAGCCCTGGCCCCCGGGG + Intronic
1167410231 19:49339872-49339894 CCCTGGGGCTCTGGCCGCTGTGG + Intronic
1167613320 19:50517660-50517682 CCCCGCAGCCCCCGCCGCTGGGG + Exonic
1167638604 19:50668431-50668453 TGCTGCTGCCCTGGCTGCTGCGG + Exonic
1168324505 19:55531064-55531086 TCCTGCGGCCCAGGCTGCTCAGG + Intronic
1168649560 19:58084903-58084925 TCCGGCCGCCATGGCTGCTGTGG + Exonic
926427753 2:12754847-12754869 TCCCTCCGCCCTGGCTGCAGAGG + Intergenic
926914265 2:17878258-17878280 CCCCGCGGCCCCGGCGGCTGGGG - Intronic
927846770 2:26476301-26476323 CCCCGCTTCCCTGGCAGCTGGGG + Exonic
927847615 2:26479596-26479618 TTCCGGGGCCGAGGCCGCTGGGG + Exonic
935059351 2:99593989-99594011 GCCCGCGGCCGTGGCCGTGGCGG - Exonic
937904566 2:127046504-127046526 ACCCCCAGCCCTCGCCGCTGGGG - Intergenic
939990851 2:148875846-148875868 TCCCGCGGGGCTGGCCTCTCGGG + Intronic
942116751 2:172735807-172735829 TCCCGCGGCCTGGGGCGGTGGGG - Intronic
943658731 2:190535000-190535022 TCCCGCTGCCCTCGGCGCAGGGG + Intergenic
947791810 2:232872995-232873017 TCCTGGGGCCCTGGCCGCTTGGG + Intronic
947918653 2:233850919-233850941 TCCTGCCGCCCTGGAGGCTGGGG - Intronic
948487363 2:238289226-238289248 TCCCGCGGCCCTGGCCGCTGGGG - Intronic
1170870297 20:20199943-20199965 TCCCGCGGGCCTGGCAGATGGGG + Intronic
1171426277 20:25050703-25050725 TCCTGGTGCCCTGGCTGCTGTGG - Intronic
1172037303 20:32019108-32019130 TCCCCCGGCCCGGGCCTCCGCGG - Exonic
1172100706 20:32483031-32483053 CCCCGCGACCCTGGGCGCTCAGG + Intronic
1172512651 20:35511485-35511507 TGCCGTGGCCCAGGCCCCTGAGG + Exonic
1175873646 20:62219693-62219715 TCCCCAGCCCCTGGCCGCTGGGG - Intronic
1175931453 20:62495769-62495791 TCCCTAGGCTCTGGCCCCTGTGG + Intergenic
1175939617 20:62531998-62532020 TCCCCCGGCCCTAGCCCCTTTGG - Intergenic
1176014932 20:62926213-62926235 GCCCGCGCCCCAGGCCGCGGCGG + Intronic
1178623431 21:34196188-34196210 TCCCGCTGCTCTGGAGGCTGAGG + Intergenic
1178627857 21:34233242-34233264 TCCCACTGCCCTGGCTTCTGGGG + Intergenic
1179375571 21:40847190-40847212 TCCCCTGCCTCTGGCCGCTGGGG + Intergenic
1179397845 21:41057517-41057539 TCCTGTGTCCCTGGCAGCTGGGG + Intergenic
1179411663 21:41167786-41167808 TCCGTTGGCCGTGGCCGCTGGGG + Exonic
1181169724 22:21001329-21001351 CCCACAGGCCCTGGCCGCTGGGG + Exonic
1183476588 22:38039075-38039097 TCCCGCGGCCCTTGCCTCCCGGG + Intronic
1183978083 22:41524692-41524714 TCCTGCAGCTCTGGCCTCTGAGG + Intronic
1184036564 22:41920814-41920836 CCCCAGGGCCCTGGCCGGTGGGG - Intergenic
1184645671 22:45893349-45893371 ACCTGCGGCCCTGGCCGTCGCGG + Intergenic
