ID: 948492965

View in Genome Browser
Species Human (GRCh38)
Location 2:238325458-238325480
Sequence ATTTCTCTGCTGCATGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948492959_948492965 24 Left 948492959 2:238325411-238325433 CCTTAACGGATGGGATTTTTTGT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 948492965 2:238325458-238325480 ATTTCTCTGCTGCATGTGGTTGG 0: 1
1: 0
2: 1
3: 22
4: 244
948492963_948492965 -2 Left 948492963 2:238325437-238325459 CCTGGTAGTGTGGCTTGTGTCAT 0: 1
1: 0
2: 1
3: 2
4: 140
Right 948492965 2:238325458-238325480 ATTTCTCTGCTGCATGTGGTTGG 0: 1
1: 0
2: 1
3: 22
4: 244
948492958_948492965 29 Left 948492958 2:238325406-238325428 CCTCGCCTTAACGGATGGGATTT 0: 1
1: 0
2: 0
3: 1
4: 204
Right 948492965 2:238325458-238325480 ATTTCTCTGCTGCATGTGGTTGG 0: 1
1: 0
2: 1
3: 22
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948492965 Original CRISPR ATTTCTCTGCTGCATGTGGT TGG Intronic
900210669 1:1454330-1454352 GTGTCTCTGCTGCAGGTGGCTGG + Exonic
900216542 1:1485001-1485023 GTGTCTCTGCTGCAGGTGGCTGG + Exonic
900223623 1:1522729-1522751 GTGTCTCTGCTGCAGGTGGCTGG + Exonic
900239298 1:1607023-1607045 AATTCTCTGCTCCAGGTGGAGGG - Intergenic
900626845 1:3612193-3612215 CTTTCTGTGCTGCATGTTCTTGG + Intergenic
901466303 1:9423509-9423531 ATTTCTCTACAGCACATGGTTGG + Intergenic
902336034 1:15755534-15755556 ACTTCTATCCTTCATGTGGTAGG + Intergenic
902847071 1:19119843-19119865 ATGACTATGCTGCATCTGGTAGG - Intronic
903092787 1:20937408-20937430 CTTTATCTGCTGCATGTCTTGGG - Intronic
904373275 1:30064388-30064410 ATTTCTCTGCAGTGTGTGGGTGG + Intergenic
905475252 1:38221857-38221879 ATTTATCTGCTGCTGGTGGAAGG + Intergenic
908027394 1:59967440-59967462 CTGTCCCTGCTGCTTGTGGTAGG - Intergenic
908319897 1:62968970-62968992 ATTTCTGTGCTGAATGTGCTGGG - Intergenic
910798438 1:91121366-91121388 ATATCTCTGTAGCTTGTGGTTGG + Intergenic
911935851 1:103970838-103970860 ATATCTCTGTTGGATCTGGTTGG + Intergenic
912241075 1:107909565-107909587 AATTCTATGCTGTATGTGATGGG - Intronic
912644265 1:111376695-111376717 ATTTCTGTGAAGCATGTCGTTGG - Intergenic
912679022 1:111716758-111716780 ATTTTTGTGCTGAATGTTGTAGG + Intronic
915342675 1:155184989-155185011 GTTTCTGTGCTGGGTGTGGTAGG + Intronic
915910563 1:159912532-159912554 ATTTCTTTCCTGCCTGGGGTGGG - Intergenic
916224262 1:162474136-162474158 TTTTTCCTACTGCATGTGGTAGG - Intergenic
916382560 1:164228683-164228705 ATCTCTATCCTGCGTGTGGTTGG - Intergenic
917306702 1:173633459-173633481 ATTTCTGTGAAGCATGTCGTTGG - Intronic
918227884 1:182502911-182502933 ATTTCTCTGATCAATGAGGTTGG - Intronic
919962643 1:202487008-202487030 ATTTCTTTCATGAATGTGGTAGG + Intronic
920729012 1:208465129-208465151 ATTTGTCTGCAGCATGAGGCAGG - Intergenic
920860319 1:209700319-209700341 ATTTCTGTGCACCATGTGGAAGG + Intronic
