ID: 948487494

View in Genome Browser
Species Human (GRCh38)
Location 2:238290019-238290041
Sequence CTTCTTTACCTGGACTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948487492_948487494 6 Left 948487492 2:238289990-238290012 CCGCAGCATCTCTCTTTACTCTT 0: 1
1: 0
2: 2
3: 48
4: 473
Right 948487494 2:238290019-238290041 CTTCTTTACCTGGACTCACCTGG 0: 1
1: 0
2: 1
3: 9
4: 141
948487490_948487494 21 Left 948487490 2:238289975-238289997 CCAAGAAGCTGGAGCCCGCAGCA 0: 1
1: 0
2: 2
3: 42
4: 374
Right 948487494 2:238290019-238290041 CTTCTTTACCTGGACTCACCTGG 0: 1
1: 0
2: 1
3: 9
4: 141
948487491_948487494 7 Left 948487491 2:238289989-238290011 CCCGCAGCATCTCTCTTTACTCT 0: 1
1: 0
2: 3
3: 41
4: 354
Right 948487494 2:238290019-238290041 CTTCTTTACCTGGACTCACCTGG 0: 1
1: 0
2: 1
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948487494 Original CRISPR CTTCTTTACCTGGACTCACC TGG Intronic
902363137 1:15953083-15953105 TTTCTTTACTTGGAGTCCCCTGG + Intronic
906159848 1:43640003-43640025 CTTATTTACATGGACTAAACTGG + Intergenic
906522403 1:46475205-46475227 CTTCCTTCTCTGGCCTCACCTGG + Intergenic
909459409 1:75892957-75892979 CTTGTTTGCCTGCATTCACCTGG - Intronic
910022844 1:82613564-82613586 GCTCTTTCCCTGGACTCAGCTGG - Intergenic
910573214 1:88729393-88729415 TTTCTTTTCCTGGTCTCAACTGG + Intronic
911722684 1:101208426-101208448 TTTCTTCACCTGGACTGCCCTGG + Intergenic
912207777 1:107527182-107527204 CTTCTTTGTTTGGACTTACCAGG - Intergenic
912492557 1:110070266-110070288 CTTCCTTACCCGGGCCCACCCGG - Intronic
913093671 1:115496829-115496851 CTTCTTGGCCTTAACTCACCTGG + Intergenic
913199911 1:116487599-116487621 CTTCTCTTCCTGGGCTCACAGGG - Intergenic
913247819 1:116885683-116885705 CTTCATTACCTGGAAGCTCCTGG + Intergenic
915938647 1:160104242-160104264 CTTGTCCACCTGGACTCTCCAGG + Intergenic
917518425 1:175728109-175728131 CTTCTTTTCTTGTACTCATCTGG - Intronic
917786116 1:178459065-178459087 CTCCTTTACCTTGACTCTACAGG - Intronic
918200305 1:182260085-182260107 GTTCTTTCCCTGCATTCACCTGG + Intergenic
920743200 1:208600702-208600724 CTCCTCAACCTGCACTCACCTGG + Intergenic
921599003 1:217087556-217087578 CTTCTTTACCGGGAATTGCCTGG - Intronic
923401978 1:233624471-233624493 TGTCTTCACCTGGCCTCACCTGG + Intronic
1064360713 10:14661785-14661807 CTGGTTTACCTGTTCTCACCTGG - Intronic
1068529645 10:58170987-58171009 ATTGTTTACATGGACTCACTAGG + Intergenic
1071470692 10:85982098-85982120 CTTCATTCCCCAGACTCACCTGG - Intronic
1076551883 10:131285066-131285088 TTTCTTTTACTAGACTCACCTGG - Intronic
1076785220 10:132746144-132746166 ACTCTCTACCTGGAATCACCAGG - Intronic
1078553067 11:12293713-12293735 CATCTTCACCAGGGCTCACCAGG - Exonic
1083801233 11:65047628-65047650 CTTCTGTCCCTGGGCTTACCTGG + Exonic
1083825006 11:65196120-65196142 ATTCTTTACCTGGCCTAAACAGG - Intronic
1083948582 11:65940921-65940943 CCTCTTTTACTGGACTCACCAGG - Intergenic
