ID: 948491270

View in Genome Browser
Species Human (GRCh38)
Location 2:238314858-238314880
Sequence AGATCCTTACGGAGGCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948491270_948491280 -10 Left 948491270 2:238314858-238314880 CCTCCCCGCCTCCGTAAGGATCT No data
Right 948491280 2:238314871-238314893 GTAAGGATCTCGGTGGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948491270 Original CRISPR AGATCCTTACGGAGGCGGGG AGG (reversed) Intergenic
No off target data available for this crispr