923892534 1:238231984-238232006 ATTTCTCAGGTGCCTGTGGTAGG + Intergenic
924793803 1:247277593-247277615 ATTTCTCTGCTGTATGTCCTAGG - Intergenic
1062959243 10:1560356-1560378 GATTTTCTGCTGCATGTGATGGG - Intronic
1063829646 10:9937204-9937226 ATTTCTCTATTGAATGTGATGGG - Intergenic
1065785751 10:29212828-29212850 AGTTCTCTGCTACTTGTGGGAGG - Intergenic
1066435887 10:35396559-35396581 ATTTCTCTGTTGCGTGTTCTCGG + Intronic
1067201627 10:44177303-44177325 ATTGCTCTGCTGCATGTAGACGG - Intergenic
1068005335 10:51386618-51386640 ATTTCTCTCTTGAATGTGGGTGG - Intronic
1068536925 10:58250207-58250229 ATTTCTCTGATGAATGTCTTTGG + Intronic
1068693019 10:59937370-59937392 GTTTCTCTACTGCATTTGGTTGG - Intergenic
1068697537 10:59983646-59983668 ATTTCTCTGATACATGAGCTAGG + Intergenic
1069996836 10:72347521-72347543 ATTTTTCTAATGCAAGTGGTTGG + Intronic
1070447234 10:76517903-76517925 ATTTCTCTGCTTCACTAGGTTGG - Intronic
1071923178 10:90374580-90374602 ATTTCCCAGCTGCATCTAGTCGG + Intergenic
1075281021 10:121138507-121138529 ATTTCTCTGCTGATGGTGTTTGG - Intergenic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1075957311 10:126535229-126535251 ATTTGTCAGCTGGGTGTGGTGGG + Intronic
1076774615 10:132687829-132687851 CTGTCTCTGCTGCGTCTGGTGGG - Intronic
1077598398 11:3554427-3554449 ATTTCTCTGTTGTATGTGTGGGG - Intergenic
1079018624 11:16890376-16890398 TTTTGTATGCAGCATGTGGTTGG - Intronic
1083517344 11:63272603-63272625 ATTGCCCAGCTGCATGTGTTAGG - Intronic
1084254477 11:67930303-67930325 ATTTCTCTGTTGTATGTGTGGGG - Intergenic
1086101110 11:83100861-83100883 TTTTCCCTGGTGAATGTGGTAGG - Intergenic
1086499915 11:87442026-87442048 ATTTCTGATCTCCATGTGGTTGG - Intergenic
1086547406 11:88014189-88014211 ATTTCTATACTCCATATGGTAGG + Intergenic
1088536625 11:110868433-110868455 TTTGGTCTGCTGCATGTGGGTGG + Intergenic
1089011504 11:115135795-115135817 TTTTCTCTGATGCTGGTGGTTGG - Intergenic
1090307171 11:125701502-125701524 ATAACGCTGCAGCATGTGGTAGG - Intergenic
1091360047 11:134972024-134972046 GTTTCCGTGCTCCATGTGGTTGG - Intergenic
1091589345 12:1834248-1834270 TTTTCTCTTCTGCATGTAGGGGG + Exonic
1096521639 12:52187877-52187899 ATTTCTCTGCTGCTCATGGGTGG - Intronic
1097034861 12:56117159-56117181 AATTATCTGCTGCTTGTGATCGG + Intronic
1097606004 12:61755182-61755204 ATTTCTTTTCTAAATGTGGTAGG + Intronic
1099005128 12:77226606-77226628 AGTTCTCTGCATCATGTGGTTGG - Intergenic
1099919889 12:88944173-88944195 CTCTCTCTGCGGCATGTAGTAGG - Intergenic
1106907727 13:34426052-34426074 ATGGCTCTGCAGCATGTGGCTGG - Intergenic
1107140678 13:36995530-36995552 ATTTCTCTTCTTCATGTCGATGG + Exonic
1108530855 13:51325696-51325718 ATTGCCCTCCTGCATGTGGGTGG + Intergenic
1108786787 13:53912820-53912842 ATTTCTATGGTGCATCTGCTGGG + Intergenic
1109149369 13:58824822-58824844 AGTTTTCTGCAGCATGTGGTTGG - Intergenic
1109730895 13:66412311-66412333 ATTAATCAGCTGGATGTGGTGGG - Intronic