1084288380 11:68146399-68146421 CTTCTCTGCCAGGACTCACTGGG + Intergenic
1085920197 11:80945502-80945524 CTTGTATTCCAGGACTCACCTGG + Intergenic
1086430315 11:86731157-86731179 CTTATTTAACTAGACTGACCAGG + Intergenic
1089614966 11:119690117-119690139 CTTCTGTACCTGGACTTAGGCGG + Intronic
1089808548 11:121113425-121113447 CGTCTTTTCCTGGAGTCACTGGG - Intronic
1090991280 11:131819153-131819175 CTTCTTCACCTGGACTCATGGGG - Intronic
1091053474 11:132396367-132396389 TTTTTCTTCCTGGACTCACCAGG + Intergenic
1091956539 12:4648726-4648748 CTTCTTCCTCCGGACTCACCAGG + Exonic
1094372174 12:29750465-29750487 CTTATTTACCAGGACACTCCTGG + Intronic
1099894502 12:88628024-88628046 CTCCTTTACTTGGAATCACTTGG - Intergenic
1101722380 12:107361075-107361097 CCACTGTACCTGGCCTCACCTGG + Intronic
1103643436 12:122371615-122371637 CATCTTTACCTGGACTTGCATGG - Intronic
1113846073 13:113392522-113392544 CCTCTTTACCTGAACTGCCCAGG + Intergenic
1117102892 14:52368700-52368722 CTTCCTTAAGAGGACTCACCTGG - Intergenic
1117474357 14:56078775-56078797 CTTCATCACCTGGTCACACCAGG + Intergenic
1118976893 14:70685685-70685707 CTTCTTGACCCTGACTCACGTGG - Intergenic
1122233724 14:100320463-100320485 CTTATTTACGTGGTCTCCCCAGG + Intergenic
1126323640 15:47451147-47451169 CTTCTTTCACTGGACAAACCAGG - Intronic
1129942354 15:79509561-79509583 CTTCTTTACCTGGCATTCCCTGG + Intergenic
1130878238 15:88032602-88032624 TTTCTTCACCTGGGCTCAGCAGG - Intronic
1131853979 15:96572636-96572658 CTTCTTTGCATGGTGTCACCTGG + Intergenic
1136132586 16:28233109-28233131 CTTCCTCAGCTGAACTCACCAGG - Intergenic
1136299141 16:29321422-29321444 CTTCCTCACCCGGAGTCACCAGG - Intergenic
1136693890 16:32058695-32058717 GGTCTTTTCCTGGACTCATCAGG - Intergenic
1137507189 16:49064380-49064402 CTTCTTTGTCTGGTCTCTCCAGG + Intergenic
1139706296 16:68743004-68743026 CTTCTTTACATGGCCTTGCCGGG - Intronic
1140658115 16:77161049-77161071 CTTCTTTACCTCAATTAACCAGG - Intergenic
1141079969 16:81041829-81041851 CTTCTTTTCCTGGATTCTGCAGG - Intronic
1142060834 16:88027977-88027999 CTTCTTCACCCGGAGTCACCCGG - Intronic
1142156864 16:88536527-88536549 CTTCTTTGCCTGCACTCACCAGG - Exonic
1144429742 17:15180470-15180492 CTTCATTACTTGGACTCTCGGGG - Intergenic
1145037569 17:19552050-19552072 CCTGTTTACCTGGACTTATCTGG - Intronic
1146591282 17:34129996-34130018 GTTCTCTAATTGGACTCACCTGG - Intronic
1148116137 17:45176159-45176181 CTTCACTGCCTGGACTCACAGGG - Intergenic
1149491681 17:57089539-57089561 GTTCTTGACCTGTACTGACCAGG - Intronic
1152705777 17:81842927-81842949 CTGCTTTACCTGGACTCTGATGG - Intergenic
1153986542 18:10356171-10356193 ATGCTTTGCTTGGACTCACCTGG - Intergenic
1159794832 18:72829498-72829520 CAACTTTACCTGGACACACCTGG + Intronic
1160008217 18:75084095-75084117 CTTCCTGATCTGGGCTCACCAGG - Intergenic
1163173373 19:15548425-15548447 CCTTTCCACCTGGACTCACCCGG - Intronic
927691769 2:25213411-25213433 CTTCTTGAACTGGAGTCACTCGG - Intergenic