1185147529 22:49147358-49147380 TCCCCCGGCCCGGGGCTCTGCGG + Intergenic
1185268641 22:49918384-49918406 TACCGCAGCCCCGGCCGCTACGG + Exonic
950628910 3:14268250-14268272 GCCCCAGGCCCTGGACGCTGAGG - Intergenic
950759237 3:15206158-15206180 TCCCGCGAGCCTGGCCTCGGCGG + Intronic
953179689 3:40584026-40584048 TCCACCAGCCCTGGCCGCTTTGG - Intergenic
953392841 3:42543812-42543834 TCCCCCCGCCATGGCCTCTGTGG + Intergenic
953423499 3:42773106-42773128 TTCCGCGCCCCCGGCAGCTGCGG + Intronic
954452605 3:50579853-50579875 CCCCGCGGCCCTGGATGGTGGGG + Exonic
963035164 3:141019507-141019529 GCCCGCGGCCCGGGCCCCTGTGG + Intergenic
963160830 3:142149417-142149439 CCCCGCGGGCCGGGCAGCTGCGG + Exonic
968473381 4:791945-791967 CCCCTCGGACCTGGCCGCTGAGG + Intronic
968618506 4:1593026-1593048 GCCCTCGGCCCTGGGCACTGGGG - Intergenic
968689055 4:1980757-1980779 TCGCGCGGCCGTGGCCTCTGAGG + Exonic
969660854 4:8526606-8526628 TCCCGCAGCCCAGGCCTCAGGGG + Intergenic
970394729 4:15654943-15654965 TGCCGAGGGCCTGGCGGCTGAGG - Intronic
976390004 4:84497667-84497689 CGCCGCGGCCGTGGCCGCCGTGG - Exonic
984888648 4:184473249-184473271 TCCCGGGGCGCGGGCCGCGGCGG - Intronic
985366581 4:189237485-189237507 TCACGGGGCCCTGTCTGCTGAGG + Intergenic
985842387 5:2317910-2317932 TCCCCTGGCCCTGGCTGCTGTGG + Intergenic
986152482 5:5140273-5140295 TCCCGCCGCCCCCGCCGCCGCGG + Intergenic
986184507 5:5423010-5423032 TCCCGGGGCCCCGGGCGCGGGGG + Intronic
994251529 5:97542133-97542155 CCCCGCCGCCCTGGGCACTGAGG - Intergenic
995106342 5:108381361-108381383 CTACGCGGCCCTGGCCGCCGAGG - Exonic
996790749 5:127290690-127290712 TGCCGGGGCAGTGGCCGCTGGGG - Intergenic
997891925 5:137684686-137684708 ACCCTAGGCCCTGGCCTCTGAGG + Intronic
998128762 5:139640686-139640708 TCCCCCAGCCCTGTCCACTGAGG - Intergenic
999693174 5:154166301-154166323 TCCCCCCGCCCCGGCCTCTGGGG - Intronic
1001617721 5:173056508-173056530 TCCCCCAGCCCAGGCCCCTGGGG - Intronic
1006359365 6:33578881-33578903 TCCCCAGGCCCTGGGCGGTGGGG - Intronic
1008109586 6:47477987-47478009 TCCCGCCGCCGTGGCTCCTGGGG + Exonic
1014947647 6:127516209-127516231 CGCCGCGACCCTGGCCGCTTTGG - Exonic
1017255693 6:152330563-152330585 TCCCACCGACCTGGCCGTTGAGG - Exonic
1018686313 6:166307447-166307469 GCCCGCGGCCCGGGGCCCTGCGG - Exonic
1019097733 6:169598720-169598742 TCACGCTTCCCTGGCCTCTGTGG - Intronic
1019114863 6:169751805-169751827 CGTCGCGGCCCTGGCCTCTGTGG + Intronic
1019485864 7:1288933-1288955 TCCTGCTGCCAGGGCCGCTGGGG + Intergenic