1111232833 13:85365538-85365560 ATTTCTCTTCTGAATGTTTTAGG + Intergenic
1111834468 13:93370680-93370702 ATTTGCCTGCTGTATGTGGCAGG - Intronic
1115193952 14:30776553-30776575 ATTTATCTGGTGCATATGATGGG - Intergenic
1116367736 14:44088905-44088927 ATTTCCCTGTTGCATGTTATTGG + Intergenic
1118910620 14:70059396-70059418 ATTTCACTGCTTCATTTGCTAGG + Intronic
1120214993 14:81672193-81672215 CTCTCTGTGCAGCATGTGGTAGG - Intergenic
1122417966 14:101559482-101559504 ATTTCTCTGCTGTCTGGGGCAGG - Intergenic
1125037772 15:35146349-35146371 ATTTCTTTGCTGAATGTTATGGG + Intergenic
1127059703 15:55169803-55169825 ATTTCTCTGCTCTCTGCGGTGGG - Intergenic
1129538430 15:76332778-76332800 AGTTCTCAGATGCCTGTGGTGGG + Intergenic
1130144693 15:81265026-81265048 TTTTCCCAGCTGGATGTGGTAGG + Intronic
1130628364 15:85539370-85539392 AATTCTCAGCTGCATGTGAAAGG - Intronic
1138226193 16:55297382-55297404 ATTTCTCTGCTCCATTTGCTTGG + Intergenic
1139136840 16:64214842-64214864 ATTTCTCTAGTGTCTGTGGTTGG - Intergenic
1143844282 17:9761947-9761969 ATTTCTCTGCTGTATATAATAGG - Intergenic
1144525214 17:15983565-15983587 ATGTCACTGCTGGATGTTGTGGG - Intronic
1145977750 17:28993981-28994003 TTTTGTCTGCTGCATCTGGGAGG + Intronic
1146725847 17:35155183-35155205 ATTTCTCTACTGCATGGGATAGG + Intronic
1148755540 17:49971296-49971318 ATTTCTCTGCTGGAACTGGTGGG + Intronic
1148940617 17:51207430-51207452 ATTTCTCTTATTCATGTTGTTGG - Intronic
1150615149 17:66764675-66764697 ATTTCCCTGCTGCACATGGGAGG - Intronic
1151266696 17:72962100-72962122 ATTTCTCTGCTTCCTGCTGTGGG + Intronic
1151620761 17:75243448-75243470 CTGTCTCTTCAGCATGTGGTAGG + Exonic
1151931467 17:77234740-77234762 AAATCTCTGATGCATCTGGTGGG + Intergenic
1152494926 17:80664366-80664388 GATTCTCTGCTTCATGTGCTAGG + Intronic
1153562856 18:6388836-6388858 ACTGCTCTGTTGCATGTGTTGGG - Intronic
1154495070 18:14949985-14950007 GTTTCCGTGCTCCATGTGGTTGG + Intergenic
1156003165 18:32408686-32408708 ATTTCTGTGCTGCATGTTTAAGG - Intronic
1157327937 18:46682273-46682295 ATTTCTCTGCCCCATGTGTCTGG - Intronic
1157763765 18:50282816-50282838 GTTTTGGTGCTGCATGTGGTAGG - Intronic
1158889447 18:61859394-61859416 ATGTCTCTGACGCATGTGTTGGG - Intronic
1159400526 18:67927216-67927238 ATTCATCTCTTGCATGTGGTTGG - Intergenic
1160117507 18:76094963-76094985 GTTTCTTTGCTGCATATAGTAGG - Intergenic
1161903469 19:7137194-7137216 AATTCTCTCTAGCATGTGGTGGG + Intronic
1164444036 19:28301802-28301824 TTTTCTCTGCTGCCTCTGCTGGG + Intergenic
1164868137 19:31622044-31622066 TTTTCTCTGCTGCATTCTGTTGG + Intergenic
1165141637 19:33703345-33703367 ACTTCCCTGCTGCCTGTGTTAGG - Intronic
925044308 2:760120-760142 ATTTTTCTGCTCCCTGTGGTTGG + Intergenic
925176776 2:1790729-1790751 AGTTTTCTGCTGGATCTGGTGGG - Intronic
925511135 2:4626540-4626562 ATTTCTCTCCCTAATGTGGTGGG - Intergenic