929575989 2:43052243-43052265 ATTCTTTGGCTGGCCTCACCTGG + Intergenic
932394192 2:71428638-71428660 CTGCTTTACCTTCACTCATCTGG - Exonic
934565398 2:95337393-95337415 CTTCTTTTCCTGGATTCAAGGGG + Intronic
934604299 2:95682572-95682594 TTCCTTTCCCTGGACTCCCCTGG + Intergenic
934904589 2:98187546-98187568 CTTCTTTACCAGGACTTTCCAGG + Intronic
936445790 2:112594122-112594144 CATCTTTACATGGACTCTGCAGG + Intergenic
939857323 2:147374956-147374978 TTTCTTTAGCTGGACTAACTTGG - Intergenic
942457480 2:176148091-176148113 CTTCTTAACCTGGTCTAGCCTGG + Intergenic
942519002 2:176783400-176783422 CTTCCTTACCAGGTCTAACCTGG + Intergenic
942756255 2:179344817-179344839 CTTCTTTACCTTGCTTCACGGGG - Intergenic
943662051 2:190569654-190569676 CCTCTTTTCCTAGACTCACAAGG + Intergenic
943894890 2:193344586-193344608 ATTCTTTACCTGGAATCACTTGG + Intergenic
946346789 2:219117399-219117421 CCTTCTTGCCTGGACTCACCTGG + Intronic
948487494 2:238290019-238290041 CTTCTTTACCTGGACTCACCTGG + Intronic
1169965366 20:11211847-11211869 CTGCCCTACCTGGACTCAACAGG - Intergenic
1171009206 20:21498882-21498904 TTTCCTTTCCTTGACTCACCCGG + Intergenic
1172705213 20:36877857-36877879 CTCCTGTCCCTGGACACACCAGG + Intronic
1174841572 20:53906066-53906088 AATCTTTACCTGGGCTCACAAGG - Intergenic
1175731373 20:61356357-61356379 CTTGTTTACCTGGACACTCTGGG - Intronic
1176364981 21:6027317-6027339 CTCCTTTACTTGAAGTCACCCGG + Intergenic
1179758537 21:43511228-43511250 CTCCTTTACTTGAAGTCACCCGG - Intergenic
1182147981 22:28008898-28008920 CTTCTTGCCCTGGACTGATCTGG - Intronic
1183047427 22:35231189-35231211 CATCTTGACCTGTACTCCCCAGG - Intergenic
1183408164 22:37640377-37640399 CTGCTTTTCCTGGACTCAGGTGG + Intronic
1184446518 22:44550710-44550732 CTTCTCTTCCTGGACTGAACTGG - Intergenic
953912730 3:46901082-46901104 CTTCTCCACCTGGACCTACCCGG - Exonic
954953138 3:54492498-54492520 CAGCTTTCCCTGGCCTCACCCGG + Intronic
956770266 3:72520040-72520062 CTTCTGTACTTGCACTCACGAGG - Intergenic
957185957 3:76941412-76941434 ATTCTTCACCTAGACTCACAAGG + Intronic
959330218 3:104996171-104996193 CATCATTACCTGGAGTCACCAGG - Intergenic
961542302 3:127608414-127608436 CCACTTTGCCTGGACTCTCCTGG - Exonic
961798000 3:129423762-129423784 CTCCTTAACCTGGCCCCACCTGG + Intronic
965073742 3:163950475-163950497 CTTGTTTACCTGGAACAACCTGG + Intergenic
965776698 3:172239356-172239378 CTTCTCTTCCTGGAATGACCTGG + Intronic
965789400 3:172371736-172371758 GTTCTTAGCCTGGACTCACCAGG + Intronic
972714112 4:41628841-41628863 CCTCTTTACCTGGATTGACAGGG - Intronic
975281853 4:72569857-72569879 CGTCCTTTCCTTGACTCACCCGG + Intergenic
976242823 4:82976215-82976237 TTTCTTCACCTGGACCCATCAGG - Intronic
978737224 4:112097682-112097704 CTTTTTAACCTGGAATCTCCAGG - Intergenic
978990630 4:115077796-115077818 ATCCTTTATCTGGACTCACAGGG + Intronic
984122980 4:175769472-175769494 TTTGTTTCCCTGAACTCACCTGG - Intronic
988827230 5:34950422-34950444 CTTCTTTCCCATGACTGACCAGG + Intronic