1019537890 7:1538438-1538460 TACCACGGCCCTGGCCGCTGCGG - Intronic
1022410245 7:30134754-30134776 TCCCGGGGCCCTGGCCATCGCGG - Intergenic
1022923817 7:35040624-35040646 TGCTGCTGCCCTGGCCCCTGGGG + Intergenic
1022997116 7:35768539-35768561 TGCCAAGGCCCTGGCAGCTGGGG - Intergenic
1025202475 7:56970757-56970779 TACCATGGCCCTGGCAGCTGTGG + Intergenic
1025669473 7:63606170-63606192 TACCATGGCCCTGGCAGCTGTGG - Intergenic
1025779010 7:64582770-64582792 CGCCGAGGCCCTGGCAGCTGGGG + Intergenic
1027250179 7:76393837-76393859 CCCCGCGGCCCAGGCGGCGGTGG + Exonic
1034784990 7:153917490-153917512 TCCCTCTTCCCTGGCCACTGAGG + Intronic
1036789505 8:11708681-11708703 TGCCGCGGCCCGGGAAGCTGCGG + Exonic
1037903829 8:22703772-22703794 GCCCGCGGCCCGGGCGGCGGGGG - Intergenic
1038773113 8:30502449-30502471 TCCTGTGGCCCAGGCCACTGGGG - Intronic
1040359954 8:46655715-46655737 ACCCACAGCCCTGGACGCTGTGG + Intergenic
1041355238 8:56993411-56993433 GCCCGCGGCCGCGGCCGATGGGG - Exonic
1041552437 8:59118099-59118121 CCCCGCGGCCCTGGCACCCGAGG + Intronic
1045575384 8:103414958-103414980 CTCCGCGGCCCTGGGCGCCGTGG - Exonic
1046452749 8:114415360-114415382 TCCCACGGCCTTGGCAGCTCTGG + Intergenic
1047615933 8:126562541-126562563 TCCCACAGCCCAGGCCTCTGTGG - Intergenic
1049433083 8:142574258-142574280 TCCGGCCGCCCTGGCTGTTGGGG - Intergenic
1049457477 8:142700885-142700907 TCCCGCCGGCCTGGCCTCCGGGG + Intronic
1049460805 8:142726893-142726915 TCCCGCGGCTTCGGCCGCGGAGG + Intergenic
1049557734 8:143291430-143291452 TCCAGCTGCTCTGGACGCTGAGG + Exonic
1049691754 8:143964426-143964448 TCCCGTGGCCCTCTCCCCTGTGG - Intronic
1049694300 8:143976107-143976129 TCCCGCGGCCCACGCCGCTGCGG - Intronic
1055750655 9:79501144-79501166 TCCTGTGGCCCAGGCCACTGTGG - Intergenic
1057297917 9:93860129-93860151 ACGGGCCGCCCTGGCCGCTGGGG - Intergenic
1059061287 9:111037859-111037881 GCCGGCGGCCCGGGCGGCTGCGG + Exonic
1059467294 9:114477078-114477100 TGACGCGGCCCGGGCTGCTGTGG + Intronic
1061123156 9:128656611-128656633 TGCAGCGGCCCTGGCCGCCCCGG + Exonic
1061377209 9:130233687-130233709 GCCCGCAGCCCTGGGAGCTGAGG - Exonic
1061892274 9:133629202-133629224 CCCCTCGGCCCTGGGCGCTGAGG + Intergenic
1062322008 9:135994643-135994665 TCCCTGTGCCCCGGCCGCTGGGG + Intergenic
1062494949 9:136827250-136827272 ACCGGCCGCCCTGGCTGCTGTGG - Intronic
1191626593 X:63277098-63277120 TCCCCCGGCACTAGCCTCTGTGG + Intergenic
1199086393 X:143634510-143634532 CCCCGCCGCCCTGGCCGCTTGGG + Intronic
1200213384 X:154356792-154356814 TCCCCCGGCCCGGGACGCAGAGG + Intronic