927926471 2:27017169-27017191 AATTCTCTGCTGCACCTGCTAGG - Intronic
928569186 2:32585887-32585909 ATTTTTCTGCTCTATGTAGTGGG + Intronic
928740273 2:34343526-34343548 ATTTCTCTTCTTTTTGTGGTGGG + Intergenic
931760350 2:65411329-65411351 ATATCCCTGCTGCTTGCGGTGGG + Intronic
932027720 2:68152816-68152838 ATTTTTGTTCTGCATGTGGGTGG + Intronic
933565247 2:83942525-83942547 CTGGCTCTGCTGGATGTGGTGGG + Intergenic
933818499 2:86088455-86088477 GTTTCTCTGCTGCATTTGGGAGG - Intronic
934980082 2:98832367-98832389 ATGTCTCTGCTGCACGACGTGGG - Exonic
935529394 2:104214314-104214336 GTTGCTCTGCTACATGTGTTGGG + Intergenic
935675108 2:105588374-105588396 AATTCTCTGCTGCAGGTGGATGG + Intergenic
936026491 2:109034746-109034768 CCTTCTCTGCTGCTTATGGTGGG - Intergenic
936549228 2:113420985-113421007 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
937379569 2:121364326-121364348 ATTTCTCTTCTCCATGTGGATGG + Intronic
942975974 2:182018219-182018241 GTTTCTATGCTGGATGTGTTAGG + Intronic
944548771 2:200825577-200825599 CTTTGTCTGTTGCCTGTGGTGGG - Intergenic
946160902 2:217835320-217835342 TTTTCTCTCCTGCCTGTGGCAGG - Intronic
947100744 2:226618598-226618620 ATGTTTCTGCTTCATGTTGTTGG - Intergenic
947479411 2:230484574-230484596 ATTTATTTCCTGCATGTGGGTGG + Intronic
948492965 2:238325458-238325480 ATTTCTCTGCTGCATGTGGTTGG + Intronic
1169667150 20:8050306-8050328 AGCTCTGTGCTGCATTTGGTGGG + Intergenic
1170835978 20:19885072-19885094 ATCTCCGTGCTGCATGAGGTTGG - Intergenic
1173052212 20:39574421-39574443 TTTTCTCTGCTGCTTTTGATTGG - Intergenic
1174109200 20:48186236-48186258 AGTTCTCTTCTGCACGTGGCTGG - Intergenic
1174895959 20:54450164-54450186 ATTTCTCTGATCCTTGTGCTGGG - Intergenic
1175067885 20:56305536-56305558 ATTTCACTGCAGTATGTAGTGGG + Intergenic
1178121628 21:29475438-29475460 CTTTCTCTGGTGCATGTGTGTGG + Intronic
1179222874 21:39425267-39425289 ATATGTCTGCTCCAGGTGGTGGG + Intronic
1182505964 22:30782654-30782676 ATTTATCTGTTGCCTGTGGATGG + Intronic
1182686883 22:32128071-32128093 CCTTCTGTGCTGAATGTGGTGGG - Intergenic
1183763923 22:39852649-39852671 ATTACTGTACTGAATGTGGTAGG + Intronic
1184875846 22:47274999-47275021 CTTTCTTTGCCCCATGTGGTAGG + Intergenic
949761055 3:7471433-7471455 GTTTCTCTGCTGACAGTGGTGGG + Intronic
950752051 3:15137408-15137430 ATTTCTCTGTTGTATGTGTGGGG + Intergenic
951120282 3:18918652-18918674 ATTTTTCTGCAGCATGTTGAAGG + Intergenic
951134726 3:19091857-19091879 ATATCTTTGCTGTATGTTGTTGG - Intergenic
951912749 3:27768576-27768598 GTTTCTCTGCTCCACATGGTGGG + Intergenic
953004088 3:38961211-38961233 ACTTCTCAGCTGCATGTTATTGG + Intergenic
953245521 3:41187920-41187942 ATTTCTCTTTTGGATGAGGTTGG - Intergenic
954507428 3:51090698-51090720 GTGTCTCTGCTGCATTTGTTTGG - Intronic
956779338 3:72591886-72591908 AGTTCCCAGCTGCATGTGGGTGG + Intergenic