993869799 5:93239244-93239266 CTACTTTGACTGGACTGACCAGG - Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
996428192 5:123337829-123337851 CTTCTTTTCCTGTACTGACTGGG + Intergenic
1001068773 5:168564778-168564800 CTTCTTTACTTGGCCTGACATGG + Intronic
1004017412 6:11744675-11744697 CTTCTTTGCCTGGCTTCACATGG + Intronic
1004389533 6:15198464-15198486 CTTTTTTTTCTGGACTCACTTGG - Intergenic
1006369322 6:33634229-33634251 CTTCTTTATCTACACACACCAGG + Intronic
1006579579 6:35069063-35069085 CTTCCTTCCCTGGGCTCTCCAGG + Intronic
1006639422 6:35481786-35481808 CTCCGTTACCAGGACTCACTTGG + Intronic
1006845205 6:37056752-37056774 GTGATTCACCTGGACTCACCTGG + Intergenic
1012224995 6:96693934-96693956 CTTTTTTGCCTGGCCTCACAGGG + Intergenic
1014233091 6:118925806-118925828 CTTGTTTACCTGGCCTTAACTGG + Intronic
1015636118 6:135276101-135276123 CTTCTTTAGATCAACTCACCAGG - Intergenic
1016921588 6:149300177-149300199 ATCCCTTACCTGGATTCACCAGG - Intronic
1020082753 7:5295612-5295634 CTTCTGTGCCTGGACTGGCCCGG + Intronic
1022244085 7:28540874-28540896 CTTCTTTTCATGGACCCACATGG + Intronic
1023440410 7:40179592-40179614 GTTCTTTTGCTGGATTCACCTGG + Intronic
1026930326 7:74220062-74220084 GGTCTTGACCTGGGCTCACCAGG - Intronic
1029221349 7:98993228-98993250 CGCCCTCACCTGGACTCACCAGG + Intronic
1029506893 7:100968197-100968219 CTTCTCTTCCTGGTGTCACCTGG + Exonic
1031623899 7:123970068-123970090 TTTCTTTACATGGAGTCTCCTGG + Intronic
1032896314 7:136254622-136254644 CTTCCTTTCCTGGACTCATGTGG + Intergenic
1035042359 7:155938526-155938548 CTTCTGCACCTGGATTCAGCAGG - Intergenic
1038795358 8:30704733-30704755 CTTCTTTCCCTGCACCCTCCAGG + Intronic
1041801328 8:61803698-61803720 CTTCTTTCCCTGGACTGTCATGG + Intergenic
1042467546 8:69145096-69145118 TTTCTCTCCTTGGACTCACCAGG - Intergenic
1043368902 8:79568095-79568117 CTTTTTTTCCTGGATTCACTTGG - Intergenic
1044704297 8:94993720-94993742 CTTCTTTAGCTTGTCTTACCTGG - Intronic
1046771168 8:118118098-118118120 CTTCCCTTCCTGGACCCACCTGG - Intergenic
1048034685 8:130666198-130666220 CCTCTTTTCCTGGCCTCCCCTGG - Intergenic
1048722385 8:137340736-137340758 CTTCTTTACCAGCACTCAAAAGG + Intergenic
1055179130 9:73361406-73361428 CTGCTTTACCTGGAGTCAATAGG - Intergenic
1055251902 9:74317734-74317756 CTTCTTTAGCATGACTTACCTGG - Intergenic
1057214353 9:93219844-93219866 CATCTGCACCTGCACTCACCTGG - Intronic
1058988573 9:110232959-110232981 CTTCCTCAACAGGACTCACCTGG + Intergenic
1059001550 9:110353965-110353987 CTTCCTCAACAGGACTCACCTGG - Intergenic
1060413883 9:123417417-123417439 CTTCTCTAACTTGCCTCACCAGG - Intronic
1193077732 X:77373467-77373489 CTTCTTCTGCTGGACTCTCCTGG + Intergenic
1195274349 X:103266849-103266871 CCTCTTTCCCTGGACACACCTGG + Intergenic
1198327752 X:135591069-135591091 CTGCTTAACATGGAATCACCTGG - Intergenic
1201920535 Y:19229085-19229107 CTTCATTACCAGTACCCACCAGG - Intergenic