957520681 3:81314400-81314422 TTTTCTCTGCTCCATATGGTGGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961495902 3:127291041-127291063 CTTTCTCTGCTGCATTTTTTGGG + Intergenic
962393733 3:134996006-134996028 ATTTCTCTCCTTCATGTGAATGG + Intronic
962924398 3:139978051-139978073 CTTTCTCTGGTGCTTGTGTTTGG - Intronic
962929785 3:140025761-140025783 ACTGCTCTACTGCATGAGGTTGG + Intronic
963007825 3:140742331-140742353 ATTGCTCTCATGAATGTGGTGGG - Intergenic
963217119 3:142760605-142760627 ATTTCTCTGAAGAATGTCGTTGG + Intronic
963252258 3:143114368-143114390 ATTGCTCTGTTCCCTGTGGTAGG - Intergenic
964335239 3:155647931-155647953 ATTCCTCTACTGCATATAGTGGG - Intronic
964448682 3:156788015-156788037 ATTTATCTGCTCCATGTGGTTGG + Intergenic
965610061 3:170534323-170534345 ATGTCTCTACTGCTTGTGCTGGG + Intronic
967497345 3:190156417-190156439 AATTCTCTGCTTGTTGTGGTTGG - Intergenic
967863764 3:194173482-194173504 ATTTATCTGATGGATGTGGCAGG + Intergenic
969382252 4:6810307-6810329 CTTTCTCTGATGTATGTTGTTGG - Intronic
969628292 4:8319879-8319901 ATTTTTATGCTGTATTTGGTAGG + Intergenic
970645759 4:18118509-18118531 ATTTCCCTTCTGCATTTAGTAGG - Intergenic
971092592 4:23362087-23362109 TTTTCCCTGCTGCATATGGAAGG - Intergenic
971741142 4:30523286-30523308 ATGTTTCTGTTGCATGTGCTTGG + Intergenic
971904451 4:32708606-32708628 TTTTCTCTTCTGCATCTGCTTGG - Intergenic
972050840 4:34731389-34731411 ATTTGTGTGCTGCATGGGATTGG - Intergenic
975042900 4:69766749-69766771 GTTTGTCTGGTGCATGTGTTTGG - Intronic
976076000 4:81299552-81299574 TTTTCTCTGCTTCATGTGTGGGG - Intergenic
976149643 4:82079087-82079109 CTTGCTCTGCTGCCTGTGGCTGG - Intergenic
976749956 4:88443829-88443851 ATTTATTTGCTGCTTGTGTTGGG + Intergenic
977073999 4:92430631-92430653 ATTTCTCTGATGAATGTCATTGG + Intronic
977364268 4:96047149-96047171 TTTTCTCTGCTGTAAATGGTGGG + Intergenic
978858404 4:113419779-113419801 ATTTCTCTGTTTCTTGTGCTTGG - Intergenic
978911268 4:114066860-114066882 ATTTCTCTCCTCCATGTCATAGG + Intergenic
979136661 4:117118694-117118716 TTTGCTGTGCTGCAGGTGGTGGG - Intergenic
979206592 4:118045978-118046000 ACTTCTTTGCTGCATCTAGTTGG - Intronic
980771459 4:137378740-137378762 ATTTCTCTGCACAATGTGGCAGG - Intergenic
982628906 4:157806367-157806389 AATTCTCTGCTCAATGCGGTGGG + Intergenic
982916467 4:161216137-161216159 ATTTCTCTGCTGTATGTTCTTGG - Intergenic
984675565 4:182543369-182543391 ATTATTCTGCTGCATCTGGTAGG + Intronic
986865541 5:11982099-11982121 GATTCTCTGATTCATGTGGTTGG - Intergenic
987056470 5:14198083-14198105 ATTTCTATGATGCATATTGTTGG - Intronic
991098526 5:62765390-62765412 GTTTCTCTGCTGTATGTGATAGG + Intergenic
991440774 5:66646143-66646165 ATTTACCTACTGCATGTTGTAGG - Intronic
991643364 5:68776171-68776193 ATTTCTCAGATGCATTTGTTTGG + Intergenic
992170150 5:74093355-74093377 CTTTCTCTGCTGCAGCTGCTGGG + Intergenic
992173331 5:74125199-74125221 GTTTCCCTGCAGCTTGTGGTGGG - Intergenic
993526162 5:88968285-88968307 ATTTCTCTGTAGAATGTTGTTGG - Intergenic
994578196 5:101608375-101608397 ATTGCCCAGCTGCATGTGCTGGG - Intergenic
1000693562 5:164352275-164352297 TTTTCTCTCCTGCTTTTGGTTGG + Intergenic
1004758899 6:18644083-18644105 ATTTCTCAGCTGTCTGTGTTGGG + Intergenic
1005069407 6:21850564-21850586 TCATCTCTGCAGCATGTGGTAGG + Intergenic
1005938641 6:30544417-30544439 ACTTCTCCGCTGCAGGAGGTGGG - Exonic
1006120408 6:31801382-31801404 ATTTCACTGCTGGAGATGGTGGG - Intronic
1006897180 6:37478649-37478671 ATTTCTCTGAGGCATATGTTAGG + Intronic
1008497295 6:52145964-52145986 ATTTCTTTGCTGCGTGTTGGAGG - Intergenic
1008875942 6:56327899-56327921 TTTTCTCAGCTGCAGGTGCTGGG - Intronic
1009508810 6:64521338-64521360 GTATCTCAGCTGCATCTGGTGGG + Intronic
1011970742 6:93219790-93219812 CTTTTTCTGCTGCATGAAGTAGG - Intergenic
1013394736 6:109723809-109723831 ACTTCTCTGGATCATGTGGTAGG - Intronic
1014633751 6:123819141-123819163 ATTGTTCTTCTGGATGTGGTAGG + Intronic
1014968632 6:127787501-127787523 ATTTCCCTGGTGCCAGTGGTAGG - Intronic
1015340547 6:132094801-132094823 ATTTCTCTGCTCCTTGGGCTTGG + Intergenic
1015810475 6:137157516-137157538 ATGTCTCTCCAGCATGGGGTAGG - Intronic
1017052097 6:150402819-150402841 ACTTCTCTGCTGCATGATATTGG + Exonic
1017207628 6:151820600-151820622 ATTTCTCTGCATAATGTCGTGGG - Intronic
1018898855 6:168040953-168040975 AATTCCCTGCAGCAGGTGGTGGG + Intronic
1023931222 7:44707800-44707822 ATCCCTCTGCTGCATGTGCCTGG - Intronic
1023939309 7:44759793-44759815 ATTTCTCTGCAGCAAGTAGAAGG - Intronic
1028122028 7:87066779-87066801 ATTGTACTGCTTCATGTGGTAGG + Intergenic
1029275838 7:99403877-99403899 ATTTGGCAGCTGCATGTGGCAGG - Intronic
1030841037 7:114354480-114354502 ATTTTTCTGCTGTACCTGGTTGG + Intronic
1031730322 7:125292407-125292429 ATTTCTCTGATGCAGGTTGCTGG + Intergenic
1032407850 7:131670113-131670135 GTTTCTCTGCTGCATAATGTGGG - Intergenic
1033052986 7:138023144-138023166 ATTTCTTTGCTGTATTAGGTTGG - Intronic
1033541719 7:142362716-142362738 ATTTCTGGGCTGCGTGTTGTAGG + Intergenic
1033673489 7:143515017-143515039 ATTTCTCTTCTGCAGAAGGTGGG - Intergenic
1033836689 7:145321985-145322007 ATTTGTCTGCTACAAGTGTTGGG + Intergenic
1035106298 7:156444417-156444439 AGTGCTGTGCTGTATGTGGTGGG + Intergenic
1036165356 8:6427701-6427723 ATCTCTCTGTTACTTGTGGTGGG + Intronic
1036246168 8:7118930-7118952 ATTTCTCTGTTGTATGTGTGGGG + Intergenic
1036968060 8:13322734-13322756 ATTTCTTTACTGCATGGGGATGG + Intronic
1040744877 8:50630058-50630080 ATTTCTATTTTGCATGTTGTTGG + Intronic
1041016141 8:53594663-53594685 ATTTCCCGGCCGCATGGGGTGGG - Intergenic
1041739507 8:61143143-61143165 ATTTGTCTGGTGGATGTGGTAGG - Intronic
1042132990 8:65607453-65607475 TTCTCACTGTTGCATGTGGTTGG - Intronic
1043601575 8:81945209-81945231 TTTTCTCTGCTTCAAGGGGTGGG + Intergenic
1045035872 8:98176214-98176236 TTTCCTCTGCTGCCTGTGGTGGG + Intergenic
1045063002 8:98424754-98424776 CTTTTTCTGCTGCATTTGGAGGG - Intronic
1045240371 8:100395400-100395422 GTTTCTCTGCTTCATGTAGGGGG + Intronic
1045430650 8:102111751-102111773 ATTTGACTGTTGCATGTGCTTGG - Intronic
1046512602 8:115218318-115218340 ATTTCTATCCTACATGTGGTAGG - Intergenic
1047839241 8:128731918-128731940 ATTTGTCTGTTACATCTGGTTGG + Intergenic
1048486322 8:134851054-134851076 ATCTCACTGCTGCTTGTCGTGGG + Intergenic
1048662516 8:136621239-136621261 TTTTCTGTACTGCTTGTGGTTGG - Intergenic
1049581145 8:143411544-143411566 ACTTCTCAGCTGCATTTGTTAGG - Intergenic
1049903712 9:195862-195884 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1051724602 9:20076109-20076131 ATTTTTGAGCTGCATTTGGTGGG + Intergenic
1052572889 9:30251044-30251066 CTTTCTTTGGTGCATGTGGATGG - Intergenic
1053746718 9:41206166-41206188 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1054480566 9:65659191-65659213 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
1054681627 9:68225116-68225138 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
1055535138 9:77233885-77233907 ATTTGTCTGTTACATGTAGTTGG + Intronic
1056960593 9:91118806-91118828 ATTGCTCGGCTGCAAGAGGTGGG - Intergenic
1058604361 9:106704826-106704848 ATTTCTCTGCTCCCTGGGGGTGG - Intergenic
1059056578 9:110987737-110987759 ATTTCTGATCTGCATTTGGTTGG + Intronic
1059443340 9:114323311-114323333 CTTTCCCTGCTGGCTGTGGTCGG + Intronic
1059957888 9:119537051-119537073 ACTCCTCTGGTCCATGTGGTGGG + Intergenic
1061902448 9:133679956-133679978 ATTCCTCGCCTGCATCTGGTTGG + Intronic
1062093607 9:134691291-134691313 CCTTCTCTGCTGGATGTGGGTGG + Intronic
1202782848 9_KI270718v1_random:16945-16967 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1185959682 X:4535589-4535611 ATGACTCTGCTGCATGTGAAAGG + Intergenic
1186455745 X:9708523-9708545 ATTTCTCTCCTGCAGGTGAGTGG - Intronic
1188129441 X:26413184-26413206 ATTTCTTAGCTGCCTTTGGTAGG - Intergenic
1188310204 X:28607700-28607722 ACTCCTCTGCTGCTTGTGGGTGG + Intronic
1188779818 X:34268073-34268095 ATTGCTCTGCTCCATTTGATTGG - Intergenic
1190230294 X:48576493-48576515 ATTTTTCTGCTCTAGGTGGTGGG + Exonic
1194130634 X:90076880-90076902 TTTTCTCTGATGCATGTGCTGGG + Intergenic
1195528597 X:105924458-105924480 ATTTCTCAGATGCATTTGGATGG - Intronic
1196193167 X:112814743-112814765 CTTTCTCTGTTGTATGTGGGGGG - Intronic
1197449845 X:126598675-126598697 ATTTTGCAGCTGGATGTGGTAGG - Intergenic
1198493943 X:137171493-137171515 TTTTCTCAGCTGAATGTGGGGGG + Intergenic
1199140774 X:144309265-144309287 CTTTCTTTGCAGCATGTGATGGG + Intergenic
1202179383 Y:22126568-22126590 ATTGCTGTGCTCCAGGTGGTGGG - Intergenic
1202211978 Y:22459826-22459848 ATTGCTGTGCTCCAGGTGGTGGG + Intergenic